CN117431305A - PCR premix and PCR amplification method - Google Patents

Abstract

The present application relates to a PCR premix comprising polyethylene glycol octylphenyl ether, octylphenyl-polyethylene glycol, BSA and blue dextran 2000 and a PCR amplification method. Polyethylene glycol octyl phenyl ether, octyl phenyl-polyethylene glycol, BSA and blue glucan 2000 are compounded to cooperatively promote the lysis of untreated sample cells, and the PCR amplification effect is obviously improved due to the protection effect on released RNA and hot-start Tth enzyme. When the PCR premix is used for amplification, complex pretreatment operations such as nucleic acid extraction or cleavage, genome removal, reverse transcription reaction and the like are not required to be carried out on a sample, and the PCR premix can be directly added into the sample for amplification reaction.

Description

PCR premix and PCR amplification method

Technical Field

The application relates to the field of biotechnology, in particular to a PCR premix and a PCR amplification method.

Background

The real-time fluorescent quantitative PCR (Quantitative Real Time PCR, RT-qPCR) technology is widely applied to the fields of tissue, cell, virus, pathogen detection, transgenic food detection, cancer gene detection and the like. In general, when a sample is subjected to gene detection, firstly, an RNA extraction kit is required to extract RNA from the sample, then the RNA is subjected to reverse transcription into first-strand cDNA by a reverse transcription kit, and finally, the cDNA is subjected to Real Time PCR amplification reaction by qPCR mix (qPCR premix). The series of procedures need to go through complicated operation steps and experimental operation time of approximately 7-8 hours, and the failure can be caused by poor performance of the kit in any link or improper operation of an operator in the process, so that manpower, material resources and time cost are greatly wasted.

With the development of biotechnology, the direct amplification RT-qPCR technology simplifies the nucleic acid extraction and reverse transcription reaction steps to a certain extent, and reduces the experimental time. In the prior art, a sample is reacted with a 2-3 tube cracking reaction solution and a stop solution at a higher temperature to obtain a cracking product, then the cracking product is centrifuged to remove precipitate, released nucleic acid supernatant is subjected to Dnase I enzyme digestion to obtain RNA, and finally a one-step RT-qPCR mix (RT-qPCR premix) is used for carrying out gene amplification reaction. The whole process is a direct amplification kit, so that the centrifugal column method RNA nucleic acid extraction and reverse transcription reaction process is omitted, the operation process is still more complicated, the time consumption is 2 hours, the kit relates to more professional equipment and clean environment, and special requirements are also provided for personnel. And protein allosteric agents, strong bases, organic solvents and/or high concentration salt ions are needed in the whole process, which can lead to low accuracy of amplification results. At present, most animal and plant direct-amplification PCR (polymerase chain reaction) kits in the market, namely, oral cavity swabs, nasopharynx swabs, serum, plasma, genital tract secretions and other sample direct-amplification qPCR/RT-qPCR kits, and cell-related direct-amplification kits are relatively deficient, and particularly, the RT-qPCR mix with nucleic acid release, genome removal, reverse transcription and qPCR amplification effects and cell RNA extraction-free functions is not found in the prior art. Therefore, development of a direct-amplification RT-qPCR method and RT-qPCR mix (RT-qPCR premix) with good amplification performance, high sensitivity, simplicity, high efficiency, rapidness, low cost and cell extraction-free has been needed.

Currently, the methods for determining cell lentivirus titer mainly adopt a fluorescence titer method, an Elisa method and an RT-qPCR method. The method has the main defects of complex operation, repeated uncovering, long time consumption, low accuracy and high reagent cost in the existing lentivirus titer determination, particularly under the condition of small cell number, the complicated steps and repeated uncovering cause serious nucleic acid loss and easy pollution by nucleic acid aerosol, so that the lentivirus titer level cannot be accurately detected. To date, a simple, rapid, and efficient lentivirus titer identification method has not been discovered.

Disclosure of Invention

Accordingly, it is necessary to provide a PCR premix in which, when the PCR amplification is performed using the PCR premix, the sample can be directly added to the PCR premix to perform the PCR amplification, and the complex steps of nucleic acid extraction or sample cleavage, genome removal, reverse transcription reaction, and the like are omitted, and the release of sample RNA, the completion of genome removal reaction, reverse transcription reaction, and qPCR amplification reaction can be performed in the PCR premix. Meanwhile, the PCR premix can rapidly, simply, conveniently and accurately measure the titer level of the cell lentivirus.

The specific technical scheme is as follows:

a PCR premix comprising polyethylene glycol octylphenyl ether, octylphenyl-polyethylene glycol, BSA, and blue dextran 2000.

In one embodiment, the PCR premix comprises the following working concentration components: 0.01 to 0.1% v/v polyethylene glycol octylphenyl ether, 0.05 to 0.5% v/v octylphenyl-polyethylene glycol, 0.05 to 0.5% w/v BSA and 0.005 to 0.05% w/v blue dextran 2000.

A PCR amplification method comprising amplification using the PCR premix or using the reagent or kit.

