CN117466987A - TNF-alpha derived polypeptide, nano selenium compound peptide, preparation method and application - Google Patents

TNF-alpha derived polypeptide, nano selenium compound peptide, preparation method and application Download PDF

Info

Publication number
CN117466987A
CN117466987A CN202311204545.XA CN202311204545A CN117466987A CN 117466987 A CN117466987 A CN 117466987A CN 202311204545 A CN202311204545 A CN 202311204545A CN 117466987 A CN117466987 A CN 117466987A
Authority
CN
China
Prior art keywords
tnf
polypeptide
polysaccharide
alpha
nano
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202311204545.XA
Other languages
Chinese (zh)
Inventor
陈梦
马天瑜
马义
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jinan University
Original Assignee
Jinan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jinan University filed Critical Jinan University
Priority to CN202311204545.XA priority Critical patent/CN117466987A/en
Publication of CN117466987A publication Critical patent/CN117466987A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/525—Tumour necrosis factor [TNF]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/52—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an inorganic compound, e.g. an inorganic ion that is complexed with the active ingredient
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/61—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule the organic macromolecular compound being a polysaccharide or a derivative thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K17/00—Carrier-bound or immobilised peptides; Preparation thereof
    • C07K17/02—Peptides being immobilised on, or in, an organic carrier
    • C07K17/10—Peptides being immobilised on, or in, an organic carrier the carrier being a carbohydrate
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K17/00—Carrier-bound or immobilised peptides; Preparation thereof
    • C07K17/14—Peptides being immobilised on, or in, an inorganic carrier
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Inorganic Chemistry (AREA)
  • Toxicology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses a TNF-alpha derived polypeptide, a nano selenium compound peptide, a preparation method and application thereof. The invention is based on genetic engineering technology and nano drug loading technology, and the solubility of the P16 is obviously improved by mutating the first two LL amino acids at the N end of the small molecule polypeptide P16 to generate the derivative polypeptide VP16; and secondly, the nano selenium modified by chitosan is used as a carrier, and is covalently coupled with TNF-alpha derived polypeptide VP16 to prepare the nano selenium composite peptide, which has the advantages of high anti-tumor activity, long half-life, high solubility, small side effect and the like. According to the experimental result of Du145 transplanted tumor nude mice, the pharmacodynamics effect of the polypeptide SCP is better than that of estramustine clinically used for prostate cancer, and the toxic and side effects are smaller.

