CN1174572A - Human tissue inhibitor of metalloproteinase -4 - Google Patents

Abstract

A human tissue inhibitor of metalloproteinases -4 polypeptide and DNA (RNA) encoding such polypeptide and a procedure for producing such polypeptide by recombinant techniques. Also disclosed are methods for utilizing such polypeptide for the treatment of diseases, including arthritis and cancer. Antagonists against such polypeptides and their use as a therapeutic to rerorb scar tissue are also disclosed. Diagnostic assays for detecting levels of human TIMP -4 protein and mutations in human TIMP-4 nucleic acid sequence are also disclosed.

Description

The human tissue inhibitor of metalloproteinase-4

The present invention relates to new identified polynucleotides, by the polypeptide of this polynucleotide encoding, the production of the application of these polynucleotide and polypeptide and this polynucleotide and polypeptide.More particularly, polypeptide of the present invention is the human tissue inhibitor of metalloproteinase-4 polypeptide, hereinafter referred to as " people TIMP-4 ".The invention still further relates to inhibition to the effect of this polypeptide.

Extracellular matrix is a kind of composite structure, and it contains collagen, proteoglycan, glycosaminoglycan, glycoprotein (fibronectin, chondronectin, ln), and in some tissues, also contain elastin (Hay, E.D., cytobiology magazine .91:205-223 (1981)).

(MMP ' s) constitutes the major portion of zinc in conjunction with endopeptidase to matrix metalloproteinase, and zinc is in conjunction with endopeptidase degrade in the reconstruction at reticular tissue in normal physiological and some pathologic process extracellular matrix protein, for example reticular tissue, collagen and gelatin.The overactivity of MMP can cause tissue degradation widely, and these enzymes relate to the various diseases process, comprises that tumour cell invades tumor-blood-vessel growth and rheumatoid arthritis (Okada, Y. etc., journal of biological chemistry, 261:14245-14255 (1986)).MMP secretes from cell as the proenzyme of non-activity, and its activity in born of the same parents' external environment is subjected to the adjusting (Matrisian, L.M., Trends Genet., 6:121-125 (1990)) of various activator and inhibitor.

The proteoclastic adjusting of metalloprotease mediation can be subjected to naturally occurring inhibitor protein, as tissue depressant (TIMP) initiation of metalloprotease.Balance between the production of MMP and the activation, and they are by the inhibition of natural inhibitor such as TIMP, no matter under physiology still is pathologic condition, are determining whether reticular tissue is degraded.

MMP comprises many proteolytic enzyme, matter for example (I type) collagenase itself, stromelysin (being also referred to as proteoglycan enzyme or transin), inoblast and polymorphonuclear leukocyte gelatinase (being also referred to as the collagen iv enzyme), " pump-1 " (metalloprotease 1 of deduction, the uterus metalloprotease) " Goldberg etc., journal of biological chemistry 2610:6600 (1986); Witham etc., biochemical magazine, 240:913 (1986); Breathnach etc., nucleic acids research, 15:1139 (1987); Muller etc., biochemical magazine, 253:187 (1988); Collier etc., journal of biological chemistry, 263:6579 (1988); Murphy etc., biochemical magazine, 258:463 (1989); Quantin etc., biochemistry, (N.Y.), 28:5327 (1989); Birkedal-Hansen, oral pathology magazine, 17:445 (1988) ".

In general, the Mammals family of proteolytic enzyme has one or more following features: (a) the optimum protein hydrolytic activity when about neutral pH; (b) enzymic activity depends on the existence of zinc, and evidence is for working as with the divalent-metal ion sequestrant as 1.10 phenanthrolenes (preferential chelating zinc) or EDTA (chelating properties less-restrictive; EDTA and EGTA are that the required calcium ion of enzyme stability causes enzyme deactivation by chelating also) lose activity when handling; (c) suppressed by TIMP; (d) the known inhibitor of other family of neutral zinc-containing metal proteolytic enzyme, as thermolysis, angiotensin converting enzyme and enkephalinase lack the obvious suppression effect; (e) biosynthesizing and with the precursor forms of hiding (proenzyme) secretion needs born of the same parents to activate outward.With many endo-proteases, organomercurial and chaotropic agent are realized activation.

In general, the member of neutral metal proteolytic enzyme family has tangible substrate specificity.Therefore, on the ability of the specificity peptide bond of collagenase I type in the natural fibril of its cracking interstitial collagen (for example, I, II and III type) specificity is arranged.Gelatinase has only faint activity to these collagens, just the interstitial collagen of the sex change of degrading and non-fiber collagen, for example: the IV type, as in basilar membrane, finding.Pumpl it is reported the collagen (gelatin) that acts preferentially on sex change, although its feature is different from stromelysin or collagenase IV type.Stromelysin and the gelatinase non-collagen structural protein of also degrading are as the core protein and the elastin of proteoglycan.The macromole that relates in the interaction of cell and matrix and cell and cell is as ln and fibronectin also the degraded sensitivity to being caused by some these metalloid proteases.

The enzyme of this family is by synovial membrane and skin flbroblast, the chondrocyte, and peripheral mononuclear cells, keratinocyte and gingiva tissue produce, and the particle that also is present in polymorphonuclear leukocyte (PMNL) stores in the vesicle.

Present information shows the family that has an inhibitors of metalloproteinase, comprises TIMP-1 (tissue depressant of metalloprotease 1); TIMP-2; Cloned, expressed and be positioned the people TIMP-3 on the human chromosome 22; The chicken tissue depressant (ChIMP-5) of metalloprotease.Polypeptide of the present invention is accredited as new people TIMP polypeptide according to the homology of aminoacid sequence through deduction.

According to an aspect of the present invention, provide one to be that the new mature polypeptide of people TIMP-4 and biology thereof are activated and diagnosis is gone up or useful fragment, analogue and derivative are gone up in treatment.

According to a further aspect in the invention, provide the nucleic acid molecule of separated coding people TIMP-4, comprised mRNA, DNA, cDNA, genomic dna and have bioactive and useful fragment, analogue and derivative are gone up in diagnosis or treatment.

The further aspect according to the present invention, the method of producing this polypeptide by recombinant technology is provided, has been included in protokaryon and/or the eukaryotic host cell of cultivating the reorganization that contains people TIMP-4 nucleotide sequence under the condition that promotes this protein expression and reclaims above-mentioned protein subsequently.

The further aspect according to the present invention, provide treatment to relate to the method for the active insufficient symptom of people TIMP-4, comprising that patient to this enzyme of needs uses contains the proteic medicinal compositions of people TIMP-4 of the present invention, thereby said composition can be replenished patient's endogenous people TIMP-4 alleviation above-mentioned symptom effectively, for example, comprise arthritis disease, as similar rheumatism and osteoarthritis, soft tissue rheumatism disease, multiple chondritis and tendonitis; Bone-resorbing disease such as osteoporosis, Paget ' s disease, Parathyroid superfunction and cholesteatoma; With diabetes complicated enhanced collagen damage; Latent malnutrition epidermis dissolving bubble; Periodontopathy, dentoalveolitis with the relevant consequence of collagenase gum product; Cornea festers; Skin and gi tract fester and undesired wound healing; The aftereffect symptom that the collagenase level raises is owing to organizing basilar membrane to destroy the cancer that is suppressed to cause metastasis of cancer, the demyelination of maincenter and peripheral nervous system; Asthma; Glomerulosclerosis; Septic shock and infection; And psoriasis.

The further aspect according to the present invention provides the antibody that resists this type of polypeptide.

The further aspect according to the present invention, provide contain can with the nucleic acid probe of the nucleic acid molecule of the sufficient length of people TIMP-4 sequence-specific hybridization.

The further aspect according to the present invention provides the antagonist at this polypeptide that can be used for therapeutic purpose, for example, and the destruction of reconstruction that is used for organizing and reparation and scar tissue.

According to a further aspect in the invention, provide the diagnostic method that is used to detect the disease that relates to interior sudden change of people TIMP-4 sequence and polypeptide overexpression.

According to the instruction of this paper, these and other aspect of the present invention is conspicuous to those skilled in the art.

The following drawings is in order to explanation embodiment of the present invention, not in order to the restriction scope of the present invention that claims comprised.

Fig. 1 represents the cDNA sequence and the corresponding derivation aminoacid sequence of total length people TIMP-4 polypeptide.The single-letter amino acid of use standard is write a Chinese character in simplified form.(Applied Biosystems Inc.) checks order, and the accuracy rate of estimating order-checking is greater than 97% to use 373 automated DNA sequenators.