In one embodiment, the amplified sample comprises a cell sample.

The PCR premix and the reagent or kit are used for lentiviral titer assays.

Compared with the traditional technology, the application has the following beneficial effects:

the PCR premix containing polyethylene glycol octyl phenyl ether, octyl phenyl polyethylene glycol, BSA and blue glucan 2000 is prepared by compounding the components of polyethylene glycol octyl phenyl ether, octyl phenyl polyethylene glycol, BSA and blue glucan 2000, and the components cooperate to promote efficient cell lysis of an untreated sample, so that the PCR premix has a protective effect on released RNA and hot-start Tth enzyme, and the PCR amplification effect is remarkably improved. In addition, the formula components of the PCR premix are mild and nontoxic, and the operation safety of personnel is improved.

When the PCR premix is used for amplification, complex pretreatment operations such as nucleic acid extraction or cracking, genome removal, reverse transcription reaction and the like are not required to be carried out on a sample, the PCR premix can be directly added into the sample for amplification reaction, and each reaction of nucleic acid extraction, genome removal, reverse transcription and qPCR is continuously carried out in the same PCR reaction tube, so that repeated uncovering and complex operation are not required, the operation simplicity is greatly improved, the reaction time is reduced, the nucleic acid pollution caused in the operation process is avoided, and the detection efficiency and accuracy are improved. In the operation process, no laboratory professional equipment such as a water bath kettle, a PCR instrument and the like and special environment are needed, and the PCR premix has few components, low cost and higher economic benefit.

The PCR premix and the PCR method provided by the application still have higher detection sensitivity to samples with low cell numbers. The method can rapidly, efficiently and accurately measure the titer level of the cell lentivirus.

Drawings

FIG. 1 is a graph showing GAPDH and ERBB2 gene effects;

FIG. 2 is a graph comparing GPLD1 melting curves and MRS2 melting curves;

FIG. 3 is a standard amplification plot;

FIG. 4 is a melting graph of a standard;

FIG. 5 is a graph of LOG (concentration) versus standard for a standard;

FIG. 6 is a graph of lentiviral sample amplification.

Detailed Description

In order to make the above objects, features and advantages of the present application more comprehensible, embodiments accompanied with the present application are described in detail below. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present application. This application is, however, susceptible of embodiment in many other forms than those described herein and similar modifications can be made by those skilled in the art without departing from the spirit of the application, and therefore the application is not to be limited to the specific embodiments disclosed below.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein in the description of the application is for the purpose of describing particular embodiments only and is not intended to be limiting of the application.

The term "and/or" as used herein includes any and all combinations of one or more of the associated listed items.

As used herein,% v/v refers to volume percent,% w/v refers to mass volume percent.

An embodiment of the present application provides a PCR premix comprising polyethylene glycol octylphenyl ether (Triton X-100), octylphenyl-polyethylene glycol (CA 630), BSA, and blue dextran 2000.

Wherein IGEPAL CA-630 is a nonionic, non-denaturing detergent suitable for solubilization, separation and purification of membrane protein complexes. Bovine Serum Albumin (BSA) can result in efficient cell lysis, improved RNA stability, and improved reverse transcription efficiency, while having a certain resistance to inhibitors generated during cell lysis, reducing the phenomenon of amplification inhibition of DNA polymerase activity by inhibitors. TritonX-100 is a relatively mild surfactant, accelerates the dissolution of extracellular membrane proteins and lipids, and improves the permeability of eukaryotic cell membranes. Blue dextran 2000 increases cell swelling, accelerates cell lysis, and reduces nucleic acid adhesion to the vessel wall; the inhibitor released in the crude cleavage can be effectively combined, the inhibition of lipid substances on DNA polymerase can be relieved, the inhibition of surfactant on PCR can be reduced, and the PCR amplification efficiency can be maintained; in low concentration samples, it can be used as a preservative for nucleic acid species, stabilizing the nucleic acid species against degradation under room temperature storage conditions. The synergistic effect of TritonX-100, CA630, BSA and blue dextran 2000 can improve the effect of the PCR premix on cracking untreated samples, and meanwhile, the PCR premix can not inhibit the hot start Tth enzyme, thereby improving the sensitivity (reducing the CT value of amplification) and the accuracy of the PCR.

The inventor researches show that in the PCR premix, the amplification effect of the Triton X-100 and the blue glucan 2000 compounded on the basis of the CA630 and the BSA components is better than that of the Triton X-100 and the glucan 6000 compounded on the basis of the CA630 and the BSA components, or the Triton X-100 and the trehalose compounded; meanwhile, the amplification effect of the composite TritonX-100, blue dextran 2000 and polyalcohol substance polyethylene glycol 4000 based on the components CA630 and BSA is better.

In one specific example, the PCR premix comprises the following working concentration components:

0.01% v/v to 0.1% v/v TritonX-100, 0.05% v/v to 0.5% v/v CA630, 0.05% w/v to 0.5% w/v BSA and 0.005% w/v to 0.05% w/v blue dextran 2000.