Description

TNF-alpha derived polypeptide, nano selenium compound peptide, preparation method and application
Technical Field
The invention relates to the fields of genetic engineering, molecular biology and biological medicine, in particular to a TNF-alpha derived polypeptide, a nano selenium composite peptide, a preparation method and application thereof.
Background
Prostate cancer is the second largest malignancy in men, with a high incidence of age above 65 years, with positive correlation between morbidity and mortality and age, and a significant tendency to younger. Because of the extremely high concealment of prostate cancer, the prostate cancer has long latency and insignificant symptoms, often reaches middle and late stages once diagnosed, is extremely difficult to cure and has short survival time. Prostate cancer is classified into localized prostate cancer, metastatic prostate cancer, and castration-resistant prostate cancer (CRPC) according to the progression. Almost all prostate cancer patients eventually develop CRPC, which is also the leading cause of death for the patient.
Prostate cancer is an androgen-dependent tumor, and Androgen Deprivation Therapy (ADT) has been the standard treatment for prostate cancer, in addition to traditional surgical, chemoradiotherapy, hormonal, and targeted therapies. ADT, although effective in the early stage, also destroys the normal endocrine environment in men, presents certain complications, and is ineffective for patients who develop CRPC. In addition, the immune response is weaker due to the lower mutation load of prostate cancer tumor and lack of T cell infiltration. Clinical trials were terminated with failure, whether CTLA-4 inhibitors, PD-1/PD-L1 inhibitors or combinations. Therefore, development of a prostate cancer therapeutic drug capable of directly killing tumor cells and improving the sensitivity of immunotherapy is needed to improve the survival quality of prostate cancer patients.
The tumor necrosis factor TNF-alpha is the cell factor with the strongest anti-tumor effect, is the only cell factor capable of directly killing tumor, and has great tumor treatment potential. TNF- α antitumor mechanisms mainly include: inducing tumor cell apoptosis, inhibiting tumor angiogenesis, enhancing immunity, etc. In addition, many studies report that TNF- α can increase tumor T cell infiltration, increase vascular permeability, and assist drugs and immune cells to cross tumor barriers into the tumor. However, TNF-alpha brings about very strong systemic toxicity to the body at effective antitumor concentrations, greatly limiting the development of TNF-alpha anticancer drugs. The invention develops the small molecular polypeptide P16 capable of specifically activating the receptor TNFR I by comparing various vertebrate TNF-alpha sequences in the early stage, reduces the side effect, but has poor solubility, poor stability and short half-life (5-10 min), and limits the clinical application value.
Disclosure of Invention
The primary object of the present invention is to overcome the disadvantages and shortcomings of the prior art and to provide a TNF-alpha derived polypeptide. The TNF-alpha derived polypeptides have higher solubility.
Another object of the present invention is to provide a nano selenium compound peptide. The nano selenium compound peptide has higher solubility, anti-tumor effect, longer half life and smaller side effect.
The aim of the invention is achieved by the following technical scheme:
a TNF- α derived polypeptide having the amino acid sequence shown below: VVTHTISRIAVSYQTKVNLL.
A nucleic acid molecule which encodes a TNF- α derived polypeptide as described above; preferably as follows:
GTGGTGACCCATACCATTAGCCGCATTGCGGTGAGCTATCAGACCAAAGTGAATCTG CTG。
the TNF-alpha derivative polypeptide can be directly synthesized or cloned into an expression vector, and the obtained recombinant vector is transformed into a host cell for expression; then collecting thalli for crushing, collecting supernatant of the crushed bacterial liquid for purifying to obtain the TNF-alpha derivative polypeptide.
The expression vector is preferably a pKYB vector.
The host cell is preferably E.coli ER2566.
The expression is preferably performed as follows: after the host cells containing the recombinant vector are subjected to expansion culture, IPTG is added for induction expression.
The conditions of the expansion culture are preferably 35-38 ℃ and 150-250 rpm; more preferably at 37℃and 200 rpm.
The degree of the expansion culture is preferably a culture to OD 600 0.6.
The conditions of the induced expression are preferably 35-38 ℃ and 150-250 rpm for 4-8 hours; more preferably, the induction of expression is carried out at 37℃and 200rpm for 6 hours.
The disruption is preferably disruption using a low temperature ultra high pressure continuous flow cell disruptor.
The purification is performed by using a chitin column; the specific operation is preferably as follows: loading the supernatant into a chitin column, then adding a solution containing mercaptan into the column, passing the column and filling the chitin column with the solution for reaction, and eluting;
the composition of the thiol-containing solution is as follows: 20mM Tris-HCI,0.5mM NaCl,1mMEDTA,50mM beta-mercaptoethanol, pH 8.0;
the composition of the eluted solution is as follows: 20mM Tris-HCl,500mMNaCl,1mM EDTA,pH 8.0.
A nano selenium compound peptide is obtained by modifying nano selenium-loaded activated TNF-alpha derivative polypeptide with polysaccharide; preferably prepared by the following steps:
(1) Dripping the activated TNF-alpha derivative polypeptide solution into polysaccharide modified nano selenium, and stirring for reaction;