Fig. 2 is that polypeptide of the present invention and other people TIMP amino acid sequence of polypeptide compare.

Fig. 3 shows the analytical results of Northern trace, shows the expression of people TIMP-4 in the different people tissue.

According to an aspect of the present invention, provide the nucleic acid (polynucleotides) of a separation, its coding has The mature polypeptide of the derivation amino acid sequence of Fig. 1 or coding with ATCC preserving number 75946 November 11 in 1994 The mature polypeptide of the cDNA clones coding of day preservation.

The polynucleotides of code book invention polypeptide can obtain from early stage human brain. It comprises an ORFs And coding has the protein of 224 amino acid residues, and wherein approximately front 29 residues represent targeting sequencing, Ripe protein comprises 195 amino acid residues. Polynucleotides of the present invention are from coming from early stage human brain CDNA library in find. This albumen shows the homology that top is arranged with people TIMP-2, is surpassing 1 On 36 amino acid whose length, 48% homogeny and 72% similitude are arranged. People TIMP-4 has 12 cysteine residues of in all members of TIMP family, all guarding. At TIMP-1 and TIMP-These 12 cysteine residues all connect with disulfide bond in 2. This evidence shows of the present invention consumingly Polypeptide is a newcomer of TIMP family.

Polynucleotides of the present invention can be the form of RNA or the form of DNA, and DNA comprises cDNA, genome D NA and artificial-synthetic DNA. DNA can be double-stranded or strand. If strand, can be coding strand or Noncoding strand (antisense strand). The coded sequence of encoding mature polypeptide can with volume shown in Figure 1 or the preservation clone The code sequence is identical, or owing to repeatability and the degeneracy of genetic code also may be encoded and DNA shown in Figure 1 or guarantor Hide the identical mature polypeptide of cDNA, but the coded sequence difference.

The polynucleotides of mature polypeptide of mature polypeptide shown in Figure 1 or preservation cDNA coding of encoding can comprise: only have The coded sequence of mature polypeptide, the coded sequence of mature polypeptide and additional code sequence such as targeting sequencing or secretion sequence Row or proteinogen sequence; The coded sequence of mature polypeptide (and optional additional code sequence) and non-coding sequence, 5 ' and/or 3 ' non-coding sequence such as introne or mature polypeptide encoded sequence.

Therefore, term " polynucleotides of coded polypeptide " had both comprised the multinuclear glycosides of the coded sequence that only contains polypeptide Acid also comprises the polynucleotides that also contain additional code and/or non-coding sequence.

The invention still further relates to the variant of polynucleotides as described above, their codings have the derivation ammonia of Fig. 1 Fragment, analog and the derivative of the polypeptide of the polypeptide of base acid sequence or preservation clone cDNA coding. Polynucleotides Variant can be that the polynucleotides that naturally occurring polynucleotides allelic variation body or non-natural exist become Allosome.

Therefore, the present invention includes the polynucleotides of coding mature polypeptide same as shown in Figure 1 or preservation clone The polynucleotides of the identical mature polypeptide of cDNA coding, and encode polypeptide shown in Figure 1 or preservation clone's cDNA The fragment of the polypeptide of coding, the polynucleotides variant of derivative or analog. The variant of these polynucleotides Comprise the deletion mutation body, replace variant and interpolation or insert variant.

As mentioned, polynucleotides may have naturally occurring coded sequence shown in Figure 1 or preservation clone The coded sequence of the allelic variation body of coded sequence. It is one at allelic variation body known in the art Another form of polynucleotide sequence, it may have the replacement of one or more nucleotides, lacks or adds Add and basically do not change the function of coded polypeptide.

The present invention also comprises the coded sequence of mature polypeptide and auxiliary polypeptide expression and secretion many from host cell Nucleotide sequence, for example, the control polypeptide transports from cell, the targeting sequencing of secretion sequence function merges Polynucleotides in reading frame. Polypeptide with targeting sequencing is a front albumen (preprotein), Thereby and may cut the polypeptide that targeting sequencing forms mature form by host cell. Polynucleotides are codified also One adds the proteinogen (proprotein) that 5 ' other amino acid residue forms by mature protein. Tool It is a proteinogen that the former mature protein of sequence is arranged, and it is the inactive form of protein. In case excision sequence Formerly will obtain an activated mature protein.

Therefore, for example, the protein of a maturation of polynucleotides codified of the present invention, or encode one and have The protein that sequence is former, or the former protein that presequence (targeting sequencing) arranged again of existing sequence of encoding.

Polynucleotide of the present invention also can have and the encoding sequence of flag sequence fusion in a frame, and it can help polypeptide of the present invention is carried out purifying.Flag sequence can be 6 histidine marks that provided by the pQE-9 carrier, when the host is bacterium, flag sequence can provide purifying to the mature polypeptide that merges with mark, perhaps, for example, when using a mammalian cell host such as COS-7 cell, flag sequence can be a hemagglutinin (HA) mark.Corresponding one of HA mark derives from the proteic epitope of influenza hemagglutinin (Wilson, I., et al., Cell, 37:767 (1984)).

The invention further relates to polynucleotide, if they have at least 50% with above-mentioned sequence, preferably has 70% homogeny, just can hybridize.The present invention be more particularly directed under stringent condition polynucleotide with above-mentioned multi-nucleotide hybrid.The employed noun of this paper " stringent condition " is meant to have 95% homogeny, the hybridization that just takes place when preferably having at least 97% homogeny at least between sequence.In preferred embodiments, keep identical biological function or the activity of mature polypeptide with cDNA or the preservation cDNA coding of Fig. 1 in fact with the polypeptide of the polynucleotide encoding of above-mentioned multi-nucleotide hybrid.

The preservation thing that this paper mentions is to carry out preservation by the requirement of the microbial preservation budapest treaty of the international recognition that is used for patented procedure.These preservation things are not to ask for the permission of preservation thing according to 35U.S.C. § 112 for those skilled in the art's convenience provides just.Be contained in the polynucleotide sequence in the preservation thing, and the aminoacid sequence of encoded polypeptides enrolls this paper for your guidance thus, and in any description of any and this paper sequence, be conclusive in the afoul situation.Making, use or sell this preservation thing needs permission, and this paper does not allow this kind permission.

The invention further relates to the derivation aminoacid sequence with Fig. 1 or people TIMP-4 polypeptide and the fragment of this polypeptide, analogue and the derivative of preservation cDNA amino acid sequence coded.

When mentioning Fig. 1 or preservation cDNA encoded polypeptide, term " fragment ", " derivative " refer to keep basically identical biological function with this polypeptide or active polypeptide with " analogue ", therefore, analogue comprises and can activate through the cracking of proteinogen part, to produce the proteinogen of active mature polypeptide.

Polypeptide of the present invention can be a recombinant polypeptide, natural polypeptides or artificial synthetic polypeptide, preferred recombinant polypeptide.

Polypeptide shown in Figure 1 or by fragment, derivative or the analogue of preservation cDNA encoded polypeptides can be (i) wherein one or more amino-acid residues by conservative or nonconservative amino-acid residue (preferred conservative amino-acid residue) replaces and this substituted amino acid residue can yes or no by the genetic code coding; Or (ii) wherein one or more amino-acid residues comprise the group of a replacement; Or (iii) wherein mature polypeptide and another compound, merge as the compound (as polyoxyethylene glycol) that improves the polypeptide transformation period; (iv) wherein mature polypeptide and additional amino acid such as leader sequence, secretion sequence, or be used for the sequence of purifying mature polypeptide, or the proteinogen sequence merges.Believe instruction, in the scope that these fragments, derivative or analogue those skilled in the art grasp according to this paper.

Polypeptide of the present invention and polynucleotide preferably provide with isolating form, and preferred purifying becomes homogeneity.

Noun " separation " mean material from its primal environment, separate (as, if it refers to its physical environment when being naturally occurring).For example, the naturally occurring polynucleotide or the polypeptide that are present in the living animal are unsegregated, but from natural system in the material of some or all coexistences isolating same polynucleotide or polypeptide be isolating.These polynucleotide can be that the part of carrier and/or this type of polynucleotide or polypeptide can be the parts of composition, and as long as these carriers or composition are not the parts of its physical environment, it remains isolating.

The invention still further relates to the carrier that comprises polynucleotide of the present invention, use carrier of the present invention to carry out the host cell of genetic modification and the polypeptide of producing by recombinant technology of the present invention.