In one specific example, the PCR premix comprises the following working concentration components:

0.025% v/v to 0.05% v/v TritonX-100, 0.15% v/v to 0.3% v/v CA630, 0.05% w/v to 0.25% w/v BSA, and 0.005% w/v to 0.01% w/v blue dextran 2000.

In a specific example, the PCR premix further comprises an aptamer.

In a specific example, the nucleotide sequence of the aptamer is shown in SEQ ID NO. 9.

In one specific example, the working concentration of the aptamer in the PCR premix is 0.05. Mu.M to 1. Mu.M.

In a specific example, the PCR premix comprises components conventional in the art for PCR reactions, and in particular, one or more of enzymes, buffer matrices, dNTPs, cations, rnase inhibitors, enhancers, genomic DNA removal reagents, reducing agents, and fluorescent dyes.

In a specific example, the enzyme comprises a DNA polymerase and/or a reverse transcriptase. Alternatively, the DNA polymerase comprises a hot start DNA polymerase. Alternatively, the reverse transcriptase includes an M-MLV reverse transcriptase and/or an AMV reverse transcriptase.

Further alternatively, the hot start DNA polymerase is selected from hot start Taq enzyme and/or hot start Tth enzyme.

In a specific example, the hot start Tth enzyme has reverse transcriptase and DNA polymerase activity. Optionally, the hot-start Tth enzyme is antibody modified Tth enzyme, and the antibody modified Tth enzyme loses enzyme activity at low temperature and activates enzyme activity at high temperature, so that non-specific amplification can be effectively avoided.

In a specific example, the ratio of monoclonal antibody to Tth enzyme in the antibody-modified Tth enzyme is (9-10) mg/1U.

In a specific example, a method for preparing an antibody modified Tth enzyme comprises the steps of: after mixing Tth enzyme with antibody (9-10) in the proportion of 1U, incubating for 30-60 min at 20-25 ℃, and then cooling and incubating for 2-4 h in a refrigerator at-20-25 ℃.

Specifically, the antibody may be purchased from biontiron (cat No. B23004801), and the Tth enzyme may be purchased from bailibo (cat No. JN 3011).

In a specific example, the buffer matrix comprises at least one of phosphate buffer, glycine buffer, HEPES buffer, boric acid buffer, acetate buffer, and Tris-HCl buffer.

In one particular example, the cation includes K ⁺ 、Mg ²⁺ And NH ₄ ⁺ At least one of them.

In one specific example, the enhancer comprises glycerin.

In a specific example, the genomic DNA removal agent comprises a dsDNase.

In one specific example, the reducing agent includes TCEP.

In one specific example, the PCR premix comprises the following working concentration components: 0.01% v/v to 0.1% v/v polyethylene glycol octylphenyl ether, 0.05% v/v to 0.5% v/v octylphenyl-polyethylene glycol, 0.05% w/v to 0.5% w/v BSA, 0.005% w/v to 0.05% w/v blue dextran 2000, 0.25. Mu.M to 1. Mu.M aptamer, 1.5U/mL to 2.5U/mL hot start Tth enzyme, 1.5U/mL to 2.5U/mL dsDnase, 10U/mu.L to 15U/mu.L RNase inhibitor, 1.5% v/v to 3% v/v glycerol, 40mM to 50mM Tris-HCl, 15mM to 25mM K ⁺ 、1.5mM～3mM Mg ²⁺ 、10mM～15mM NH ₄ ⁺ 0.1 mM-0.25 mM dNTPs, 1.5 mM-2.5 mM TCEP, and 0.2X-1X fluorescent dye.

In one specific example, the PCR premix comprises the following working concentration components: 0.025% v/v to 0.05% v/v polyethylene glycol octylphenyl ether, 0.15% v/v to 0.3% v/v octylphenyl-polyethylene glycol, 0.05% w/v to 0.25% w/v BSA, 0.005% w/v to 0.01% w/v blue dextran 2000, 0.25. Mu.M to 0.5. Mu.M aptamer, 2U/mL to 2.5U/mL hot start Tth enzyme, 2U/mL to 2.5U/mL dsDnase, 12U/. Mu.L to 15U/mu.L RNase inhibitor, 2% v/v to 3% v/v glycerol, 45mM to 50mM Tris-HCl, 20mM to 25mM K ⁺ 、2mM～3mM Mg ²⁺ 、12mM～15mM NH ₄ ⁺ 0.2 mM-0.25 mM dNTPs, 2 mM-2.5 mM TCEP, and 0.32X-0.64X fluorescent dye.

In a specific example, the preparation method of the PCR premix comprises the following steps: the components are uniformly mixed to prepare PCR premix.

Specifically, the method comprises the following steps (1) to (5):

(1) Trir-HCl solution (pH 8.3), KCL solution, mgCl were prepared separately using sterile double distilled water ₂ ﹒6H ₂ O solution, (NH) ₄ ) ₂ SO ₄ And (3) after autoclaving the solution, adding the solution according to a formula, and uniformly mixing.