(2) And dialyzing the reaction product to obtain the nano selenium compound peptide.
The stirring reaction condition in the step (1) is preferably 2-8 ℃ and stirring is carried out at 100-500 rpm for 8-12 hours; more preferably at 4℃and 300rpm for 8 to 12 hours.
The polysaccharide modified nano selenium is preferably prepared by the following steps: uniformly mixing sodium selenite and polysaccharide in water, and adding a reducing agent for reaction; and (3) dialyzing after the reaction is finished to obtain the polysaccharide modified nano selenium.
The polysaccharide is preferably chitosan.
The addition amount of the chitosan is as follows: polysaccharide=mass ratio 9-11: 1, calculating; more preferably as sodium selenite: polysaccharide = mass ratio 10:1 calculation.
The reducing agent is preferably ascorbic acid.
The reducing agent is added into the reaction system in a dropwise manner. The addition of the reducing agent is stopped when the color of the reaction product no longer changes.
The reaction is carried out in the dark.
The activated TNF-alpha derived polypeptide is preferably obtained by the steps of: dissolving the TNF-alpha derivative polypeptide by using DMSO, then using water to fix the volume, and then adding an amide activator for reaction to obtain the activated TNF-alpha derivative polypeptide.
The dosage of DMSO is preferably 2-3 mu L of DMSO per mg of TNF-alpha derived polypeptide.
The volume of the constant volume is preferably 1mL per 1-3 mg TNF-alpha derived polypeptide.
The amide activator is EDC and NHS with the mass ratio of 1.5-2.5: 1, the amide activator obtained; preferably EDC and NHS in a mass ratio of 2:1, and an amide activator obtained by the method.
The amide activator is preferably used in an amount to derivatize the polypeptide according to TNF- α: amide activator = mass ratio 10: 1-2 proportion; more preferably, the polypeptide is derived from TNF- α: amide activator = mass ratio 10:1 proportion.
The reaction conditions are preferably 2-8 ℃ and 100-500 rpm for stirring for 60-180 min; more preferably at 4℃and 300rpm for 120min.
The polysaccharide modified nano-selenium and the activated TNF-alpha derivative polypeptide are preferably prepared by modifying polysaccharide in the nano-selenium according to the polysaccharide: TNF- α derived polypeptide after activation = mass ratio 0.08:1.5 to 2.5; more preferably, the polysaccharide in the nano selenium is modified by polysaccharide: TNF- α derived polypeptide after activation = mass ratio 0.08:2, calculating.
The application of the TNF-alpha derived polypeptide or the nano selenium composite peptide in preparing medicaments for treating diseases related to TNFR I type receptor.
The diseases associated with TNFR type I receptor include prostate cancer.
The medicine plays the following roles: promoting tumor cell apoptosis, promoting tumor cell cycle block, and inhibiting tumor neovascular.
Compared with the prior art, the invention has the following advantages and effects:
the invention is based on genetic engineering technology and nano drug-loading technology, and the solubility of the P16 is obviously improved by mutating the first two LL amino acids at the N end of the small molecule polypeptide P16 to generate the derivative polypeptide VP16. And secondly, chitosan modified nano selenium (SeNPs-CTS, SC) is used as a carrier, and is covalently coupled with TNF-alpha derived polypeptide VP16 to prepare TNF-alpha derived polypeptide and nano selenium composite peptide (SeNPs-CTS-VP 16, SCP), and the nano selenium composite peptide has the advantages of high antitumor activity, long half-life, high solubility, small side effect and the like.
(1) The TNF-alpha derived polypeptide and the nano selenium compound peptide SCP prepared by the invention are recombinant derivatives of natural TNF-alpha, contain a TNF-alpha core anti-tumor sequence, and have higher targeting and anti-tumor activity compared with the natural TNF-alpha.
(2) The gene recombinant polypeptide SCP overcomes the defect of poor solubility of the earlier-stage TNF-alpha derived polypeptide P16, and the SCP solubility is remarkably improved by carrying out site-directed mutation on the first two amino acids at the N end of the polypeptide P16.
(3) The invention utilizes the nano drug carrier technology, on one hand, the slow release function can obviously increase the half life of the drug in vivo, and on the other hand, the nano selenium has the excellent anti-tumor property. In addition, the invention also utilizes chitosan to modify nano-selenium SC so as to increase the stability of nano-selenium loaded drugs. The SC and the TNF-alpha derivative polypeptide VP16 are coupled to achieve dual anti-tumor effect.
Drawings
FIG. 1 is a graph showing the results of solubility analysis of VP16 polypeptides; wherein, (A) is a standard curve of a standard bovine serum albumin after gradient dilution; (B) absorbance at 562nm for each group.
FIG. 2 is a graph showing the weight results of each group of tumors.
FIG. 3 is a graph showing the results of HE staining (200X) of five organs and tumors in each group.
Detailed Description
The present invention will be described in further detail with reference to examples and drawings, but embodiments of the present invention are not limited thereto.
Unless specific test conditions are noted in the following embodiments, conventional test conditions or test conditions recommended by the reagent company are generally followed. The materials, reagents and the like used are those obtained commercially unless otherwise specified. EXAMPLE 1 preparation of recombinant nanoselenium complex peptide SCP for the treatment of prostate cancer