Host cell can use carrier of the present invention, and for example cloning vector or expression vector carry out genetically engineered (transduction or conversion or transfection).Carrier can be, for example, and plasmid, virion, forms such as phage.The host cell of through engineering approaches can be cultivated in the conventional nutritional medium of transformant selection or people TIMP-4 gene amplification be suitable for the promotor activation through adjustment.Culture condition, such as temperature, pH etc. are the conditions that was used to the host cell expression selected in the past, and are conspicuous for those of ordinary skill in the art.

Polynucleotide of the present invention can be used for producing polypeptide by recombinant technology.For example, polynucleotide can be contained in any one different expression vector, with express polypeptide.These carriers comprise chromosomal, achromosomal and synthetic dna sequence dna is as the derivative of SV40, bacterial plasmid, phage DNA, baculovirus, the yeast plasmid derives from the carrier that plasmid and phage DNA make up, such as vaccinia virus, adenovirus, bird pox virus, the viral DNA of pseudorabies virus.Yet any other carrier reproducible and that can survive in the host can use.

Suitable dna sequence dna can be inserted in the carrier by serial of methods.Usually, dna sequence dna is inserted into suitable restriction endonuclease sites, believes in the scope of these methods and additive method those skilled in the art grasp by the method known in the art.

Dna sequence dna in the expression vector effectively is connected with a suitable expression control sequenc (promotor), and is synthetic to instruct mRNA's.As the representational example of this promotor, that can mention has: LTR or SV40 promotor, intestinal bacteria Lac or trp, phage P _LPromotor and other known may command genes expression promoter in protokaryon or eukaryotic cell and their virus.Expression vector also comprises a ribosome bind site that is used for translation initiation and Transcription Termination.Carrier also can comprise the suitable sequence that is used for overexpression.

In addition, expression vector preferably includes one or more selectable marker genes so that provide phenotypic characteristic for the selection of transformed host cell.As the Tetrahydrofolate dehydrogenase or the neomycin resistance of eukaryotic cell culture, or tsiklomitsin in the intestinal bacteria or amicillin resistance.

Suitable dna sequence dna and the suitable promotor or the carrier of control sequence of including mentioned above can be used for transforming a suitable host and reaches this protein to allow master meter.

The representational suitable host's example that can mention has: bacterial cell, and as intestinal bacteria, streptomycete, Salmonella typhimurium, fungal cell such as yeast, insect cell such as fruit bat S2 and Sf9, zooblast such as CHO, CO S or Bowes melanoma; Adenovirus, vegetable cell etc.Believe instruction, suitably in host's the scope that is chosen in those skilled in the art's grasp according to this paper.

More particularly, the present invention also comprises the recombinant precursor that comprises one or more above-mentioned broad sense sequences, and this construct comprises a carrier, as plasmid or virus vector, wherein to have inserted sequence of the present invention forward or backwards.From the preferred one side of the present embodiment, this construct also comprises the adjusting sequence, for example, comprises a promotor that effectively is connected with sequence.Known a large amount of suitable carrier of those skilled in the art and promotor, and obtain commercial.Following carrier provides by way of example: bacterium: pQE70, pQE60, pQE9 (Qiagen), pbs, pD10, phagescript, pSiX174, pbluescriptSK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); Ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia).Eucaryon: pWLNEO, pSV2 CAT, pOG44, pXT1, pSG (Stratagene), pSVK3, pBPV, pMSG, pSVL (Pharmacia).Yet as long as can duplicate in the host and survive, any other plasmid or carrier all can use.

Use CAT (CAT) carrier or other carriers that has selective marker from the gene of any needs, to select promoter region.Two suitable carriers are pKK232-8 and pCM7.Especially the bacterium promotor that should mention comprises lacI, lacZ, T3, T7, gpt, Lambda P _R, P _LAnd trp.Eukaryotic promoter comprises that CMV is early stage immediately, the HSV thymidine kinase, early stage and late period SV40, the LTRs in the retrovirus and mouse metallothionein(MT)-I.Those of ordinary skill in the art's level can be carried out the selection of suitable carrier and promotor.

In further embodiment, the present invention relates to include the host cell of above-mentioned construct.Host cell can be a higher eucaryotic cells, and as mammalian cell, or eukaryotic cell such as low, as yeast cell, or host cell can be prokaryotic cell prokaryocyte, as bacterial cell.Construct can pass through calcium phosphate transfection to the importing of host cell, the transfection of DEAE-dextran mediation, or electroporation carries out (Davis, L., Dibner, M., Batey, I., Basic Methods in Molecular Biology, (1986)).

Construct in the host cell can be used for the gene product of produced in conventional processes by the recombination sequence coding.In addition, polypeptide of the present invention can carry out synthetic by traditional peptide synthesizer.

Sophisticated protein can be at mammalian cell, and yeast is suitably being expressed under the promotor control in bacterium or other cells.Cell free translation system also can be used for using the RNAs that derives from DNA construct of the present invention to produce this proteinoid.Suitable clone and expression vector that protokaryon and eucaryon host use see Sambrook et al. for details, Molecular Cloning:A Laboratory Mannal, Second Edition, Cold SpringHarbor, N.Y., (1989)) description, this paper classifies it as reference.

Transcribing of the DNA of coding polypeptide of the present invention can be improved by insert an enhancer sequence in carrier in the higher eucaryotic cells.Enhanser is the cis acting factor of DNA, about 10 arrives 300bp usually, acts on promotor to improve transcribing of it.Example comprises the SV40 enhanser that is positioned at replication orgin site in late period 100-270bp, and the early promoter enhanser of cytomegalovirus is positioned at the polyoma enhanser and the adenovirus enhanser in replication orgin site in late period.

Usually, recombinant expression vector comprises replication orgin and the selective marker that allows host cell to transform, as, the TRP1 gene of colibacillary ampicillin resistance gene and cereuisiae fermentum, and derive from the promotor that instructs the cance high-expression gene that the downstream configurations sequence transcribes.This class promotor can derive from coding glycolytic ferment such as glycerol 3-phosphate acid kinase (PGK), α-factor, acid phosphatase, or the operon of heat shock protein(HSP) etc.Allos structure sequence and translation initiation and terminator sequence combine with suitable manner, and preferably, combine with the leader sequence of the protein secreting that can instruct translation medium outside cell periplasmic space or born of the same parents.Perhaps, one of heterologous sequence codified comprises gives required feature, for example, makes the recombinant products of expression stable or be easy to the fusion rotein of the terminal identification polypeptide of N-of purifying.

The expression vector that uses in the bacterium is to insert with functional promotor with effective reading method by the structural DNA sequence of the desired protein of will encoding and suitable translation initiation and termination signal to make up.Carrier can comprise selectable mark and a replication orgin that guarantees the carrier existence and amplification can be provided if desired on one or more phenotypes in the host, the prokaryotic hosts that is suitable for transforming comprises intestinal bacteria, Bacillus subtilus, Salmonella typhimurium and Micromonospora, various kinds in streptomyces and the Staphylococcus, however also can select to use other hosts.

As a representative but nonrestrictive example, the useful expression vector that uses in the bacterium comprises a selected marker and derives from the bacterium replication orgin of the plasmid of commercial or the genetic element that comprises known cloning vector pBR322 (ATCC37017) that obtains.These commercial carriers comprise, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA)." skeleton " part of these pBR322 combines with a suitable promotor and the structure sequence that will express.

After suitable host strain is transformed and grow into suitable cell density, should use appropriate means (as temperature transition or chemical induction) to induce the promotor of selection, and cell is cultivated for some time again.

Through centrifugal typically harvested cell, by physics or chemical process fragmentation, the crude extract of gained is waited until and is further purified.

The microorganism cells that uses in protein expression can comprise freeze-thaw cycle by any method easily, supersound process, and fragmentation is carried out in Mechanical Crushing or the molten born of the same parents' agent of use cell.These methods all are that those skilled in the art is known.

Various mammalian cell culture systems also can be used for express recombinant protein matter.The example of mammalian expression system comprises monkey kidney inoblast COS-7 system, sees Gluzman for details, Cell, and 23:175 (1981), and other can be used to express the clone such as the C127 of compatible carrier, 3T3, CHO, Hela and bhk cell system.Mammalian expression vector comprises a replication orgin, suitable promotor and enhanser, and the ribosome bind site of any necessity, polyadenylation site, donor splicing site and acceptor site, transcription termination sequence, and 5 ' flank non-transcribed sequence.The dna sequence dna that derives from SV40 montage and polyadenylic acid site can be used for providing the non-transcribed genetic element of needs.

