CN117448330A

CN117448330A - Construction method and application of ACSL4 gene deleted MDCK homozygote cell line

Info

Publication number: CN117448330A
Application number: CN202311390977.4A
Authority: CN
Inventors: 袁小远; 张玉霞; 董雯雯; 孟凯; 李桂明; 于志君
Original assignee: Poultry Research Institute Shandong Academy of Agricultural Sciences
Current assignee: Poultry Research Institute Shandong Academy of Agricultural Sciences
Priority date: 2023-10-25
Filing date: 2023-10-25
Publication date: 2024-01-26

Abstract

The invention belongs to the technical field of biology, and particularly relates to a construction method and application of an ACSL4 gene-deleted MDCK homozygote cell line. According to the construction method, the ACSL4 gene of the canine kidney cell MDCK is knocked out by adopting a specific gRNA high-efficiency targeting ACSL4 gene and combining with a CRISPR/Cas9 gene editing technology, so that the construction method is safe, quick and low in off-target effect.

Description

Construction method and application of ACSL4 gene deleted MDCK homozygote cell line

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a construction method and application of an ACSL4 gene-deleted MDCK homozygote cell line.

Background

Acyl-coa synthetase long chain family member 4 (Acyl-CoA synthetase long chain family member, ACSL 4) is a key enzyme regulating lipid components that catalyzes the reaction of long chain fatty acids and coa to ester Acyl-coa. This step activates long chain fatty acids for lipid synthesis and energy metabolism, lipid peroxidation occurs, and further promotes cell iron death.

The Canine kidney cells (MDCK, madin-Darby Canine) are widely used for separating, culturing and purifying various respiratory tract and enteroviruses of livestock and poultry, and have the advantages of easy culture, high growth speed, high stability and plasticity, capability of forming single-layer cell membranes and the like. The gene knockout technology generally adopts a homologous recombination technology to introduce the constructed gene knockout vector into a receptor cell, utilizes the principle of homologous recombination of base sequences to directionally integrate vector DNA into a certain position on the genome of the receptor cell, and finally can lead to the loss of a specific gene function, thereby leading to the screening of partial functions of the gene regulation and control, and further analyzing and judging the influence on various aspects of organisms.

Based on the need to study various cellular activities in which the ACSL4 gene participates, such as by regulating its mediated cellular iron death, and further by activating or blocking the iron death activity, stable cell lines in which the ACSL4 gene is deleted are expected to be good targets of study. There are no reports on construction of MDCK cells with the ACSL4 gene deleted.

The ACSL4 gene of the MDCK cells is knocked out in the study, the MDCK cell homozygote with the ACSL4 gene deleted is obtained, and after 3 passages and freezing storage, the stable resuscitative reproduction can be realized, and the stable physiological characteristics can be maintained. The method has great significance for researching various cell activities participated by ACSL4 genes and relieving or treating various diseases.

Disclosure of Invention

The invention aims to provide a construction method and application of an ACSL4 gene-deleted MDCK homozygote cell line. The construction method adopts the specific gRNA to efficiently target the ACSL4 gene and combines the CRISPR/Cas9 gene editing technology to knock out the ACSL4 gene of the canine kidney cell MDCK, thereby being safe and quick, having low off-target effect and low off-target rate of less than 30 percent.

The invention provides one of the following technical schemes:

specific gRNA for targeted knockout of ACSL4 gene, which gRNA is located at 366-344 sites of ACSL4 gene at the targeted site of ACSL4 gene (Genbank No: XM 038588058); the nucleotide sequence of the specific gRNA is SEQ ID NO.1: gRNA-A1: TATCCAGAGTGTCAGCTCCGGGG.