The TNF-alpha derivative polypeptide P16 with good anti-tumor activity is obtained by comparing the TNF-alpha sequences of nine vertebrates in the early stage, and the amino acid sequence is as follows:LLTHTISRIAVSYQTKVNLL, the nucleotide sequence of which is shown as SEQ ID NO. 4. On this basis, two LL amino acids (underlined in the sequence) were subjected to site-directed mutagenesis and then joined to chitosan-modified nanoselenium (Senps-CTS, SC) via an amide bond to form SCP (Senps-CTS-VP 16).
The preparation method comprises the following steps:
(1) Amino acid site-directed mutagenesis: LL amino acid is designed to carry out site-directed mutagenesis, three primers are designed by using Primer X design of mutagenic primers for site-directed mutagenesis according to the design principle of the primers and the kit, and the VP16 gene is obtained by carrying out chain extension reaction and then PCR reaction by adopting overlap PCR.
Primer F1:
5'-GGTGGTCATATGGTGGTGACCCATACCATTAGCCGC-3'；
primer F2:
5'-GGTCTGATAGCTCACCGCAATGCGGCTAAT-3'；
primer F3:
5'-CCACCATGCTCTTCCGCACAGCAGATTCACTTTGGTCTG-3'。
wherein,CATATGis an Nde I enzyme cutting site,GCTCTTCCGCAis BspQ I restriction enzyme site; GGTGGT and CCACCAT are protecting bases; wherein,GTGGTGis a post-mutation sequence.
The chain extension reaction system is as follows: primer F1 (10. Mu.M) 2. Mu.L, primer F2 (10. Mu.M) 2. Mu.L, 10X TaKaRa LA PCR Buffer (Mg) 2+ plus)5μL，dNTP8μL，TaKaRa LA Taq0.5μL，H 2 O 32.5μL。
The extension reaction conditions are as follows: 94℃for 10min,60℃for 5min and 72℃for 10min.
The PCR (50. Mu.L) reaction system was constructed as follows: primer F1 (10. Mu.M) 2. Mu.L, primer F3 (10. Mu.M) 2. Mu.L, extension reaction solution 1. Mu.L, dNTP 4. Mu.L, 10 XTaKaRa Ex Buffer 5. Mu.L, taKaRaTaq 0.5. Mu.L, H 2 O 36.5μL。
The reaction conditions are as follows: 94 ℃ for 5min;94℃for 30s, 60℃for 30s, 72℃for 30s,31 cycles; extending at 72℃for 10min. After the PCR was completed, 3. Mu.L of the sample was subjected to agarose gel electrophoresis, and the result was observed, and after the phase formation, the sample was purified to obtain a PCR product.
(2) Construction of recombinant expression vector pKYB-VP 16: the PCR product obtained in the above step and vector pKYB1 (company of New England Biolabs (NEB) in the United states) were digested with NdeI and BspQI (isozymes of SapI, company of New England Biolabs (NEB)). And (3) carrying out agarose gel electrophoresis on the vector pKYB1 after enzyme digestion, and cutting, recovering and purifying. Connecting the VP16 gene after double enzyme digestion and the vector pKYB1 after gel digestion, and establishing a connection system to form the pKYB-VP16 recombinant plasmid.
(3) Construction of engineering bacteria: by CaCl 2 E.coli (E.coli) ER2566 strain competent cells were prepared by the method, recombinant plasmid pKYB-VP16 was added into competent cell suspension, mixed with ice bath for 20min, heat-shocked for 60s at 42 ℃, added with SOC culture solution preheated at 37℃and shake-cultured at 37℃for 45min. And uniformly coating 200 mu L of the transformed bacterial liquid on an LB plate (containing 100 mu g/mL of kanamycin), standing for about 20min, and after the coated liquid is dried, carrying out inverted-buckling on the plate, and carrying out constant-temperature static culture at 37 ℃ for 13-16h until obvious colonies grow.
(4) Screening and identification of positive clones: after transformation, positive monoclonal colonies are picked into 5mL LB culture medium (containing 100 mug/mL kanamycin), amplified culture is carried out at 220rpm on a shaking table at 37 ℃ for 12h, the plasmids are extracted, PCR identification is carried out, and plasmid DNA sequencing verification (Hua Dagen) is carried out by using a T7 promoter primer, so that engineering bacteria pKYB-VP16-ER2566 is obtained.
(5) Inducible expression of recombinant fusion protein VP 16-intein-CBD: engineering bacteria pKYB-VP16-ER2566 are mixed according to the volume ratio of 1:100 were inoculated into 2 bottles of 200mL LB medium (containing 100. Mu.g/mL of kana)Plain), shaking table 200rpm culture at 37℃to OD 600 About 0.6, isopropyl-. Beta. -D-thiogalactoside (IPTG) was added to one of the flasks to a final concentration of 1mM, and the other flask was centrifuged at 6000rpm for 15min after induction of expression at 200rpm at 37℃for 6 hours without adding IPTG as a negative control, to collect the cells. The cells were resuspended in Buffer A solution (20 mM Tris-HCl pH8.0, 500mM NaCl,1mM EDTA, 0.1% Triton-X100) at m/V (g/mL) =1/10, and then crushed with a low temperature and ultra high pressure continuous flow cell crusher in an ice bath at a low temperature under conditions that the concentration of the diluted cells in Buffer A solution was 18% (m/V), the crushing pressure was 1700bar, and the cooling temperature was 4 ℃. The crushed product was centrifuged at 20000rpm at 4℃for 30min, and the supernatant was collected. The induction of expression of the fusion protein VP16-intein-CBD was detected by 12% SDS-PAGE.