(2) The BSA solution, the blue dextran 2000 solution and the TCEP solution are prepared by using sterile double distilled water and are mixed uniformly.

(3) Adding BSA solution, blue dextran 2000 solution, CA630 solution, triton X-100 and glycerol into the mixed solution obtained in the step (1), and stirring uniformly.

(4) Adding dNTPs, an aptamer, a TCEP solution, a hot start Tth enzyme, an RNase inhibitor and a thermosensitive dsDnase into the mixed solution obtained in the step (3), and uniformly stirring.

(5) And (3) adding a fluorescent dye into the mixed solution obtained in the step (4) under the condition of no illumination to prepare a PCR premix.

In one specific example, the fluorescent dye includes a SYBRGreen I dye.

In a specific example, the obtained PCR premix is stored at-20deg.C in a sub-package.

An embodiment of the present application also provides a reagent or kit comprising the PCR premix as described above.

An embodiment of the present application also provides a PCR amplification method, which includes performing amplification using the PCR premix solution or using the reagent or kit described above.

Optionally, the amplified sample comprises a cell sample. The cell sample may be a cell sample that has not been subjected to lysis or nucleic acid extraction or the like.

Specifically, the PCR amplification method comprises adding a cell sample into the PCR premix solution for amplification. Alternatively, the PCR comprises quantitative reverse transcription PCR (quantitative reverse transcription PCR, RT-qPCR). Wherein, the cell sample does not need to be subjected to treatments such as lysis or nucleic acid extraction.

RT-qPCR is an experimental method applied in PCR experiments with RNA as starting material. In this method, total RNA or messenger RNA (mRNA) is first transcribed into complementary DNA (cDNA) by reverse transcriptase. Subsequently, qPCR reactions were performed using cDNA as template. RT-qPCR has been used in a variety of molecular biological applications including gene expression analysis, RNA interference validation, microarray validation, pathogen detection, genetic testing, and disease research. One-step RT-qPCR combines reverse transcription with PCR amplification to allow the reverse transcriptase to react with DNA polymerase in the same tube with the same buffer.

An embodiment of the present application also provides a reagent or kit of the PCR premix as described above for use in lentiviral titer assays.

Alternatively, the lentivirus comprises an HIV-type 1 lentivirus. Further alternatively, the primers used for the HIV-type 1 lentiviral titer determination comprise primers having the nucleotide sequences shown in SEQ ID NO. 10-11.

Embodiments of the present application will be described in detail below with reference to examples. It should be understood that these examples are illustrative only of the present application and are not intended to limit the scope of the present application. The experimental methods, in which specific conditions are not noted in the following examples, are preferably referred to in the guidelines given in the present application, may be according to the experimental manual or conventional conditions in the art, may be according to the conditions suggested by the manufacturer, or may be referred to experimental methods known in the art.

In the specific examples described below, the measurement parameters relating to the raw material components, unless otherwise specified, may have fine deviations within the accuracy of weighing. Temperature and time parameters are involved, allowing acceptable deviations from instrument testing accuracy or operational accuracy.

EXAMPLE 1 component and concentration screening of direct amplified RT-qPCR mix

1. Direct amplification RT-qPCR

The 293 cell suspension is used as a template, different reagents are added into RT-qPCR mix to screen components and optimal concentration suitable for direct amplification RT-qPCR mix, 8 groups of experimental data (table 4) with 4 factor 2 level are obtained through an orthogonal experimental method, a qPCR instrument is used for amplification, a CT value is output after the amplification is finished, an orthogonal factor regression equation and an effect value are analyzed by using Mtb software, and reagent combinations with optimal amplification effects are screened according to the CT value and the effect coefficient.

The primer sequences used for amplification are shown in Table 1.

TABLE 1

The reaction system is shown in Table 2.

TABLE 2

Component (A)	Volume (mu L)
		2×RT-qPCR mix	10
Forward Primer(10μM)	0.4
		Reverse Primer(10μM)	0.4
Cell suspension	2
		RNase Free H 2 O	To 20

Wherein the 2 xRT-qPCR mix comprises 100mM Tris-HCl, 50mM KCl, 6mM MgCl ₂ ﹒6H ₂ O、30mM(NH ₄ ) ₂ SO ₄ 6% v/v glycerol, 0.5mM dNTPs, 5mM TCEP, 5U/mL hot start Tth enzyme, 30U/μl RNase inhibitor, 5U/mL dsDnase, and 0.64 XSYBR Green I (10000X).

The reaction procedure is shown in Table 3.

TABLE 3 Table 3

* The model of the instrument is different in the experiment, and the melting curve acquisition program is also different, and the default melting curve acquisition program of the instrument is usually used.

2. Experimental design and results analysis

Based on 2×RT-qPCR mix, triton X-100, BSA, CA630 and/or blue dextran 2000 were added at various concentrations to form corresponding experimental and control groups as shown in Table 4. A total of 8 groups (Table 4) were obtained by performing orthogonal experimental design on the levels of 2 for each of the four factors Triton X-100, BSA, CA630 and blue dextran 2000, respectively, using 0.1% w/v BSA and 0.3% v/v CA630 as control groups.