Further, the CRISPR/Cas9 system of the present invention comprises a specific gRNA as described above. The CRISPR/Cas9 system comprises two portions of a CRISPR locus and a Cas gene (CRISPR associated gene). CRISPR gene sequences consist mainly of leader (leader), repeat (repeat) and spacer (spacer). The Cas gene is located near the CRISPR gene or scattered elsewhere in the genome, and the proteins encoded by the gene can all co-act with the CRISPR sequence region. Compared with the traditional gene editing technology, the CRISPR/Cas9 system has the advantages of high editing efficiency, more accurate editing sites, low off-target probability, low verification cost, simplicity in operation and the like.

The invention provides a second technical scheme as follows:

the construction method of the ACSL4 gene-deleted MDCK homozygote cell comprises the following operation steps:

(1) Electroconverting the specific gRNA and Cas9 protein prepared in step (1) to MDCK cells at a 1:3 volume ratio;

(2) And selecting monoclonal and obtaining the MDCK homozygous cells with the ACSL4 gene knocked out through PCR and sequencing verification.

Further, the electrical conversion parameters in the step (2) are as follows: c=25 μf, pc=200Ω, v=1.8 kV; the primers used in the PCR in the step (3) are shown as SEQ ID NO.2 and SEQ ID NO. 3.

The invention provides a third technical scheme as follows:

an MDCK homozygote cell line is constructed by the construction method.

The invention provides a fourth technical scheme as follows:

the application of the MDCK homozygote cell line in constructing an ACSL4 gene knockout in-vitro cell model.

The MDCK homozygote cell line is applied to separation, culture and purification of livestock and poultry respiratory tract and enteroviruses.

The invention has the beneficial effects that:

the invention adopts a Cas9 RNP system method, knocks out ACSL4 genes of canine kidney cells MDCK by using a CRISPR/Cas9 gene editing technology mediated by an electrotransfer method, and has the advantages of safety, rapidness and low off-target effect. After electrotransformation, monoclonal is selected, and verified by PCR and sequencing, the MDCK homozygous cell with the ACSL4 gene knocked out is successfully obtained. The MDCK cells with the ACSL4 gene knocked out still can keep the physiological characteristics, and can be stably propagated and passaged after repeated freezing and recovering, so that a good model is provided for researching various cell activities participated by the ACSL4 gene.

Drawings

The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the invention and do not constitute a limitation on the invention. In the drawings:

FIG. 1 shows the PCR amplification results of monoclonal 1A3 of the present invention;

FIG. 2 shows the sequencing results of monoclonal 1A3 of the invention;

FIG. 3 is a photomicrograph (100X) of a homozygous cell of MDCK 1A3 of the invention.

Detailed Description

In order to clearly illustrate the technical features of the present solution, the present invention will be described in detail below with reference to the accompanying drawings. The scope of the present invention is not limited to the following examples. Those skilled in the art will appreciate that various changes and modifications can be made to the invention without departing from the spirit and scope thereof.

The instruments, reagents, materials, etc. used in the examples described below are conventional instruments, reagents, materials, etc. known in the art, and are commercially available. The experimental methods, detection methods, and the like in the examples described below are conventional experimental methods, detection methods, and the like that are known in the prior art unless otherwise specified. Parts, percentages, etc., referred to in the examples below are weight units unless otherwise indicated.

1. Material

1.1 main reagents:

Neon ^TM transfection System 10. Mu.L of kit (Invitrogen, MPK 1096), hygromycin B (Invitrogen, 10687-010), enGenTM Spy Cas9 NLS (NEB, M0646T), whole blood/cultured cell DNA kit (Simgen, 3002250), DMEM basal medium (OriCellB, DMF-03011), fetal bovine serum (OZFAN, AF 500-P).

1.2 preliminary detection of MDCK cells for the test of the invention

After resuscitating MDCK cells (supplied by the racing organism), 20 μl of the cell suspension was withdrawn for bacterial and mycoplasma detection, with primers for bacterial detection being 16s universal primers:

F:5’-AGAGTTTGATCMTGGCTCAG-3’(SEQ ID NO.4)，

R:5’-TACGGYTACCTTGTTACGACTT-3’(SEQ ID NO.5)；

the primers for mycoplasma detection are:

F:5-GAGGCTTATCGCAGGTAATCACG-3’(SEQ ID NO.6)，

R:5’-AACAAGGTATCCCTACGAGAACG-3’(SEQ ID NO.7)。

after PCR reaction, the detection results of bacteria and mycoplasma are negative.