(6) Purification and preparation of intein-mediated recombinant polypeptide VP 16: passing the supernatant collected in the step (5) through a chitin column, passing a solution containing mercaptan through the column and filling the chitin column for reaction for 24 hours at 16 ℃, eluting and collecting target peptide, performing electrophoresis identification, preparing the genetically engineered polypeptide VP16 by using High Performance Liquid Chromatography (HPLC), analyzing the purity of the polypeptide VP16, and freeze-drying the prepared target peptide. Wherein the composition of the thiol-containing solution is as follows: 20mM Tris-HCI,0.5mM NaCl,1mM EDTA,50mM beta-mercaptoethanol, pH8.0, deionized water as solvent; the composition of the solution eluting the chitin column was as follows: 20mM Tris-HCl,500mM NaCl,1mM EDTA,pH 8.0, the solvent is deionized water. The HPLC procedure was as follows: mobile phase a is obtained by adding trifluoroacetic acid (TFA) into 10% acetonitrile (CNCH, pure water as solvent) by volume percentage, wherein the final concentration of TFA is 0.1% by volume percentage; mobile phase B is 100% of CNCH added with TFA, the final concentration of TFA is 0.1% by volume, the flow rate is 1mL/min, and the linear gradient elution is carried out for 20 min; the mobile phase B in the linear gradient elution is used for collecting the target peptide elution peak from 0-60% (v/v), and the light absorption detection wavelength is 218nm.
(7) Preparing a nano selenium carrier SC: 1mL of sodium selenite solution with the concentration of 5mM is added into a clean sterile small beaker, then 100 mu L of chitosan solution with the concentration of 0.8mg/mL is added, after uniform mixing and standing, 1mL of ascorbic acid solution with the concentration of 20mM is added dropwise, and shaking is carried out while adding (preferably light-shielding)) Stirring with magnetic stirrer at 300rpm for 5-10min until color is no longer deepened, standing at 4deg.C for 30min, and dialyzing at 4deg.C for 8-12 hr to obtain chitosan modified nano selenium carrier SC. Wherein Na is 2 SeO 3 The preparation steps of (5 mM) were as follows: weigh 8.7mg Na 2 SeO 3 Dissolving the powder in a proper amount of ultrapure water, then fixing the volume to 10mL, and preserving the powder in a dark place at 4 ℃; the Vc solution (20 mM) was prepared as follows: weighing 35.2mg of Vc powder, dissolving in a proper amount of ultrapure water, then fixing the volume to 10mL, and preserving at 4 ℃ in a dark place; CTS solution (0.8 mg/mL) was prepared as follows: 8mg of chitosan CTS powder was weighed and dissolved in 1% glacial acetic acid solution to 10mL and stored at 4 ℃.
(8) Preparing VP16 polypeptide solution: weighing 2mg of the polypeptide prepared in the step (6), adding 5 mu L of DMSO for dissolution, using ultrapure water to fix the volume to 1mL, adding 0.2mg of EDC/NHS (uniformly mixed in the ratio of m/m=2:1) amide activator, and stirring at 300rpm for 2 hours at 4 ℃ to obtain VP16 polypeptide solution.
(9) Preparing nano selenium compound peptide SCP: adding the nano selenium carrier SC solution prepared in the step (7) into a clean sterile beaker, dropwise adding the VP16 polypeptide solution obtained in the step (8) into the clean sterile beaker, using ultrapure water to fix the volume to 5mL, stirring at 300rpm for 8-12h, dialyzing for 12h in a dialysis bag with the molecular weight cut-off of 6000-8000D to remove unreacted substances, thus obtaining the nano selenium compound peptide SCP, measuring the selenium content in the mutant SCP by using ICP-AES, and measuring the polypeptide content by using HPLC. The HPLC determination of the polypeptide release amount was as follows: 5mg of SCP powder was dissolved in 5mL of PBS (pH 7.4, 0.01 mol/L) and filled into the same amount of the above-mentioned cutoff dialysis bag, followed by placing in a hard glass tube containing 50mL of PBS solution, shaking at a constant speed of 37℃with 1mL of PBS solution being sucked every 2 hours, and an equal amount of fresh PBS solution being added back, the concentration of VP16 polypeptide was measured by using an HPLC system (Agilent 1100) equipped with a mu-Bondapak C18 (4X 300 mm) column, and the drug release amount was calculated. The detection wavelength was set at 225nm, 125mL of acetonitrile was mixed with 875mL of 0.05mM potassium dihydrogen phosphate buffer solution (pH 6.0) in a 1mL vacuum flask to obtain a mobile phase, and the flow rate was set at 1.0mL/min.
EXAMPLE 2VP16 solubility analysis
With reference to the preparation method of example 1 (steps (1) to (6)), VP16 was prepared; referring to the preparation method of example 1 (step (1) to step (9)), the nano selenium compound peptide SCP is prepared.
Wherein TNF-alpha and Estramustine (Est) are purchased from Italy pharmacia, and polypeptide P16 is synthesized by Baiottai Biotech (Guangzhou).
The solubility was measured as follows:
(1) 10mg of each group of samples was weighed and added to a test tube, and 5mL of physiological saline was added to dissolve uniformly.
(2) The test tube was placed in a 37℃thermostatted shaker and shaken evenly at 125rpm to allow the polypeptide to dissolve well.
(3) The solution was filtered through a 0.22 μm filter to remove impurities and undissolved polypeptide particles.
(4) According to the solution A: solution B = 50:1 ratio, and BCA working fluid was prepared. Standard proteins were serially diluted in distilled water to the following concentrations: 2000. 1000, 500, 250 and 0 mug/mL, 10 mu L of the filtrate obtained in the step (3) is taken, 20 mu L of distilled water is added into each hole to dilute the protein of the sample by 3 times, and the protein of the sample is uniformly mixed by shaking.
(5) 10. Mu.L of diluted standard protein and sample protein was taken, and 200. Mu.L of BCA working solution was added thereto. The 96-well plate was placed in an incubator at 37℃and incubated for 30min in the absence of light. The absorbance of each well at 450nm is detected by an enzyme-labeled instrument, and the higher the absorbance is, the higher the protein concentration in the filtrate is, and the better the protein solubility is.