Table 4 2X Components and concentration

Amplification of 293 cell suspensions was performed on these 8 combinations and the CT values of the amplification results on GAPDH, ERBB2 primers are shown in table 5:

TABLE 5

Combination of two or more kinds of materials	GAPDH gene	ERBB2 gene
			Control group	28.29	29.82
1	25.35	27.46
			2	24.99	26.35
3	25.08	27.51
			4	23.87	25.83
5	27.37	28.58
			6	23.60	25.35
7	24.58	26.59
			8	26.06	27.68

As can be seen from the amplified CT values in Table 5, the amplified CT values in 8 experimental groups are smaller than those in the control group, which indicates that the increase of Triton X-100 and blue dextran 2000 in the reaction system effectively reduces the CT values. Of the 8 groups, the amplification effect of the experimental group 6 is best, namely, 0.05% Triton X-100, 0.5% BSA, 0.3% CA630 and 0.01% blue dextran 2000 are added into a 2X reaction system, so that the cell lysis effect is effectively improved, and the amplification CT value of the reaction system can be obviously reduced.

For these 8 combinations, the regression equation and the factor effect values of each reagent in the combination were analyzed using Mtb software. The results were as follows:

GAPDH gene CT value regression equation:

CT value = 25.11-0.2900triton x-100-0.4825BSA-0.2150CA630-0.7625 blue dextran +0.09000triton x-100 BSA-0.1325triton x-100 ca630+0.5500triton x-100 blue dextran

Regression equation for ERBB2 gene CT values:

CT value = 26.92-0.1312Triton x-100-0.6163BSA-0.01625CA630-0.6113 blue dextran-0.08125 Triton x-100 BSA-0.1013Triton x-100 CA630+0.4687Triton x-100 blue dextran

Note that: in the formula, "-0.1312TritonX-100" represents that the effect value of TritonX-100 is 0.1312, and the larger the effect value is, the larger the contribution rate to CT value is, wherein "-" represents that the CT value gradually decreases with the increase of the concentration of the substance; "+0.5500Triton X-100 blue dextran" indicates that the effect value of Triton X-100 and blue dextran combination is 0.5500, and "+" indicates that the CT value gradually increases with increasing substance concentration. And the other is the same.

The effect values of the individual reagents of the 8 experimental combinations are analyzed, and the result is shown in FIG. 1, wherein on the GAPDH gene, the effect coefficient is the maximum blue glucan 2000, and then Triton X-100 and BSA; on gene ERBB2, the effect coefficients had a similar conclusion, i.e., the top three reagents remained BSA, blue dextran 2000 and Triton X-100. In the reaction system, the 3 reagents find dominant effect on improving the amplification effect, and can reduce the amplification CT value.

Example 2

At low cell numbers (< 10) ^{^3} Per ml), the present example compares the effect of the aptamer on the amplification effect of the direct amplification RT-qPCR against the phenomena of large amplification CT value, easy non-specific amplification and selection of non-specificity.

1. Direct amplification RT-qPCR

(1) The primer sequences used are shown in Table 6.

TABLE 6

(2) The reaction system is shown in Table 7.

TABLE 7

Component (A)	Volume (mu L)
		2×Cell Direct RT-qPCR SYBR mix	10
Forward Primer(10μM)	0.4
		Reverse Primer(10μM)	0.4
Cell suspension	5
		RNase Free H 2 O	To 20

Wherein the 2 XCell Direct RT-qPCR SYBR mix comprises 100mM Tris-HCl, 50mM KCl, 6mM MgCl ₂ ﹒6H ₂ O、30mM(NH ₄ ) ₂ SO ₄ 6% v/v glycerol, 0.5mM dNTPs, 5mM TCEP, 5U/mL hot start Tth enzyme, 30U/μl RNase inhibitor, 5U/mL dsDnase, 0.64 XSYBR Green I (10000X), 0.05% Triton X-100, 0.5% BSA, 0.3% CA630, 0.01% blue dextran 2000.

(3) The reaction procedure is shown in Table 3.

(4) The present example uses a nucleic acid aptamer having the sequence:

CUUACCCCUUCGGCCCGUCAUGAGCGAUGUCCUAGCCGACU，SEQ ID NO.9。

2. experimental design and result analysis:

the amplification effects of the aptamers in the reaction system were compared by adding 0. Mu.M, 0.5. Mu.M and 1. Mu.M of the aptamers to 2 XCell Direct RT-qPCR SYBR mix, respectively, as shown in Table 8.