People TIMP-4 polypeptide is by comprising ammonium sulfate or ethanol sedimentation, acid extraction, positively charged ion or anion-exchange chromatography, the phosphorylated cotton chromatography, hydrophobic interaction chromatography, affinity chromatography, methods such as hydroxyapatite chromatography and phytohemagglutinin chromatography reclaim and purifying from the reconstitution cell culture.If necessary, when finishing the configuration of mature protein, can use proteinic refolding step.In the end can use high performance liquid chromatography (HPLC) in the purification step at last.

Polypeptide of the present invention can be the product of a natural purifying, or the product of chemical synthesis process, or by recombinant technology from protokaryon or eucaryon host (as, by bacterium, yeast, higher plant, insect and mammalian cell cultures) product that produces.According to the host cell that uses in the recombinant production process, polypeptide of the present invention can be glycosylated or nonglycosylated.Polypeptide of the present invention also can comprise an initial methionine residues.

The present invention also partly relates to the people TIMP-4 of the feature of the active ability of inhibition MMP ' s with qualification.People TIMP-4 polypeptide can be used for as an inhibitors of metalloproteinase to stop tumour invasion and vasculogenesis and subsequent transfer.People TIMP-4 polypeptide also can be used for the treatment of arthritis disease, as rheumatoid arthritis and osteoarthritis, and soft tissue rheumatism disease, multiple chondritis and tendonitis, and bone-resorbing disease, as osteoporosis, Paget ' s disease, Parathyroid superfunction and cholesteatoma.People TIMP-4 also can be used for preventing with diabetes, recessive auxotrophy epidermis dissolving bubble, the concurrent enhanced collagen of the associated consequences that periodontopathy and collagenase gum are produced destroys.People TIMP-4 also can be used for suppressing the release of the PMNL collagenase behind the gum of cellular infiltration inflammation, comprises the bigger susceptibility of opposing diabetic subject to periodontal disease.

People TIMP-4 also can be used for treatment by burning such as alkali or other, radiation, vitamin-E or retinene (retinoid) lack the inductive cornea festers, and skin and gi tract fester, and undesired wound healing, and comprise the colon anastomose operation back symptom that the collagenase level raises.

The growth in situ of MMP ' s mediation tumour.Therefore the people TIMP-4 destruction that can be used for blocking the cell based counterdie, the latter is the cancer cell Transfer Mechanism.MMP ' s relates to the neovascularity generation of supporting tumor growth and surviving required, relates to required tissue reconstruction in the elementary and secondary tumour of regulating growth, and relates to tumour cell penetrating by the vessel wall basilar membrane in transfer process.

MMP ' s is responsible for the localized degradation of folliculus wall in the ovulation process and is used for the localized degradation of the Uterus wall of protoblast implantation.Therefore, people TIMP-4 can be used as contraceptive bian.

People TIMP-4 also can be used as common somatomedin with treatment restenosis and similar disease.People TIMP-4 especially can be used as the growth of red corpuscle born of the same parents like cell pedigree and goes through son.

The medicable other diseases of personnel selection TIMP-4 also comprises: dentoalveolitis, and asthma, psoriasis, glomerulosclerosis and septicopyemia shock are invaded because MMP ' s participates in some parasitic tissue.

The fragment of total length people TIMP-4 gene can be used as hybridization probe, separates full-length gene and separate other genes that high sequence similarity or similar biologic activity are arranged to this gene from the cDNA library.For example, this class probe can be between 20 and 2000 bases.Yet preferred probes has 30 to 50 base pairs.Probe also can be used to identify the cDNA clone and a genomic clone of corresponding total length transcript or contain whole person TIMP-4 gene, comprises regulatory region and promoter region, the clone of exon and intron.The example of screening comprises that the coding region of using known dna sequence dna separation of human TIMP-4 gene is with synthetic oligonucleotide probe.The labeled oligonucleotide that has with the sequence of gene complementation of the present invention is used to screen the human cDNA library, and hybridize with which member in the library with the decision probe in genomic dna or mRNA library.

The invention still further relates to end user TIMP-4 gene as detecting a part that has the diagnostic method of diseases associated or susceptibility with people TIMP-4 sudden change.

The individuality that carries sudden change on people TIMP-4 gene can detect on dna level by various technology.Can be from patient's cell such as blood, urine, saliva obtains diagnostic nucleic acid in biopsy and the necrotomy material.Genomic dna can be directly used in detection or use PCR through enzyme method amplification (Saiki et al., Nature, 324:163-166 (1986)) before analysis.RNA or cDNA also can be used for same purpose.For example, can be used for identifying sudden change with analyst TIMP-4 with the nucleic acid complementary PCR primer of coding people TIMP-4.For example, by with relatively can the detecting disappearance from the variation of amplified production size or insert of normal genotype.Point mutation can be hybridized with radiolabeled people TIMP-4 RNA or radiolabeled people TIMP-4 antisense dna sequence by DNA amplification and identified.Complete paired sequence can be distinguished from the two strands of mispairing by the digestion of RNaseA or the difference of melting temperature(Tm).

Measure to change by the electrophoretic mobility of dna fragmentation in the gel that contains or do not contain denaturing agent based on the genetics of dna sequence dna difference and realize.Can see little sequence deletion or insertion by the high resolving power gel electrophoresis.Not homotactic dna fragmentation can be distinguished on sex change methane amide gradient gel, different dna fragmentations (for example are stuck on the different gel location according to their specific fusions or part melting temperature (Tm) in this glue, see Myers et al., science, 230:1241 (1985)).

Sequence variation on the specific position also can be by nuclease protection experiment as RNase and S1 protection or the announcement of chemical chop method (for example Cotton et al., PNAS, USA, 85:4397-4401 (1985)).

Therefore; the detection of specific DNA sequences can be passed through such as hybridization; the RNase protection, chemical chop, directly the Southern trace of determined dna sequence or use restriction enzyme (for example restriction fragment length polymorphism (RFLP)) and genomic dna is realized.

Except that gel electrophoresis more easily and dna sequencing, also can be by the sudden change of original position analyzing and testing.

The proteinic overexpression of comparing with the normal control tissue sample the invention still further relates to and detect the diagnostic test that people TIMP-4 protein level changes in the various tissues, because can detect the disease of being regulated by people TIMP-4 or the susceptibility of disease.The experiment that is used for detecting from host's sample people TIMP-4 protein level is well-known to those having ordinary skill in the art, and comprises radioimmunoassay, and competition is in conjunction with experiment, and Western engram analysis, ELISA are measured and " sandwich " experiment.ELISA mensuration (coligan, et al., Current Protocols in Immunology, 1 (2), Chapter 6, (1991)) comprise that at first preparation has specific antibody to people TIMP-4 antigen, preferred monoclonal antibody.The report antibody that also will prepare in addition, anti-monoclonal antibody.On report antibody, connect detectable reagent such as radiation, fluorescence or as in the present embodiment, use a horseradish peroxidase.From the host, obtain sample and can cultivate with the solid support such as the polystyrene dish of protein bound in the sample.By with nonspecific proteins matter such as turbid the educating of BSA and the floating preteins binding site on the covering disk.Then, incubation monoclonal antibody in dish, any people TIMP-4 of bonded protein bound on monoclonal antibody and the polystyrene dish in incubation time.With all unconjugated monoclonal antibodies of damping fluid flush away, will place dish with horseradish peroxidase bonded report antibody now, cause reporting that antibody combines with people TIMP-4 bonded monoclonal antibody.The unconjugated report antibody of flush away then.The substrate that in dish, adds peroxidase, with typical curve relatively, the amount that develops the color in the given time is the observed value of the proteic amount of people TIMP-4 that exists in patient's sample of given volume.

Can do competitive assay, wherein the specific antibody of people TIMP-4 be combined with solid support, the people TIMP-4 of mark and from host's sample by solid support, the amount of dodging people TIMP-4 in the amount of chromatogram certification mark and the sample by for example liquid is dependency.

" sandwich " measured and measured similar to ELISA.In sandwich assay, people TIMP-4 by a solid support and with the antibodies that is attached on the solid support.Second antibody is attached on the people TIMP-4 subsequently.The 3rd antibody that is specific to second antibody of mark combines with second antibody by solid support, then can be quantitative.