As a result, as shown in FIG. 1, FIG. 1 (A) is a standard curve obtained from OD values measured at 562nm after a gradient dilution of 2000. Mu.g/mL bovine serum albumin standard, R 2 A closer to 1 indicates a more reliable result; the (B) in fig. 1 is the OD value measured at 562nm for each group, which shows a significant increase in VP16 group OD value compared to P16, with higher concentrations in physiological saline, indicating that VP16 is more soluble than P16.
Example 3 in vivo half-life study of Nano-selenium Compound peptide SCP animal level
(1) 264 Kunming mice (from the medical laboratory animal center, guangdong province) were selected and weighing 25-30 g and were randomly divided into four groups of 66 animals each.
(2) Each group of mice was injected with SCP, VP16, P16 and TNF-. Alpha.at the same time in a dose of 5mg/kg. Then, the groups are randomly divided into eleven groups, and blood is taken according to time points of 0min, 15min, 30min, 1h, 2h, 4h, 8h, 12h, 16h, 24h and 48h respectively.
(3) OD values of each set of serum mutations SCP, VP16, P16 and TNF- α were tested at different time points according to ELISA kit instructions.
(4) The content of each group was calculated according to the standard curve of ELISA kit, and the half-life of the four drugs in the Kunming mice was simulated by using pharmacokinetic software 3p 97.
In vivo pharmacokinetic parameters are shown in Table 1, the half life of SCP in vivo is 13.52h, and the half life of TNF-alpha in vivo is only 25.8min, which is consistent with the half life of TNF-alpha reported in literature being only 30 min; it can be seen that VP16 effectively prolongs the half-life of VP16 in vivo under the loading of carrier SC. The area under the blood concentration-time curve (AUC) of SCP is 11.1 times that of VP16; whereas the plasma Clearance (CL) of VP16 is 11.8 times that of SCP, indicating that the clearance of SCP in vivo is much lower than VP16. These results indicate that vector SC can sufficiently prolong the half-life of VP16 in vivo, thereby exerting drug effects.
TABLE 1 in vivo pharmacokinetic parameters in mice
EXAMPLE 4 investigation of the Effect and toxic side Effect of nano-selenium Compound peptide SCP on DU145 nude mice transplantable tumor
In order to examine whether SCP also has an effect of inhibiting tumor growth in animals and an effect of toxic and side effects on organs, a model of a transplanted tumor was used in which human prostate cancer cells DU145 (derived from Shanghai cell institute of China academy of sciences) prepared by a preliminary experiment were transplanted to the armpit of nude mice.
(1) And selecting 40 BALB/c-nu male nude mice (from medical laboratory animal centers in Guangdong province), wherein the weight is 18-20g after 4 weeks, and when the nude mice are fed and isolated for one week, the feeding and water intake are normal and abnormal disease phenomenon does not exist, so that the model for constructing the subcutaneous transplantation tumor can be prepared.
(2) DU145 cells in log phase with good status were collected and placed on ice. Disinfection of the right dorsal skin of nude mice of the experimental group with alcohol cotton ball, 100. Mu.L of cell suspension (1X 10) was subcutaneously injected in the armpit part of each BALB/c-nu nude mouse 7 Individual cells). The injected cells should be treated within 30min so as not to affect cell viability. After one week of inoculation of the cells, the armpit of the nude mice can grow into tumor blocks with the size of 50mm, and the tumor formation rate is 100%.
(3) After successful molding, the compositions were randomly divided into 8 groups of 5 animals each, and each group was administered once daily for 30 days according to the following schedule. Wherein the Se group is a single nano-selenium carrier (the specific preparation steps are the same as those of the step (7) of the example 1 except that the chitosan CST is not added for modification).
Table 2 administration procedure for mice of each group
(4) Observing tumor volume and nude mice weight change, collecting blood sample from orbit blood (heparin sodium blood collection tube) after treating mice, detecting, standing for 30min, centrifuging at 10000rpm for 15min, taking serum, placing in EP tube, immediately delivering to clinical laboratory of first affiliated hospital of Nanjiao university for blood biochemical index detection, and collecting five viscera of each mouse of each group for calculation and then HE staining.
The tumor weight change of each group is shown in figure 2, and the result shows that the average tumor inhibition rate of SCP is highest and reaches more than 50% excluding inflammatory necrosis caused by TNF-alpha, which indicates that the nano selenium compound peptide SCP has better growth inhibition effect on DU145 prostate cancer nude mice transplantation tumor, and then VP16 and Est; the results also show that both SeNPs and SC alone have some tumor inhibiting effect. The carrier SC effectively prolongs the half-life period of VP16 in vivo, reduces the renal clearance rate, and can achieve the synergistic anti-tumor effect by combining the two.
In addition, according to HE staining analysis of five organs of each group of nude mice, the results are shown in fig. 3: the nano selenium compound peptide SCP has no obvious damage and destruction to liver function and kidney function of nude mice transplanted with tumor, which indicates that the nude mice transplanted with tumor are safe in vivo. The positive control drug Est and TNF-alpha group have a certain damage to liver cells, which leads to obvious damage to liver synthesis function. And has no obvious toxic and side effects on other five organs.
The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.