Table 8 comparison of amplified CT values of aptamers in reaction systems

Gene name	Aptamer 0. Mu.M	Aptamer 0.5. Mu.M	Aptamer 1. Mu.M
				GPLD1	30.12	29.96	29.54
MRS2	32.67	31.85	31.57

As can be seen from the results in Table 8, at low cell numbers (< 10) ^{^3} Each ml) of the template, the CT value is obviously about 1 CT larger than that of the reaction group added with the aptamer when no aptamer is added. There was no significant difference in CT values for the addition of 0.5. Mu.M and 1. Mu.M of the aptamer. In addition, by observing the melting curve (FIG. 2), it was found that primer non-specific amplification was evident without adding an aptamer, and that the non-specific amplification phenomenon was significantly improved when the aptamer concentration in 2 XCell Direct RT-qPCR SYBR mix reached 1. Mu.M. The aptamer has the effect of enhancing the amplification capability in a reaction system, can improve the specificity, and greatly improves the accuracy of gene amplification.

Example 3

In order to verify the beneficial effects of cell extraction-free, direct-amplification RT-qPCR mix for cell RNA gene amplification, three cell sample RNA amplification methods were compared:

the method comprises the following steps: extracting RNA with a tissue/cell RNA extraction kit of Optimaea, and using OptimaeaIII RT SuperMix for qPCR (+gDNA reverse) RNA genome removal and reverse transcription reactions were performed to generate cDNA, which was finally subjected to gene amplification detection using the Optimago ArtiCanATM SYBR qPCR Mix.

The second method is as follows: gene amplification was detected using the FOREGENE company QuickEasyTM Cell Direct RT-qPCR Kit-SYBRGreen I whole set of cells direct RT-qPCR Kit-SYBR Green I. The kit comprises 8-tube reagents, and the whole amplification involves three steps, namely, the first step of using lysate to lyse cells to release RNA, the second step of using reverse transcription reaction liquid to reverse transcribe the RNA into cDNA, and the third step of using qPCR mix to carry out cDNA amplification reaction.

And a third method: the cell extraction-free direct-amplification RT-qPCR mix provided by the application can be used for judging the effect on the whole flow operation time, the amplification CT value and the amplification sensitivity.

1. The application provides a cell extraction-free direct-expansion RT-qPCR mix, the formula of which is shown in Table 9:

TABLE 9

2. Sample processing

293 cells in the dishes were subjected to cell digestion and resuspended and counted using a cell counter. Cell concentrations were diluted 1 x 10 with PBS, respectively ^{^1} Per ml, 1 x 10 ^{^2} Per ml, 1 x 10 ^{^3} Per ml, 1 x 10 ^{^4} Cell sample gene amplification was performed using 3 amplification methods per ml, each concentration being repeated for 3 groups of cell samples.

3. Sample adding method

(1) The first and second methods operate according to the specifications of Optimum and FOREGENE, respectively.

(2) The operation method of the application (namely, the method III) comprises the following steps: taking 1 mu L of diluted cell sample, directly placing the diluted cell sample into a PCR reaction tube, and carrying out subsequent reaction.

4. The detection primer sequences are shown in Table 1.

5. The reaction system of the present application is shown in Table 10.

Table 10

Component (A)	Volume (mu L)
		2 Xdirect amplification RT-qPCR mix (Table 9)	10
Forward Primer(10μM)	0.4
		Reverse Primer(10μM)	0.4
Cell suspension	5
		RNase Free H 2 O	To 20

6. The procedure of the reaction is shown in Table 3.

7. Analysis of results

The three methods for amplifying the RNA of the cell samples use a timer to record the operation time of the whole flow and the total time spent by the amplification reaction. From the total time spent on the whole flow operation time and the amplification reaction, the first time spent on the method is 300min, the second time spent on the method is 160min and the third time spent on the method is 90min, so that compared with the method of the kit of the other 2 companies, the method has the advantages of shortest time spent on the application (namely, the third method).

Diluting the cell suspension to 1 x 10 respectively ¹ 、1*10^ ² 、1*10^ ³ 、1*10^ ⁴ (in/ml) concentration, the total amount of cells in the reaction system of each experimental group was uniform, the number of repetitions was 3 for each experimental group, and the average number of CT values of 3 repeated samples was calculated for comparison, and the results are shown in Table 11. Meanwhile, water is used as a negative control to detect the nucleic acid pollution.

TABLE 11

As can be seen from the results in Table 11, method one was performed at a lower cell number (10 ^{^2} ) In the case of (2), the CT value could not be detected, and the CT value of the negative reference group without the template was about 35, indicating that the sensitivity was low. Method II in cell number (10) ^{^2} ) When CT value is obviously increased (39.41), the negative parameter value is about 37, and the control level of the negative parameter is better than that of the first method. Method III when the cell number is extremely low (10 ^{^1} ) In the case of (2), CT values were detected, and no CT values were detected in the experimental group of yin reference, indicating that method three can detect gene expression levels of extremely low cell numbers, with higher sensitivity than methods one and two. In addition, the CT value is not detected by the yin-ginseng experimental group of the method III, which also shows that the amplification reaction of the method III is not interfered by genome pollution, and the genome pollution in the environment is effectively controlled. In summary, compared with the other two methods, the method III has obvious advantages in improving the amplification sensitivity and controlling the pollution level of the ginseng, and can improve the detection sensitivity and the detection fidelity and accuracy.

Example 4

This example utilized the cell extraction-free, direct-expansion RT-qPCR mix of the present application to rapidly detect cell lentivirus titers.

1. The cell lentiviral titer primer sequences are shown in table 12:

primers were designed with the HIV-1 genome conserved region sequences, and were compatible with all lentiviral vectors and most of the commonly used lentiviral vectors on the market.

Table 12

2. Lentiviral nucleic acid sequences

The HIV-1 genome has the sequence number of GenBank:OR327228.1 in NCBI functional network, and the amplified sequence is:

TCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAGTCCTGGCTGTG GAAAGATACCTAAGGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGG AAAACT (SEQ ID NO. 12) and the amplified total fragment length was 103bp.

3. Cell transduction and enumeration

Cells were resuspended by digestion with 2% pancreatin from 37℃incubator, counted using a cell counter, and the cells were counted at 1X 10 ^{^3} Each well was inoculated into a 24-well plate, and the total volume of cell culture fluid per well was 1mL. After 24h of cell attachment, 1 well of cells were taken for cell counting again, the number of cells was M this time, the remaining wells were transduced with lentiviral solution, 50. Mu.L of cytoviral solution was added to each well, 10. Mu.L of lentiviral transfection solution was added, and the wells were gently shaken well and then returned to the 37℃incubator.

4. Standard and sample dilution

RNA standard of lentivirus HIV-1 the product is provided by a microorganism of the family Optimus, standard original concentration 1.00×10 ^{^10} The copies/. Mu.L was diluted according to the gradient of the RNA standard according to Table 13, and mixed well.

TABLE 13

5. The reaction system is shown in Table 14.

TABLE 14

Component (A)	Volume (mu L)
		2 Xdirect amplification RT-qPCR mix (Table 9)	10
IVS-Forward Primer(10uM)	0.4
		IVS-Reverse Primer(10uM)	0.4
Cell suspension/standard	2
		RNase Free H 2 O	To 20

6. The reaction procedure is shown in Table 3.

7. Titer calculation

(1) And calculating the average CT value of each group of standard products, and generating a standard curve Y=A x+B by taking the average CT value as Y and Log (copy number) as X. The correlation coefficient of the standard curve should be higher than 0.99.

(2) And (3) reading the Ct value of the sample, substituting the Ct value into the formula generated in the step (1), and calculating the corresponding copy number.

(3) Multiplying the copy number by the dilution factor to obtain the titer of the original sample.

Viral titer (TU/ml) =1000×hiv-1 gene copy number×m (cell count value) ×viral dilution/transduction volume. For example, the HIV-1 gene copy number of the sample after amplification CT calculation is 1.00 x 10 ≡ ⁹ Cell count 10 pre-transduction ³ The virus dilutions were diluted 10-fold and 50uL was added to the dish for virus transfection. The titer calculation method is 1000 x 1.00 x 10 ⁹ ×10^ ³ ×10×1/50。

8. Analysis of results

And detecting cell samples by using an ABI 7500 fluorescent quantitative PCR instrument, detecting 2 complex holes of each sample, deriving CT values by using EXCEL after the amplification of the instrument is finished, and recording CT values corresponding to different copy numbers according to a standard.

Table 15 average CT value of Standard amplification

Copy number of standard	LOG (copy number)	Average CT value
			1.00x10^ 9	9.00	9.49
1.00x10^ 8	8.00	13.82
			1.00x10^ 7	7.00	17.59
1.00x10^ 6	6.00	21.03
			1.00x10^ 5	5.00	24.98
1.00x10^ 4	4.00	28.82
			1.00x10^ 3	3.00	32.16
1.00x10^ 2	2.00	35.97
			1.00x10^ 1	1.00	37.02

Standard formulations were prepared according to 1.00 x 10 ≡ ⁹ The copy number is subjected to 10-time gradient dilution, the amplification curve line is in a standard S shape, and amplification curves corresponding to different concentrations have certain gradients, so that the amplification curve accords with the amplification standard (figure 3).

After the amplification of the standard substance is finished, the melting curve analysis is carried out, the melting curve is single in line shape, and the non-specific amplification is avoided, so that the CT value and the primer selection of the lentivirus amplification meet the requirements, and the amplification result is reliable (figure 4).

Standard formulations were prepared according to 1.00 x 10 ≡ ⁹ And (3) carrying out 10-time gradient dilution on the copy number, recording a CT value, taking LOG (concentration) as an X axis, and drawing a standard curve by taking the CT value as an ordinate. The result is shown in fig. 5, and the linear correlation coefficient r2= 0.9917 is larger than 0.98, which meets the file requirements of the nucleic acid detection kit quality evaluation technical Specification, and shows that the established lentivirus standard curve is available and meets the standard. The amplification efficiency E=E=94.12% meets the requirement that the qPCR amplification efficiency in the molecular diagnosis industry ranges from 90% to 110%.

After 10-fold and 100-fold dilution of lentiviral samples, 2 duplicate wells were amplified per sample, with a 10-fold dilution CT of 19.76 and a 100-fold dilution CT of 23.53. Substituting the CT value into the linear correlation y= -3.4714x+42.046 to obtain the corresponding copy number, and according to a lentivirus titer formula of = 1000 x HIV-1 gene copy number x M (cell count value) x viral dilution factor/transduction volume. The corresponding titer was calculated. The results are shown in FIG. 6 and Table 16, where the titers of lentiviruses diluted 10-fold and 100-fold are consistent with a titer range of 10 for conventional use ^{^6} -10 ^{^12} The range of the slow virus titer is up to the qualified use standard, and the slow virus titer has good detection sensitivity, so that the slow virus titer can be accurately calculated.

TABLE 16 lentiviral titer value calculation

The technical features of the above-described embodiments may be arbitrarily combined, and all possible combinations of the technical features in the above-described embodiments are not described for brevity of description, however, as long as there is no contradiction between the combinations of the technical features, they should be considered as the scope of the description.

The above examples merely represent a few embodiments of the present application, which are described in more detail and are not to be construed as limiting the scope of the invention. It should be noted that it would be apparent to those skilled in the art that various modifications and improvements could be made without departing from the spirit of the present application, which would be within the scope of the present application. The scope of the patent is, therefore, indicated by the appended claims, and the description may be used to interpret the contents of the claims.

Claims (10)

1. A PCR premix comprising polyethylene glycol octylphenyl ether, octylphenyl-polyethylene glycol, BSA, and blue dextran 2000.

2. The PCR primer mix of claim 1, wherein the PCR primer mix comprises the following working concentration components:

0.01 to 0.1% v/v polyethylene glycol octylphenyl ether, 0.05 to 0.5% v/v octylphenyl-polyethylene glycol, 0.05 to 0.5% w/v BSA and 0.005 to 0.05% w/v blue dextran 2000.

3. The PCR master batch of claim 1, wherein the PCR master batch further comprises an aptamer;

alternatively, the nucleotide sequence of the aptamer is shown as SEQ ID NO. 9.

4. The PCR premix of claim 3, wherein the working concentration of the aptamer in the PCR premix is 0.05. Mu.M to 1. Mu.M.

5. The PCR primer mix of any one of claims 1 to 4, further comprising one or more of enzymes, buffer matrices, dNTPs, cations, rnase inhibitors, enhancers, genomic DNA removal reagents, reducing agents, and fluorescent dyes.

6. The PCR primer mix of claim 5, wherein the PCR primer mix meets one or more of the following conditions:

(1) The enzyme comprises a DNA polymerase and/or a reverse transcriptase;

optionally, the DNA polymerase comprises a hot start DNA polymerase and/or the reverse transcriptase comprises an M-MLV reverse transcriptase and/or an AMV reverse transcriptase;

further alternatively, the hot start DNA polymerase is selected from hot start Taq enzyme and/or hot start Tth enzyme;

(2) The buffer matrix comprises at least one of phosphate buffer, glycine buffer, HEPES buffer, boric acid buffer, acetic acid buffer and Tris-HCl buffer;

(3) The cation comprises K ⁺ 、Mg ²⁺ And NH ₄ ⁺ At least one of (a) and (b);

(4) The enhancer comprises glycerol;

(5) The genomic DNA removal agent comprises a dsDNase;

(6) The reducing agent comprises TCEP.

7. The PCR primer mix of claim 6, wherein the PCR primer mix comprises the following components in working concentration:

0.01% v/v to 0.1% v/v polyethylene glycol octylphenyl ether, 0.05% v/v to 0.5% v/v octylphenyl-polyethylene glycol, 0.05% w/v to 0.5% w/v BSA, 0.005% w/v to 0.05% w/v blue dextran 2000, 0.25. Mu.M to 1. Mu.M aptamer, 1.5U/mL to 2.5U/mL hot start Tth enzyme, 1.5U/mL to 2.5U/mL dsDnase, 10U/mu.L to 15U/mu.L RNase inhibitor, 1.5% v/v to 3% v/v glycerol, 40mM to 50mM Tris-HCl, 15mM to 25mM K ⁺ 、1.5mM～3mM Mg ²⁺ 、10mM～15mM NH ₄ ⁺ 0.1 mM-0.25 mM dNTPs, 1.5 mM-2.5 mM TCEP, and 0.2X-1X fluorescent dye.

8. A reagent or kit comprising the PCR premix of any one of claims 1 to 7.

9. A PCR amplification method, characterized in that it comprises amplification using the PCR premix according to any one of claims 1 to 7 or using the reagent or kit according to claim 8;

optionally, the amplified sample comprises a cell sample;

optionally, the PCR amplification method comprises directly adding a cell sample into the PCR premix solution for amplification;

alternatively, the PCR comprises RT-qPCR.

10. The PCR premix of any one of claims 1 to 7 or the reagent or kit of claim 8 for use in lentiviral titer assays;

alternatively, the lentiviruses include HIV-type 1 lentiviruses;

further alternatively, the primers used in the HIV-type 1 lentivirus titer assay comprise primers having the sequences shown in SEQ ID NO. 10-11.