1.3 obtaining the genome of the cells of the invention

The MDCK cells are directly subjected to genome extraction, and the steps are as follows:

collecting the mixture in a centrifuge tube with the concentration of less than or equal to 5 multiplied by 10 in 1.5mL ⁶ Cells were cultured, 180. Mu.L of PBS solution was added thereto, and the cells were sufficiently suspended and cultured by vortexing. mu.L of proteinase K was added. 200. Mu.L Buffer Sl was added and mixed by vortexing for about 15 seconds. The centrifuge tube was placed in a 56℃water bath for 10 minutes. The solution on the tube cap was allowed to settle to the bottom of the tube by low speed centrifugation for several seconds. 200mL of absolute ethanol was added and mixed by vortexing for about 15 seconds. The above solution was pipetted into a nucleic acid purification column (the column was placed in a 2mL centrifuge tube), covered with a tube cap and centrifuged at 12000rpm for 60 seconds. The 2mL centrifuge tube was discarded, the nucleic acid purification column was returned to the 2mL centrifuge tube, 500. Mu.L of wash Buffer was added to the nucleic acid purification column, the tube cap was closed, and the mixture was centrifuged at 12000rpm for 60 seconds. The filtrate in the centrifuge tube was discarded, the nucleic acid purification column was returned to the 2mL centrifuge tube, and 600. Mu.m, was added to the nucleic acid purification columnL wash Buffer, cap tube lid, centrifuge at 12000rpm for 60 seconds. The filtrate in the 2mL centrifuge tube was discarded, the nucleic acid purification cartridge was placed back into the 2mL centrifuge tube, the cap was closed, and the cartridge was centrifuged at 14000rpm for 1 minute. The 2mL centrifuge tube was discarded, the nucleic acid purification cartridge was placed in a clean 1.5mL centrifuge tube, 100. Mu.L of the eluate incubated at 56℃was added to the center of the membrane of the purification cartridge, the tube was covered, and the mixture was allowed to stand at room temperature for 1 minute and centrifuged at 12000rpm for 60 seconds. The purification column was discarded and the eluted DNA was immediately used in the following experiments or the DNA was stored at-20℃for use.

2 Experimental methods

2.1 acquisition of gRNA

According to the design principle of the gRNA target sequence, the target sequence is designed at 366-344 sites (Genbank No: XM 038588058) of the ACSL4 gene, in the design process, the gRNA target is close to the N end of protein coding, so that the possibility of gene damage is increased, PAM (NGG) sequences are arranged before and after the target, 3 gRNAs are constructed by total design, and the optimal gRNA-A1 with mediated localization effect specificity is optimally screened, as shown in SEQ ID NO.1, and the length of the gRNA-A1 is 23 nucleotides, so that the operation is convenient.

The ACSL4 gene gRNA targeting site and its nearby genomic sequences were amplified. Optimally designing a reaction system and a reaction program aiming at target sequence gRNA-A1:5'TATCCAGAGTGTCAGCTCCGGGG 3' amplification are as follows: 100-200ng of template, 0.6. Mu.L of upstream primer F (10. Mu.M), 0.6. Mu. L, dNTPs (2.5 mM) 1.8. Mu.L of downstream primer R (10. Mu.M), 5X LongAmp Taq Reaction 3. Mu.L, longAmp Taq DNA Polymerase. Mu.L, and 15.0. Mu.L of sterile water-adjusted total system. Pre-denaturation at 94℃for 3min, denaturation at 94℃for 30s, annealing at 62℃for 35s, extension at 65℃for 50s,35 cycles, final extension at 72℃for 10min. The PCR products were electrophoresed using agarose gel and cut and then sent to sequencing company for sequencing, and sequencing was identified as correct.