Claims (10)

1. A TNF- α derived polypeptide, characterized by: the amino acid sequence of the TNF-alpha derivative polypeptide is shown as SEQ ID NO. 1.
2. A nucleic acid molecule characterized in that: the nucleic acid molecule is a nucleic acid encoding the TNF-alpha derivative polypeptide of claim 1.
3. The nucleic acid molecule of claim 2, wherein: the sequence of the nucleic acid molecule is shown as SEQ ID NO. 2.
4. A method of producing a TNF- α derived polypeptide of claim 1, comprising the steps of: cloning the nucleic acid molecule of claim 2 into an expression vector, and transforming the obtained recombinant vector into a host cell for expression; then collecting thalli for crushing, collecting supernatant of the crushed bacterial liquid for purifying to obtain the TNF-alpha derivative polypeptide.
5. The method of producing a TNF- α derived polypeptide of claim 4 wherein:
the expression vector is a pKYB vector;
the host cell is escherichia coli ER2566;
the expression is performed as follows: after the host cells containing the recombinant vector are subjected to expansion culture, IPTG is added for induction expression;
the purification is performed by using a chitin column.
6. The method of producing a TNF- α derived polypeptide of claim 5 wherein:
the conditions of the expansion culture are that the culture is carried out at 35-38 ℃ and 150-250 rpm;
the degree of the expansion culture is that the culture is carried out until OD 600 0.6;
the conditions of the induced expression are that the induced expression is carried out for 4 to 8 hours at the temperature of 35 to 38 ℃ and at the speed of 150 to 250 rpm;
the specific operation of the purification is as follows: loading the supernatant into a chitin column, then adding a solution containing mercaptan into the column, passing the column and filling the chitin column with the solution for reaction, and eluting;
the composition of the thiol-containing solution is as follows: 20mM Tris-HCI,0.5mM NaCl,1mMEDTA,50mM beta-mercaptoethanol, pH 8.0;
the composition of the eluted solution is as follows: 20mM Tris-HCl,500mMNaCl,1mM EDTA,pH 8.0.
7. A nano selenium composite peptide, which is characterized in that: is obtained by modifying nano selenium loaded and activated TNF-alpha derivative polypeptide in claim 1 with polysaccharide.
8. The nano-selenium composite peptide of claim 7, wherein:
the polysaccharide modified nano selenium is prepared by the following steps: uniformly mixing sodium selenite and polysaccharide in water, and adding a reducing agent for reaction; dialyzing after the reaction is finished to obtain polysaccharide modified nano selenium;
the activated TNF-alpha derivative polypeptide is obtained by the following steps: dissolving the TNF-alpha derivative polypeptide by using DMSO, then using water to fix the volume, and then adding an amide activator for reaction to obtain the activated TNF-alpha derivative polypeptide;
the polysaccharide modified nano selenium and the activated TNF-alpha derivative polypeptide are prepared by modifying polysaccharide in the nano selenium according to the polysaccharide: TNF- α derived polypeptide after activation = mass ratio 0.08:1.5 to 2.5.
9. The nano-selenium composite peptide of claim 8, wherein:
the polysaccharide is chitosan;
the addition amount of the polysaccharide is as follows: polysaccharide=mass ratio 9-11: 1, calculating;
the reducing agent is ascorbic acid;
the reducing agent is added into the reaction system in a dropwise manner;
the reaction is carried out under the condition of avoiding light;
the amide activator is EDC and NHS with the mass ratio of 1.5-2.5: 1, the amide activator obtained;
the usage amount of the amide activator is that the polypeptide is derived from TNF-alpha: amide activator = mass ratio 10: 1-2 proportion.
10. Use of a TNF- α derived polypeptide of claim 1 or a nano-selenium complex peptide of any of claims 7-9 in the manufacture of a medicament for treating a disease associated with a TNFR type i receptor.
CN202311204545.XA 2023-09-19 2023-09-19 TNF-alpha derived polypeptide, nano selenium compound peptide, preparation method and application Pending CN117466987A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311204545.XA CN117466987A (en) 2023-09-19 2023-09-19 TNF-alpha derived polypeptide, nano selenium compound peptide, preparation method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311204545.XA CN117466987A (en) 2023-09-19 2023-09-19 TNF-alpha derived polypeptide, nano selenium compound peptide, preparation method and application