The present invention also provides the method for SCREENED COMPOUND, to determine which is the stimulant or the antagonist of people TIMP-4 polypeptide.An example of this method comprises mammalian tissues such as the ox radiation wrist joint that obtains to contain extracellular matrix.Joint cartilage is cut into less garden sheet, and in DMEM, uses ³⁵The chien shih cartilage mixed the sodium sulfate of mark when S-sodium sulfate mark (10 μ Ci/ml) was sufficiently long.Then, under suitable condition, with MMP, for example stromelysin or IL1 or TNF join in the sheet of cartilage garden so that tissue damage normally takes place.Add the compound of people TIMP-4 and desire screening subsequently in reaction mixture, the time wants sufficiently long so that MMP normally destroys cartilage garden sheet.Collect supernatant liquor, it is the outer medium of cartilage garden sheet, and by liquid flashing counting device counting radioactivity.Calculating is discharged in the medium ³⁵The percentage of S.Discharge ³⁵S-GAG is the representative of protein-polysaccharide in the cartilage extracellular matrix, and the degraded of the protein-polysaccharide that carries out of reaction MMP.Determine by liquid sudden strain of a muscle chromatogram ³⁵The amount of S-GAG is compared with the control experiment under the situation about existing at compound not screened, and can determine that compound is to the stimulation of people TIMP-4 or the ability of antagonistic action.

Except that top those that identify, the example of potential people TIMP-4 antagonist comprises antibody or in some example is and polypeptide bonded oligonucleotide.In addition, the potential antagonist can be the mutant form of people TIMP-4, and it can discern natural substrate, but therefore non-activity hinders the effect of people TIMP-4.

Potential people TIMP-4 antagonist also comprises the antisense constructs of using the antisense technology preparation.Antisense technology can be used for expressing by forming triple helical or antisense DNA or RNA controlling gene, and two kinds of methods are combining based on polynucleotide and DNA or RNA all.For example, design the antisense rna oligonucleotide that length is about 10-40 base pair with the polynucleotide sequence 5 ' coding region of coding mature polypeptide of the present invention.(triple helical is seen Lee ed al., Nucl.Acids.Res.6:3073 (1979) with gene region complementation that the DNA oligonucleotide is designed to and participates in transcribing; Coondy et al., Science, 241:456 (1988); And Dervan et al., Science, 251:136091991)), thereby stop transcribing and producing of people TIMP-4.Antisense rna oligonucleotide and mRNA are hybridized in vivo, and stop mRNA molecule translation adult TIMP-4 (antisense-Okano, J.Neurochem., 56:1360 (1991)); Oligodeoxynucleotide is as the antisense inhibitor of genetic expression, CRC press, BocaRaton, FL (9188)).Above-mentioned oligonucleotide also can change in the cell, and sense-rna or DNA can be expressed in vivo to suppress the generation of people TIMP-4.

The antagonist of another kind of potential people TIMP-4 is a small molecules, its in conjunction with and occupy the avtive spot of people TIMP-4, thereby the interaction of blocking-up people TIMP-4 and MMP ' s so is blocked normal biologic activity.Micromolecular example includes but not limited to little peptide or class peptide molecule, for example peptide binding molecule.

People TIMP-4 antagonist can be used for tissue repair and reconstruction, for example, and in the time of need destroying scar tissue.In some cases, may need to improve the renewal and the reconstruction of reticular tissue, for example absorption again of scar tissue, postpartum degenerates in the uterus, lung, the fiber in liver or joint is rebuild.In these cases, the suitable control of the renewal of extracellular matrix protein needs balance between MMP ' s and the people TIMP-4 with control degradation suitably.

According to the present invention, polypeptide and the stimulant or the antagonist that are all polypeptide can be used so-called " gene therapy " by the expression in vivo of this type of polypeptide.

Therefore, for example, can use polynucleotide (DNA or RNA) to from patient's cell in the external through engineering approaches of carrying out, the cell with through engineering approaches offers the patient who uses the polypeptide treatment then.These methods are known in this area.For example, adopt the method known in the art, but use a counter-transcription-ing virus particle through engineering approaches cell that contains the RN A of the polypeptide of the present invention of encoding.

Similarly, also can adopt the method known in the art in vivo the through engineering approaches cell so that polypeptide express in vivo.As known in the art, the production cell that is used to produce the counter-transcription-ing virus particle of the RNA that contains the polypeptide of the present invention of encoding can give patient's medication with through engineering approaches cell and express polypeptide in vivo in vivo.According to instruction of the present invention, this class and other method of using polypeptide of the present invention with these class methods will be conspicuous to those skilled in the art.For example, the expression vector of engineering cell can not be a retrovirus, as through with the adenovirus that is used for through engineering approaches cell in the body after suitable transmission carrier combines.

Polypeptide of the present invention and stimulant thereof or antagonist can be used in combination with a kind of suitable pharmaceutical carrier.This composition comprises a kind of polypeptide for the treatment of significant quantity, and a kind of medicinal acceptable carrier or vehicle gone up.Carrier includes but not limited to salt solution, resiliency salt solution, glucose, water, glycerine, ethanol, and combination.Prescription should be suitable for the mode of administration.

The present invention also provides the drug packages or the test kit of the container that comprises one or more compositions that are full of one or more medicinal compositionss of the present invention.The production that the specification sheets provided of the container government organs that a production of regulating medicine or biological products arranged together, use and sell therewith, this specification sheets react human medication uses and marketing organization ratifies.In addition, this medicinal compositions can be used in combination with the other treatment compound.

Medicinal compositions form medication easily.As by local application, intravenous injection, intraarticular, in the tumour, intraperitoneal, intramuscular, subcutaneous, in the nose, or intradermal routes carries out.The amount of application of medicinal compositions is to be advisable to effectively treating and/or preventing of specific adaptations disease.Usually, the amount of application of medicinal compositions is with at least about the 10ug/kg body weight, and as a rule, and their amount of application is no more than approximately 8mg/kg body weight every day, preferred dosage be every day about 10ug/kg to the 1mg/kg body weight, consider the approach of administration, symptom etc.

Sequence of the present invention identifies it also is valuable for karyomit(e).Sequence specifically target and with single human chromosome on special site hybridization.And, need on karyomit(e), identify special site now.There is the chromosome marking reagent based on the actual sequence data (repetition polymorphism) seldom to can be used to the marker chromosomes position now.The location of DNA according to the present invention on karyomit(e) is the important the first step that these sequences and the gene relevant with disease are connected.

Briefly, can sequence be navigated on the karyomit(e) by preparation PCR primer (preferred 15-25bp) from cDNA, the Computer Analysis of 3 ' non-translational region can be used for being chosen in fast that length is no more than the primer of an exon in the genomic dna, otherwise makes the process of amplification become complicated.These primers are used for screening the somatic cell hybrid that contains individual chromosome through PCR then.The hybrid cell that only contains with the corresponding people's gene of primer just can produce an amplified fragments.

The PCR of somatic cell hybrid mapping is that specific DNA is navigated to fast method on the specific karyomit(e).Use has the present invention of identical Oligonucleolide primers, can be by similar method, realize inferior location with one group of fragment from specific karyomit(e) or big genomic clone storehouse.Other are similar is used to locate its chromosomal targeting scheme and comprises in situ hybridization, and the stream of applying marking selects chromosomal prescreen and uses the preselected to set up chromosome specific cDNA library of hybridization.

The fluorescence in situ hybridization (FISH) of cDNA clone and Metaphase Chromosome smear can be used for a step provides chromosomal localization accurately.This technology can be used the cDNA that is as short as 500 to 600 bases, yet, higher greater than clone and the single chromosomal foci bonded possibility of 2000bp, and can produce the signal of the sufficient intensity that can simply measure.FISH need use the clone in EST source, and the longer the better.For example, 2000bp is for well, and 4000bp is better, may be unnecessary for the result who obtains in rational time scale greater than 4000bp.The summary of this technology is seen Verma et al., human chromosomal: basic technology handbook, Pergamon Press, New York (1988).

In case a sequence has navigated on the accurate chromosome position, sequence physical location on karyomit(e) just can interrelate with the genetic map data.For example, can be at V.Mckasick, find this type of data the human Mendelian inheritance (can from the online acquisition of the John Hopkins Welch of university medical library).Be positioned at gene on the same chromosomal region and the relation between the disease by linkage analysis (physics closes on the common heredity of gene) then.

Below, the difference between the individuality that need determine to be affected and not to be affected in cDNA or genome sequence.If find sudden change in the individuality that some or all are not affected, but do not find sudden change in any normal individuality, sudden change just may be the cause of disease so.

With the resolving power of current physical map and genetic map technology, accurately be positioned cDNA with the chromosomal region of disease-related and may be in the 50-500 potential Disease-causing gene.(this supposes figure spectral resolution and gene of every 20kb of 1 megabasse).

Polypeptide, their fragment or other derivative or its analogue, or the cell of expressing them can be used as immunogen to produce antibody.For example, these antibody can be polyclonal antibody or monoclonal antibody.The present invention also comprises chimeric, antibody strand and humanized, and Fab fragment, or the product of Fab expression library.The whole bag of tricks known in the art can be used for this antibody-like and segmental generation.

With the antibody of the corresponding polypeptide of sequence of the present invention can be by with polypeptide direct injection precession thing or use this polypeptide to animal and obtain preferred non-human animal.So the antibody that obtains will combine with polypeptide is own.By this way, even only the coded polypeptide fragments sequence also can be used to produce and total length natural polypeptides bonded antibody.This antibody-like can be used for isolated polypeptide from the tissue of expressing this polypeptide subsequently.

For the preparation monoclonal antibody, any technology of the antibody that is produced by cloned culture that provides all can be used.Embodiment comprises essay knurl technology (Kolher and Milstein, 1975, Nature, 256:495-497), trisome hybridoma technology, human B cell essay knurl technology (Kozbor et al., 1983. today immunology 4:72), and the EBV hybridoma technology is to produce human monoclonal antibodies (Cole, et al., 1985, " monoclonal antibody and cancer therapy ", Alan R.Liss, Inc., pp.77-96).

The technology (United States Patent (USP) 4,946,778) of describing the manufacture order chain antibody also is applicable to the single-chain antibody of producing anti-immunogenic polypeptide product of the present invention.Also can use transgenic mice to express the humanized antibody of anti-immunogenic polypeptide product of the present invention.

The present invention is further described in following examples, yet, should understand and the invention is not restricted to these embodiment.All components and content except as otherwise noted, all are weight ratios.

For helping to understand following examples, will following method and/or terms that often occur be described.

" plasmid, with the p of small letter place the front and/or after be that capitalization and/or numeral are represented.Initial plasmid herein all is commercially available, can be obtained or can be made up from obtainable plasmid according to the method for delivering by the public on unrestriced basis.In addition, be known in this area with the plasmid of foregoing description equivalence and be conspicuous those of ordinary skill in the art.

" digestion " of DNA refers to uses a restriction enzyme that only acts on last some sequence of DNA that DNA is carried out catalyze cleavage.Various restriction enzyme used herein is commercially available, their reaction conditions, and cofactor and other need be known for the those of ordinary skill in field.For reaching analysis purposes, typically in the damping fluid of about 20ul, 1ug plasmid or dna fragmentation are used with about 2 unit enzymes.The DNA isolation fragment in order to be used for plasmid construction, typically with 5 to 50ugDNA in more volume with the enzymic digestion of 20 to 250 units.The suitable buffer of specific limited enzyme and the amount of substrate are limited by manufacturer.Normally used incubation time is about 37 ℃, 1 hour, but can change to some extent according to the suggestion of manufacturer.Digest the reactant that finishes and directly on polyacrylamide gel, carry out electrophoresis to separate required fragment.

The polyacrylamide gel that is cut segmental size separation use 8% carries out, and sees Goeddel, D.etal., Nucleic Acids Res., 8:4057 (1980).

" oligonucleotide " refers to the strand polydeoxyribonucleotide maybe can be by two complementary polydeoxyribonucleotide chains of chemosynthesis.This synthetic oligonucleotide does not have 5 ' phosphoric acid, therefore if do not add ATP so that phosphoric acid to be provided in the presence of kinases, just can not be connected with another oligonucleotide.Synthetic oligonucleotide can be connected with a fragment of handling without dephosphorylation.

" connection " refer between 2 double stranded nucleic acid fragments to form phosphodiester bond process (Maniatis, T., et al., Id., p146).Unless provide in addition, connect known damping fluid and the condition used, the dna fragmentation that every 0.5ug approximately waits mole to connect uses 10 T4 of unit dna ligases (" ligase enzyme ").

Unless other explanation is arranged, and the method for conversion is with reference to Graham, F.and Van der Eb, A., Virology, 52:456-457 (1973).

Embodiment 1

The bacterial expression of people TIMP-4 and purifying

At first use dna sequence dna, ATCC#75946 with respect to the PCR Oligonucleolide primers amplification coding people TIMP-4 of the carrier sequence of the proteinic 5 ' sequence of people TIMP-4 (subtraction signal peptide sequence) of processing and 3 ' side of TIMP-4 gene.Add and the corresponding additional nucleotide of people TIMP-4 to 5 ' and 3 ' sequence respectively.The sequence of 5 ' Oligonucleolide primers is 5 ' GCCAGAGGATCCTGCAGCTGCGCCCCGGCGCAC3 ', containing a BamH1 restriction site, is thereafter 21 Nucleotide of the people TIMP-4 encoding sequence that begins of the end amino acid of deduction from protein code of processing.3 ' sequence, 5 ' CGGCTTCTAGAACTAGGGCTGAACGATGTCAAC3 ' contains an XbaI site, is thereafter 18 Nucleotide of people TIMP-4.Restriction site on restriction site and the bacterial expression vector pQE-9 (Qiagen, Inc.9259 Eton Avenue, C hatsworth, CA, 91311) is corresponding.The pQE-9 antibiotics resistance (Ampr) of encoding, a bacterium replication orgin (ori), the promotor operon (P/O) that IPTG regulates, a ribosome bind site (RBS), one 6 histidine mark and restriction site.With BamH1 and XbaI digestion pQE-9, the sequence of amplification is connected with pQE-9, and is inserted in the reading frame together with histidine mark and RBS encoding sequence then.With connecting mixture transformed into escherichia coli bacterial strain m1 5/pREP4, this bacterial strain can obtain from Qiagen then, and method is seen Sambrook, J.et al., Molecular Cloning:A Labo ratory Mannal, Cold Spring Laboratory Press, (1989).M1 5/pREP4 contains the expression lacI repressor of multiple copied and the plasmid pREP4 of that plain resistance (Kanr) of card is provided.Differentiate transformant and select penbritin/kalamycin resistance clone by the ability of on the LB flat board, growing.Isolated plasmid dna, and confirm by restriction analysis.The grow overnight (O/N) in the LB liquid nutrient medium that replenishes Amp (100ug/ml) and Kan (25ug/ml) simultaneously that is cloned in that contains required construct.The O/N culture is used to inoculate big culture, and ratio is 1: 100 to 1: 250.Cell grows to optical density(OD) 600 (O.D.600) between 0.4 and 0.6.Add IPTG (sec.-propyl-B-D-thio-galactose pyran-glucoside) with final concentration 1mM then.IPTG removes P/O by making lacI repressor inactivation, causes genetic expression to improve and induces.Cell was cultivated 3-4 hour again.Pass through centrifugal cell harvesting then.Cell precipitation is dissolved in the chaotropic agent 6 mole hydrochloride guanidines.After the clarification, under the condition of combining closely with the protein that allows to contain 6 histidine marks, on the nickel chelate column through chromatography with dissolved people TIMP-4 purifying from solution come out (Hochul, E.et al., J.Chromatography 411:177-184 (1984).6 mole hydrochloride guanidines with pH5.0 elute people TIMP-4 (purity is 90%) from pillar, for renaturation, then be adjusted to 3 mole hydrochloride guanidines, 100mM sodium phosphate, 10 mmole gsh (reduced form) and 2 mmole gsh (oxidized form).In this solution, cultivate after 12 hours, protein is dialysed in the sodium phosphate of 10 mmoles.

Embodiment 2

The expression of recombinant human TIMP-4 in the COS cell

The expression of people TIMP-4 HA derives from pcDNAI/Amp carrier (Invitrogen), and this carrier comprises 1) replication orgin of SV40; 2) ampicillin resistance gene; 3) intestinal bacteria replication orgin; 4) CMV promotor has a polylinker district subsequently, SV40 intron and polyadenylic acid site.Coding total length people's TI MP-4 precursor and one and the dna fragmentation of its 3 ' terminal HA mark at reading frame endomixis are cloned into the polylinker district of carrier, therefore, carry out under the control that is expressed in the CMV promotor of recombinant protein.The HA mark is corresponding to deriving from the influenza hemagglutinin proteantigen decision base of describing the front (I.Wilson, H.NIm an, K.Heighten, A Cherenson, M.Connolly, and R.Lerner, 1984, Cell, 37,767).The fusion of HA mark and target protein makes uses the antibody test recombinant protein of an identification HA epitope to be easy to carry out.

The strategy of plasmid construction is described below:

Make up the dna sequence dna ATCC#75946 of coding people TIMP-4 by PCR, 2 primers are: 5 ' end primer, 5 ' GCCAGAGGATCCGCCACCATGCCTGGGAGCCCTCGGCCC3 ', contain a BamHI site, the back is with 21 Nucleotide of the people TIMP-4 encoding sequence that originates in initiator codon.3 ' sequence, 5 ' CGGCTTCTAGAATCAAGCGTAGTCTGGGACGTCGTATGGGTAGGGCTGAACGATGT CAAC3 ' contains one and XbaI site, translation stop codon, last 18 Nucleotide (not comprising terminator codon) complementary sequence of HA mark and people TIMP-4 encoding sequence.Therefore, the PCR product contains a BamHI site, people TIMP-4 encoding sequence and back with the HA mark of frame endomixis, be right after translation stop codon and an XbaI site of HA mark.With the dna fragmentation and the carrier pcDNAI/Amp of BamHI and XbaI restriction enzyme digestion pcr amplification, and connect.Connect mixture and transform into coli strain SURE (can be from StratageneClon ing Systes, 11099 North Torrey Pines Road, La Jolla, CA92037 acquisition).Transform culture and on the ampicillin medium flat board, cultivate and select resistance clone.Isolated plasmid dna and from transformant by the correct segmental existence of restriction analysis inspection.Be the expression of recombinant human TIMP-4, pass through DEAE-DEXTRAN method rotaring redyeing COS cell (J.Sambrook, E.Fritsch, T. molecular cloning laboratory manual, press of cold spring harbor laboratory (1989)) with expression vector.Method by radio-labeling and immunoprecipitation detects the proteic expression of people TIMP-4HA (E.Harlow, D.Lane, antibody laboratory manual, press of cold spring harbor laboratory, (1988)).35S halfcystine pair cell mark 8 hours are used in transfection after 2 days.Collect substratum then and use stain remover (RIPA damping fluid (150mM NaCl, 1%NP-40,0.1%SDS, 1%NP-40,0.5%DOC, 50mM Tris, pH7.5) (Wilson, I.et al., Id.37:767 (1984)) lysing cell.Use the HA monoclonal antibody specific to precipitate lysate and substratum simultaneously.On 15% SDS-PAGE gel, analyze sedimentary albumen.

Embodiment 3

Use the baculovirus expression system clone and express TIMP-4

Use is increased to the proteic dna sequence dna ATCC#75946 of coding total length TIMP-4 corresponding to the Oligonucleolide primers of the PCR of 5 ' and 3 ' sequence of gene.

The sequence of 5 ' primer is 5 ' GCCAGAGGATCCATGCCTGGGAGCCCTCGGCCC3 ', and contains a BamHI restriction site (runic is represented) after initial 21 Nucleotide of TIMP-4 gene (translation initiation codon ATG underscore).

The sequence of 3 ' primer be 5 ' CGGCTTCTAGAACTAGGGCTGAACGATGTCAAC 3 ' and the point of contact of containing restriction enzyme XbaI and with 18 Nucleotide of 3 ' non-translated sequence complementary of TIMP-4 gene.Commodity in use test kit (" Geneclean " BIO 101 Inc., La Jolla, Ca.) sequence that increases from 1% sepharose separation.Use endonuclease BamHI and XbaI digestion fragment and purifying on 1% sepharose once more then, this fragment called after F2.

(carrier pVL941 is modified and obtain for carrier pA2, below discuss) be used for that (summary is seen: Summers at baculovirus expression system, M.D.and smith, G.E.1987, the method handbook of baculovirus vector and insect cell culture procedure, Texas Agricultural Experimen tal StationBulletin NO.1555) the middle TIMP-4 albumen of expressing.This expression vector contains strong polyhedrin promotor of autographa california nuclear polyhedrosis virus (AcMNPV) and subsequent the recognition site of restriction enzyme BamHI and XbaI.The polyadenylic acid site of simian virus SV40 is used for effective polyadenylic acidization.For making recombinant virus be easy to select, insert in the same way from colibacillary beta-galactosidase gene and polyhedrin promotor, be thereafter the polyadenylation signal of polyhedron gene.The both sides of the sequence of polyhedrin are the virus sequences that is used for the cell-mediated homologous recombination of cotransfection wild-type virus DNA.Much other baculovirus vector can be used for replacing pGR1, as pAc373, pVL941 and pAcIM1 (Luckow, V.A.a nd Summers, M.D., Virology, 170:31-39).

Use restriction enzyme BamHI and XbaI digested plasmid, then with commercial kit from 1% the sepharose DNA isolation (" Geneclean " BIO 101 Inc., La Jolla, Ca.).This carrier DNA called after V2.

Use the T4 dna ligase that fragment F2 and plasmid V2 are coupled together.Transformed into escherichia coli HB101 cell and the bacterium of the plasmid (pBac TIMP-4) that contains the TIMP-4 gene is identified then with restriction enzyme BamHI and XbaI.Confirm the sequence of cloned sequence by dna sequencing.

Linear the baculovirus (" Baculogold of the plasmid pBacTIMP-4 of 5ug and 1.0ug commercialization ^TMBaculovirus DNA " .Phamingen, San Diego CA.) uses fat transfection method (Felgner et al., Proc.Natl.ACad.Sci.USA, 84:7413-7417 (1987)) cotransfection.

With 1ug BaculoGold ^TM(Life Technologies Inc., Gaithersburg mix in the aseptic hole of titer plate MD) at the Grace ' s substratum that contains the 50ul serum-free for viral DNA and 5ug plasmid pBac TIMP-4.The mixture that adds 10ul lipofectin reagent and 90ul Grace ' s substratum then at room temperature mixes and cultivated 15 minutes.Then transfection mixture is added drop-wise in the Sf9 insect cell (ATCC CRL1 711) that is inoculated in the 35mm tissue culturing plate that contains 1ml serum-free Gr ace ' s nutrient solution.The solution that the culture plate that rocks back and forth newly adds with mixing.Place 27 ℃ to cultivate 5 hours culture plate.Remove transfection liquid from dull and stereotyped updip after 5 hours, adding 1ml contains the Grace ' s insect substratum of 10% foetal calf serum culture plate is put back to incubator and continued cultivation 4 days in 27 ℃.

After 4 days, collect supernatant liquor, similarly carry out the plaque analysis by Summer and Smith (ibid) are described.As improvement, use to contain that ' (Life Technologies Inc. is Gaithersburg) so that separate blue plaque for the sepharose of Blue Gal '.(detailed ' plaque analysis ' can be with reference to Life Technologies Inc., and the insect cell that Gaithersburg delivers is cultivated and baculovirus is learned users' guidebook 9-10 page or leaf).

Behind the serial dilution 4 days, in cell, add virus, with the blue plaque of Eppendorf tube head picking.The agar that will contain recombinant virus is resuspended in the Eppendorf pipe that contains 200ul Grace ' s substratum.Simple centrifugal removal agar infects the Sf9 cell that is inoculated on the 35mm ware with the supernatant liquor that contains recombinant baculovirus.After 4 days, collect the supernatant liquor in these culture dish, then 4 ℃ of preservations.

The Sf9 cell grows in the Grace ' s substratum that contains 10% hot deactivation FBS.With recombinant baculovirus V-TIMP-4 cells infected, infection multiplicity (MOI) is 2.Remove substratum after 6 hours, (Life Technologies Inc. Gaithersburg) substitutes with the SF900 II substratum that does not contain methionine(Met) and halfcystine.Add 5uCi after 42 hours ³⁵S-methionine(Met) and 5uCi ³⁵S-halfcystine (Amersham).Continued culturing cell 16 hours, then, centrifugal collecting cell is with SDS-PAGE and autoradiography observation labelled protein.

Embodiment 4

The expression pattern of people TIMP-4 in people's tissue

With the total RNA sex change of 20ul of above-mentioned each tissue, carry out 1.2% formaldehyde agarose gel electrophoresis, the capillary trace spends the night to nylon membrane.RNA is fixed on the filter membrane through UV is crosslinked.Insert produced in fragments random primer probe from the EcoRI-Xhol of part TIMP-4 nucleotide sequence, and be used for through making encapsulant with 100ug/ml sex change salmon sperm DNA, hybridization is spent the night and is detected trace in the Church damping fluid.Use 2 * SSC/0.1%SDS and 0.2 * SSC/0.1%SDS to wash successively at 65 ℃.The size criteria sample is BRL RNA ladder and 18S, and 28S ribosome-RNA(rRNA) band is seen Fig. 3.

Sequence table

(1) general information

(i) applicant: GREENE, ET AL.

(ii) denomination of invention: people TIMP-4

(iii) sequence number: 2

(iv) contact address:

(A) contact person: CARELLA, BYRNE, BAIN, GILFILLAN, CECCHI, STEWART ﹠amp; OLSTEIN

(B) street: 6 BECKER FARM ROAD

(C) city: ROSELAND

(D) state: NEW JERSEY

(E) country origin: USA

(F) postcode: 07068

(v) computer-reader form:

(A) medium type: 3.5 inches dishes

(B) computer: IBM PS/2

(C) operating system: MS-DOS

(D) software: WORD PERFECT 5.1

(vi) the application's data

(A) application number:

(B) applying date:

(C) classification

(vii) application materials formerly

(A) application number:

(B) applying date:

(viii) lawyer/proxy's information

(A) name: FERRARO, GREGORY D.

(B) registration number: 36,134

(C) reference/number of documents: 325800-278

(ix) telecom information:

(A) phone: 201-994-1700

(B) fax: information (i) sequence signature of 201-994-1744 (2) SEQ ID NO:1

(A) length: 675 base pairs

(B) type: nucleic acid

(C) chain: strand

( D ) ： ( ii ) ：cDNA ( xi ) ：SEQ ID NO：1ATGCCTGGGA GCCCTCGGCC CGCGCCAAGC TGGGTGCTGT TGCTGCGGCT GCTGGCGTTG 60CTGCGGCCCC CGGGGCTGGG TGAGGCATGC AGCTGCGCCC CGGCGCACCC TCAGCAGCAG 120ATCTGCCACT CGGCACTTGT GATTCGGGCC AAAATCTCCA GTGAGAAGGT AGTTCCGGCC 180AGTGCAGACC CTGCTGACAC TGAAAAAATG CTCCGGTATG AAATCAAACA GATAAAGATG 240TTCAAAGGGT TTGAGAAAGT CAAGGATGTT CAGTATATCT ATACGCCTTT TGACTCTTCC 300CTCTGTGGTG TGAAACTAGA AGCCAACAGC CAGAAGCAGT ATCTCTTGAC TGGTCAGGTC 360CTCAGTGATG GAAAAGTCTT CATCCATCTG TGCAAGTACA TCGAGCCCTG GGAGGACCTG 420TCCTTGGTGC AGAGGGAAAG TCTGAATCAT CACTACCATC TGAACTGTGG CTGCCAAATC 480ACCACCTGCT ACACAGTACC CTGTACCATC TCGGCCCCTA ACGAGTGCCT CTGGACAGAC 540TGGCTGTTGG AACGAAAGCT CTATGGTTAC CAGGCTCAGC ATTATGTCTG TATGAAGCAT 600CTTGACTTCA CCTGCAGCTG GTACCGGGGC CACCTGCCTC TCAGGAAGGA GTTTGTTGAC 660ATXGTTCAGC CCTAG 675 ( 2 ) SEQ ID NO：2 ( i )

(A) length: 224 amino acid

(B) type: amino acid

(C) chain:

(D) topology: line style is molecule type (ii): protein (xi) sequence description: SEQ ID NO:2Met Pro Gly Ser Pro Arg Pro Ala Pro Ser Trp Val Leu Leu Leu

-25 -20 -15Arg?Leu?Leu?Ala?Leu?Leu?Arg?Pro?Pro?Gly?Leu?Gly?Glu?Ala?Cys

-10 -5 1Ser?Cys?Ala?Pro?Ala?His?Pro?Gln?Gln?His?Ile?Cys?His?Ser?Ala

5 10 15Leu?Val?Ile?Arg?Ala?Lys?Ile?Ser?Ser?Glu?Lys?Val?Val?Pro?Ala

20 25 30Ser?Ala?Asp?Pro?Ala?Asp?Thr?Glu?Lys?Met?Leu?Arg?Tyr?Glu?Ile

35 40 45Lys?Gln?Ile?Lys?Met?Phe?Lys?Gly?Phe?Glu?Lys?Val?Lys?Asp?Val

50 55 60Gln?Tyr?Ile?Tyr?Thr?Pro?Phe?Asp?Ser?Ser?Leu?Cys?Gly?Val?Lys

65 70 75Leu?Glu?Ala?Asn?Ser?Gln?Lys?Gln?Tyr?Leu?Leu?Thr?Gly?Gln?Val

80 85 90Leu?Ser?Asp?Gly?Lys?Val?Phe?Ile?His?Leu?Cys?Asn?Tyr?Ile?Glu

95 100 105Pro?Trp?Glu?Asp?Leu?Ser?Leu?Val?Gln?Arg?Glu?Ser?Leu?Asn?His

110 115 120His?Tyr?His?Leu?Asn?Cys?Gly?Cys?Gln?Ile?Thr?Thr?Cys?Tyr?Thr

125 130 135Val?Pro?Cys?Thr?Ile?Ser?Ala?Pro?Asn?Glu?Cys?Leu?Trp?Thr?Asp

140 l45 150Trp?Leu?Leu?Glu?Arg?Lys?Leu?Tyr?Gly?Tyr?Gln?Ala?Gln?His?Tyr

155 160 165Val?Cys?Met?Lys?His?Val?Asp?Gly?Thr?Cys?Ser?Trp?Tyr?Arg?Gly

170 175 180His?Leu?Pro?Leu?Arg?Lys?Glu?Phe?Val?Asp?Ile?Val?Gln?Pro

185 190 195

Claims (24)

1, a kind of isolating polynucleotide are selected from:

(a) coding has the polypeptide of deduced amino acid of Fig. 1 or the fragment of said polypeptide, the polynucleotide of analogue or derivative;

(b) coding has by the polypeptide of the cDNA amino acid sequence coded that is contained in ATCC preserving number 75946 or the fragment of said polypeptide, the polynucleotide of analogue or derivative.

2, the polynucleotide of claim 1, wherein polynucleotide are DNA.

3, the polynucleotide of claim 1, wherein polynucleotide are RNA.

4, the polynucleotide of claim 1, wherein polynucleotide are genomic dnas.

5, the polynucleotide of claim 2, wherein said polynucleotide encoding has the polypeptide of the deduced amino acid of Fig. 1.

6, the polynucleotide of claim 2, wherein said polynucleotide encoding is by the cDNA encoded polypeptides of ATCC preserving number 75946.

7, the polynucleotide of claim 1 have encoding sequence shown in Figure 1.

8, the polynucleotide of claim 2 have the encoding sequence with 75946 preservations of ATCC preserving number.

9, a kind of carrier contains the DNA of claim 2.

10, a kind of genetically engineered host cell of carrier with claim 9.

11, produce the method for a peptide species, comprise the polypeptide of the host cell expression of Accessory Right requirement 10 by said dna encoding.

12, produce the method for the cell of energy express polypeptide, comprise that the carrier pair cell with claim 9 carries out genetically engineered.

13, a kind of can have the separated DNA of the active polypeptide of people TIMP-4 with the DNA hybridization and the coding of claim 2.

14, a peptide species is selected from polypeptide and fragment thereof that (i) has the deduced amino acid of Fig. 1, analogue and derivative and (ii) by cNDA encoded polypeptides and the fragment of said polypeptide, analogue and the derivative of ATCC preserving number 75946.

15, the polypeptide of claim 14, polypeptide wherein has the deduced amino acid of Fig. 1.

16, the antibody of the polypeptide of anti-claim 14.

17, at the antagonist of the polypeptide of claim 14.

18, a kind of treatment needs the patient's of people TIMP-4 method, comprising: the polypeptide of giving the claim 14 of significant quantity on patient's administering therapeutic.

19, a kind of method for the treatment of the patient who needs inhibition people TIMP-4 comprises the antagonist to the claim 17 of significant quantity on patient's administering therapeutic.

20, a kind of pharmaceutical composition comprises the polypeptide and the medicinal acceptable carrier of going up of claim 14.

21, the method for claim 18, the polypeptide of significant quantity is through DNA that the said polypeptide of coding is provided to patient and expresses said polypeptide in vivo and come medication in the wherein said treatment.

22, a kind of evaluation has the method for the compound of people TIMP-4 stimulant or antagonistic activity, comprises

Mix MMP, people TIMP-4, compound to be screened and contain the reaction mixture of the substrate that can be degraded by MMP, wherein said substrate is labeled; And

Determine that through measuring the mark that from substrate, discharges compound enhancing or inhibition are by the ability of said MMP to the degraded of substrate.

23, the disease that diagnosis is relevant with sudden change in the people TIMP-4 nucleotide sequence or the method for disease susceptibility comprise:

From nucleotide sequence from separation coding people TIMP-4 host's the sample; With

Measure the sudden change in the people TIMP-4 nucleotide sequence.

24, a kind of diagnostic method comprises:

The existence of the polypeptide of right to analysis requirement 14 in from host's sample.

Images