Upstream primer (SKO 705-F2): 5'GCTGCTTCCGTTATTGCCTT 3' (SEQ ID NO. 2)

The downstream primer (SKO 705-R2) 5'GTGCAGTGAGTCCACTACCAA 3' (SEQ ID NO. 3).

Construction of 2.2ACSL4 Gene-deleted MDCK cell line

2.2.1 electric transfer

Cas9 RNP methods were used to directly complex-transfect Cas9 proteins and grnas into cells by electro-stimulated transfection. Because Cas9 protein is uncharged, and gRNA is charged, after the Cas9 protein and the gRNA are combined, the gRNA can be efficiently transfected into MDCK cells. Moreover, the Cas9-gRNA complex can be gradually degraded in cells and the residence time is not long, so that the operation is simplified and the probability of off-target occurrence is low. The method comprises the following specific steps:

s1, the gRNA, cas9 protein, etc. are taken out and equilibrated to room temperature for use. And (5) preparing an electrotransport converter according to the required final concentration, and starting a power supply for preheating. Taking out 1 clean electric rotating cup, adding 3mL E2 Buffer, and clamping on a pipette rack matched with the electric rotating instrument for standby.

S2, collecting MDCK cells, washing 1 time by 1 XPBS, and counting.

S3, setting 3 groups, namely a negative control group, a formal group and a positive control group. Each group takes 1 x 10 ⁶ Individual cells, centrifuged, and the supernatant removed. In addition, 3 groups of fresh medium DMEM ready for use were prepared in advance and labeled for inoculation of cells after electrotransformation.

Negative control group: cells were resuspended using R/T Buffer. And then the pipette matched with the electrotransport device is provided with a 100uL gun head, the cell suspension is sucked and transferred into the electrotransport cup to be firmly clamped, and no air bubble can be generated in the gun head. The electric rotation parameters c=25μf, pc=200Ω, v=1.8 kV post-electric rotation are set. After the electrotransfer is completed, the pipettor is taken out of the electrotransfer cup, and the cells are inoculated into the prepared culture medium and uniformly mixed. Finally, about 20uL of cell suspension was removed for viability calculation.

Formal group: the cells were resuspended using R/T Buffer, and gRNA and Cas9 protein (both in a 1:3 ratio) were added sequentially, dsDNA was added in an amount of 2. Mu.g, the total volume was controlled to 113uL, and mixed well. And (3) turning the culture medium electrically under the same parameters, inoculating the culture medium into the prepared culture medium, and uniformly mixing. Finally, about 20uL of cell suspension was also removed for viability calculation.

Positive control group: the positive control AGO2 knockout BHK plasmid (established prior to the subject group, validated) was added to the cells using R/T Buffer resuspended, and the procedure was as above.

3 groups of cells were placed in an incubator for culture. Samples of 3 groups of cells were stained with trypan blue separately, and viability was calculated and recorded. After 24 hours, the fluorescence expression conditions of the positive control group and the formal experiment group are observed, and the fluorescence rates of the positive control group and the formal experiment group are obtained by microscopic counting and recorded. If the cell state is normal, screening the medicine after 48 hours. If the cell state is poor, the cell can be recovered and then the medicine can be screened.

2.2.2 monoclonal culture

Monoclonal plating was performed using limiting dilution. During the time that the cells were subjected to monoclonal culture in 96-well plates (i.e., before 60% cell confluency), the frequency of culture medium exchange was 1 time per week.

Periodically observing the monoclonal in culture, and counting out hole conditions within 2 weeks of inoculating the 96-well plate; wells without monoclonal growth were marked with an "x" on the plate cover; the number of holes and the hole-out rate were recorded. If the number of the outlet holes is lower than 200, the cells after the medicine screen are required to be recovered, and then the monoclonal is re-plated; if the hole rate of the 96-well plate is lower than 50%, plate collecting operation is needed before plate preparation. When the confluence of the cell monoclonals in the 96-well plate generally reaches 60-70%, the plate preparation operation is carried out.

2.2.3 cell monoclonal screening and detection

(1) PCR primer:

upstream primer (SKO 705-F2): 5'GCTGCTTCCGTTATTGCCTT 3' (SEQ ID NO. 2)

Downstream primer (SKO 705-R2): 5'GTGCAGTGAGTCCACTACCAA 3' (SEQ ID NO. 3)

(2) The reaction system: template 1.5uL, upstream primer F (10. Mu.M) 1.0uL, downstream primer R (10. Mu.M) 1.0uL, 2 Xpolymerase PCR Mix 12.5uL, sterile water was adjusted to 25.0uL.

Reaction conditions: pre-denaturation at 94℃for 3min, denaturation at 94℃for 30s, annealing at 62℃for 35s, extension at 72℃for 35s, and final extension at 72℃for 5min. And (5) observing the result by electrophoresis. The wild PCR band size was 773bp. As shown in fig. 1.

The sequencing primer was the upstream primer (SKO 705-F2): 5'GCTGCTTCCGTTATTGCCTT 3'.

The sequencing results are shown in FIG. 2. The monoclonal critical site sequencing results were as follows:

CACGCACTTCGACTCACTAGCTGTCATAGACATCCCCGGA--insert1bp--A--GCTGACACTCTGGATAAGTTATTTGATCATGCCGTGTCCA。

(3) Results: MDCK monoclonal 1A3 is identified as a gene knockout homozygote by PCR and sequencing.

3. Stability investigation of ACSL4 deleted MDCK homozygote cells

3.1 passage of homozygous cells

Basic culture system determined by the study: dmem+10% fbs, the passaging ratio was optimal at 1:3 passaging. As a result, bacteria were detected as sterile, and mycoplasma was detected as negative. As shown in fig. 3, it can be seen that: the homozygote cell of the invention can still maintain the physiological characteristics after multiple passages, and has remarkable stability.

The method comprises the following specific steps:

the complete medium, sterilized PBS and pancreatin were first warmed to 37 ℃. Carefully aspirate the medium from the culture vessel. Cells were washed 1 time with PBS (e.g., T25 flask plus about 6 mL), and the whole was washed with care. The PBS was blotted off.

Pancreatin (T25 flask was added to about 3 mL) was added and rapidly spread to ensure adequate contact with the cell surface. Putting the mixture into an incubator for digestion and observation. Observing digestion conditions under a microscope, and after about 70% -80% of cell shapes shrink and become round, tapping the outer wall of the culture container and observing that cells are separated from the culture surface.

Complete medium (T25 flask was added to about 6 mL) was immediately added in 2 volumes of pancreatin, followed by gentle shaking of the culture vessel to allow rapid mixing of medium and pancreatin. The cell suspension was pipetted, the bottom surface of the culture vessel was blown off several times, and the cells were blown off as much as possible. The blowing action can not be intense, so that a large number of bubbles are avoided, and cells are prevented from being damaged and lost.

The cell suspension was transferred to a centrifuge tube. The vessel was washed 1 time with PBS (T25 flask added with about 3 mL) and residual cells were collected. All cell suspensions collected were centrifuged at 1100rpm for 4min. After centrifugation, the supernatant was removed. 1mL of complete culture medium is added, cell sediment is gently blown off, and the mixture is fully blown off and uniformly mixed.

Inoculating cells at a certain ratio, and passaging for the first time according to a ratio of 1:3, if the cells grow full within two daysThe passage ratio can be increased, and if the cells are not grown fully for 72 hours, the passage ratio can be properly reduced. And adjusting the passage ratio according to the actual growth condition of the cells. Shaking the cells, adding 5% CO at 37deg.C ₂ Is placed in an incubator with saturated humidity.

The following passage day, the cell state was observed. If more dead cells are found, the liquid change operation is performed. After that, the complete medium is changed every 2 days, and the cells are observed to grow to a confluency of more than 80%, namely, the cells need to be passaged or frozen.

4. Cryopreservation and resuscitation of ACSL 4-deleted MDCK homozygote cells

And (5) pre-cooling the cooling box and the frozen stock solution in a refrigerator at 4 ℃ before operation. And (5) freezing and preserving the cells after the cells grow to the confluence of more than 80 percent. Centrifuging, removing supernatant, and uniformly re-suspending cells to a concentration of 10 with appropriate amount of lyophilized solution ⁷ /ml. The cells were dispensed into cryopreservation tubes at a ratio (50-70%).

And (3) placing the cell freezing tube into a precooled program cooling box, then placing the program cooling box into a refrigerator at the temperature of-80 ℃, and transferring the cell freezing tube into liquid nitrogen for long-term storage the next day.

Preparation before resuscitation: the water bath kettle is started to preheat at 37 ℃. The complete medium was incubated to 37 ℃.

6mL of complete medium was added to a 15mL centrifuge tube for further use.

Taking out cells from liquid nitrogen, putting the cells into a water bath kettle at 37 ℃ and shaking the cells to enable the frozen suspension to be melted rapidly. And wiping the outer surface of the freezing and storing tube with alcohol cotton ball in the super clean bench for disinfection. The frozen tube was opened in a super clean bench, the cell frozen suspension was pipetted with a pipette and transferred to a centrifuge tube of the prepared complete medium.

The frozen tube was washed 1 time with 1mL of complete medium and residual cells were collected, reducing losses. The cell suspension was centrifuged at 1100rpm for 4min. After centrifugation, the supernatant was removed. 1mL of complete culture medium is added, cell sediment is gently blown off, and the mixture is fully blown off and uniformly mixed. Cells were inoculated on average into 1T 25 flask or equivalent bottom area culture vessel. Adding enough complete culture medium, and adding the total amount of the culture medium in 1T 25 culture flask to be not less than 6mL.

Shaking the cells, and placing the cells in an incubator with a saturated humidity of 5% CO2 at 37 ℃. The cells are not required to be moved or observed as much as possible within 2 hours of inoculation, so that the cell adhesion is affected, and the conditions of poor state, cell aggregation, uneven adhesion and the like are caused.

The next day of resuscitating, observing the state of the cells, and if the cell adherence condition is good, replacing a fresh complete culture medium; if the cells are observed to be in a round and bright form but not attached to the wall, the cells can be continuously cultured for 24 hours and then subjected to liquid exchange operation. After that, the complete medium was changed every 2 days, and cells were observed to grow to a confluence of 80% or more and passaged.

The foregoing is merely exemplary of the present application, and the scope of the present application is not limited to the specific embodiments, but is defined by the claims of the present application. Various modifications and changes may be made to the present application by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the technical ideas and principles of the present application should be included in the protection scope of the present application.

Claims

1. The specific gRNA for targeted knockout of the ACSL4 gene is characterized in that the nucleotide sequence of the gRNA is gRNA-A1: TATCCAGAGTGTCAGCTCCGGGG, and is shown as SEQ ID NO. 1.

The construction method of the ACSL4 gene-deleted MDCK homozygote cell line is characterized by comprising the following operation steps:

3. The method for constructing an ACSL4 gene-deleted MDCK homozygous cell line according to claim 2, wherein the primers used in the PCR in the step (3) are shown in SEQ ID No.2 and SEQ ID No. 3.

4. An MDCK homozygous cell line constructed by the construction method of claim 3.

5. Use of the MDCK homozygous cell line of claim 4 in the construction of an ACSL4 knockout in vitro cell model.

6. Use of the MDCK homozygous cell line of claim 4 in the separation, culture and purification of livestock and poultry respiratory tract and enteroviruses.