Publications (1)

Publication Number Publication Date
CN117466987A true CN117466987A (en) 2024-01-30

Family

ID=89632042

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311204545.XA Pending CN117466987A (en) 2023-09-19 2023-09-19 TNF-alpha derived polypeptide, nano selenium compound peptide, preparation method and application

Country Status (1)

Country Link
CN (1) CN117466987A (en)

Similar Documents

Publication Publication Date Title
JP6812403B2 (en) Gla domain as a targeting agent
CN106565836B (en) High affinity soluble PDL-1 molecules
CN112724259B (en) Fusion protein of human serum albumin and interleukin 2 and application thereof
WO2013003987A1 (en) Tumor-targeted tumor necrosis factor-related apoptosis ligand variant and use thereof
WO2021027704A1 (en) Application of polypeptide or derivative thereof
KR100886783B1 (en) N-terminal modified PEG-TRAIL, method for preparing and uses thereof
CA2848118C (en) Endostatin mutants with mutations at atp binding sites
CN111373034A (en) Recombinant uricase
US20110077206A1 (en) Use of hnf4alpha for treatment of human malignant solid tumors through induction-differentiation therapy
WO2022078185A1 (en) Interleukin-2 mutant
CN106029683B (en) Polypeptide and polypeptide compound for inhibiting tumor metastasis and treating leukemia, and preparation method and application thereof
CN111777667B (en) Small peptide and application thereof in preparation of immunoregulation medicine
CN111187345B (en) High-affinity TCR for identifying AFP
WO2015055148A1 (en) Yap protein inhibiting polypeptide and application thereof
CN108440673A (en) Fc fusion proteins PD1/FGFR1 and its application
KR20210142666A (en) High-affinity TRF to identify APF antigens
CN111979213A (en) Novel coronavirus SARS-CoV-2 main proteinase and alkannin compound crystal and preparation method thereof
CN117466987A (en) TNF-alpha derived polypeptide, nano selenium compound peptide, preparation method and application
JP2022502078A (en) High affinity T cell receptor that identifies AFP antigen
CN110156889B (en) High affinity HBs T cell receptor
RU2285537C1 (en) Antitumor peptide preparation based on alpha-fetoprotein fragment, its conjugate, pharmaceutical composition and method for treatment of hormone-dependent tumors
CN112225820B (en) Recombinant human serum albumin-collagen binding domain fusion protein of tumor specific targeting matrix and application thereof
US20230067805A1 (en) Peg-modified polypeptide capable of inhibiting gp96, preparation method therefor and use thereof
CN103865899B (en) There is VEGFR 2the fusion toxin of/KDR receptor-specific and encoding gene thereof and application
CN103755813A (en) Targeting anti-tumor fusion protein, and encoding gene and expression plasmid thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination