CN117431228A

CN117431228A - High-stereoselectivity aminotransferase mutant, encoding gene and application thereof

Info

Publication number: CN117431228A
Application number: CN202311406336.3A
Authority: CN
Inventors: 于洪巍; 衣晓敏; 叶丽丹
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2023-10-27
Filing date: 2023-10-27
Publication date: 2024-01-23

Abstract

The invention discloses a high stereoselectivity aminotransferase mutant, a coding gene and application thereof, and belongs to the technical field of bioengineering. The aminotransferase mutant is a mutant of the aminotransferase from the chromobacterium violaceum, the amino acid sequence of which is shown as SEQ ID NO.1, through amino acid mutation, wherein the site of the amino acid mutation is at least one of 118 th, 225 th and 418 th, asparagine at 118 th is mutated into glycine, glycine at 225 th is mutated into alanine, and cysteine at 418 th is mutated into threonine. Compared with wild transaminase, the transaminase mutant provided by the invention has higher enzyme activity and stereoselectivity, 4-hydroxy-2-butanone can be used as a substrate to prepare (R) -3-aminobutanol, the yield of the product is high, the optical purity is high, and no by-product is generated.

Description

High-stereoselectivity aminotransferase mutant, encoding gene and application thereof

Technical Field

The invention relates to the technical field of bioengineering, in particular to a transaminase mutant modified aiming at a transaminase derived from chromobacterium violaceum, a coding gene and application thereof in preparation of (R) -3-aminobutanol.

Background

Dolutegravir (DTG), chemical name: (4R, 12 aS) -N- [ (2, 4-difluorophenyl) methyl ] -3,4,6,8,12 chemical book-hexahydro-7-hydroxy-4-methyl-6, 8-dioxo-2H-pyrido [1',2':4,5] pyrazino [2,1-b ] [1,3] oxazine-9-carboxamide, CAS registry number 1051375-16-6. Dolutegravir is an inhibitor against human immunodeficiency virus type 1 (HIV-1) integrase, and is mainly used for treating aids virus infection, and has a crucial effect on suppressing aids transmission.

The (R) -3-aminobutanol is an important chiral six-membered ring building block for synthesizing dolutegravir, and the chiral purity of the (R) -3-aminobutanol determines the purity of a subsequent intermediate in the synthesis process of dolutegravir, thereby playing an important role in synthesizing high-quality dolutegravir. Optical purity has a significant impact on the use of drugs and their intermediates. Different stereoisomers may exhibit varying activities, metabolisms and toxicities. High optical purity is a key factor in ensuring that the drug interacts with the target molecule in an optimal manner, enhancing the efficacy of the drug.

Therefore, developing a method for efficiently synthesizing (R) -3-aminobutanol, especially a synthetic method with high optical purity, is beneficial to improving the efficiency of medicine preparation and reducing the production cost.

The current synthetic methods of (R) -3-aminobutanol with high optical purity mainly comprise a chemical method and a biological method. Common methods among the chemical methods are a kinetic resolution method using lithium aluminum hydride or the like as a reducing agent, and a direct synthesis method using a chiral compound as a starting material. However, these methods have problems of low utilization rate of raw material atoms, expensive price of chiral pure raw materials, and the like, and longer reaction steps, thereby resulting in higher production cost.

Compared with chemical synthesis, the biological synthesis has the advantages of mild reaction conditions, high conversion rate, strong stereoselectivity and the like. For example, patent document CN104131048A discloses cloning a D-aminotransferase gene derived from archrobacter sp into an escherichia coli host cell by genetic engineering techniques, expressing to obtain a recombinant D-aminotransferase, and finally catalyzing the reaction with 3-carbonyl butanol as a substrate to obtain (R) -3-aminobutanol. The aminotransferase can asymmetrically catalyze potential chiral ketone compounds to directly synthesize chiral amine compounds, and has good prospect in application.

However, in practical applications, the stereoselectivity of the wild-type transaminase in catalyzing unnatural substrates often fails to meet the needs of practical applications and requires modification by protein engineering techniques. For example, patent document CN108823179a discloses that an improvement of aminotransferase derived from actinomycetes is made, valine at position 80 is mutated to glycine, tryptophan at position 203 is mutated to serine, threonine at position 294 is mutated to serine, and a mutant protein is obtained, which has an improvement of substrate conversion rate of 12% -25%.

At present, the transaminase meeting the industrial application demands is still limited, so that transaminases from different sources are deeply excavated, and molecular transformation is carried out by means of protein engineering technology, so that the application space of the transaminase in the chiral pharmaceutical manufacturing industry is widened.

Disclosure of Invention

The invention aims to provide a transaminase with high catalytic activity and strong stereoselectivity for preparing high optical purity (R) -3-aminobutanol, which meets the requirement of industrial production.

In order to achieve the above purpose, the invention adopts the following technical scheme:

the invention discloses a transaminase mutant obtained by carrying out amino acid mutation on transaminase CvATA from Achromobacter violaceus (Chromobacterium violaceum) through a protein engineering technology, wherein the transaminase mutant is a mutant obtained by carrying out amino acid mutation on transaminase from Achromobacter violaceus, the amino acid sequence of which is shown as SEQ ID NO.1, specifically, the site of the amino acid mutation is at least one of 118 th, 225 th and 418 th, the asparagine at 118 th is mutated into glycine, the glycine at 225 th is mutated into alanine, and the cysteine at 418 th is mutated into threonine.

Specifically, the mutant N118G is formed by mutating asparagine at 118 th position into glycine, and the amino acid sequence is shown as SEQ ID NO. 3.

The mutant G225A is formed by mutating glycine at position 225 into alanine, and the amino acid sequence is shown as SEQ ID NO. 4.

The mutant C418T is formed by mutating 418 th cysteine into threonine, and the amino acid sequence is shown in SEQ ID NO.5.

The mutant N118G/G225A is characterized in that asparagine at position 118 is mutated into glycine, glycine at position 225 is mutated into alanine, and the amino acid sequence is shown in SEQ ID NO. 6.

The mutant N118G/C418T is characterized in that the 118 th asparagine is mutated to glycine and the 418 th cysteine is mutated to threonine, and the amino acid sequence is shown in SEQ ID NO.7.

The mutant N118G/G225A/C418T is characterized in that asparagine at position 118 is mutated into glycine, glycine at position 225 is mutated into alanine, and cysteine at position 418 is mutated into threonine, and the amino acid sequence is shown in SEQ ID NO.8.

Research shows that compared with wild aminotransferase, the aminotransferase mutant has obviously raised catalytic activity and stereoselectivity.

Conservative substitution forms, forms in which one or more amino acids are added or deleted, amino-terminal truncated forms, carboxy-terminal truncated forms for other amino acid positions of the transaminase mutants are also included within the scope of the present invention.

The aminotransferase mutant is obtained by carrying out site-directed mutagenesis on aminotransferase encoding genes from the chromobacterium violaceum, cloning the aminotransferase encoding genes into host cells to construct genetically engineered bacteria and carrying out induced expression.

The invention also provides a coding gene for the transaminase mutant. The invention can optimize the coding gene according to the codon preference of the genetically engineered host cell. Furthermore, the mutant coding gene is obtained by mutating codons for coding corresponding amino acids on the basis of a nucleotide sequence shown in SEQ ID NO. 2. Specifically, N118G is a mutation of the codon AAT encoding asparagine at position 118 to the codon GGC encoding glycine, G225A is a mutation of the codon GGC encoding glycine at position 225 to the codon GCG encoding alanine, C418T is a mutation of the codon TGT encoding cysteine at position 418 to the codon ACC encoding threonine.

The invention also provides a recombinant expression vector containing a coding gene for the amino acid sequence of the aminotransferase mutant. Preferably, the recombinant expression vector takes pET30a as a vector plasmid.

The invention also provides a genetic engineering bacterium containing the recombinant expression vector, and the genetic engineering bacterium is used for producing the transaminase mutant. The recombinant vector is used for transforming host cells to obtain recombinant genetically engineered bacteria, the host cells can be various conventional host cells in the field, and preferably, E.coli and specifically E.coli BL21 can be used as host bacteria of the genetically engineered bacteria.

The invention also provides a method for constructing the transaminase mutant, which comprises the following steps:

(1) Designing a site-directed mutagenesis primer, and performing inverse PCR by taking a plasmid carrying a purple color bacillus source aminotransferase encoding gene as a template to obtain a unit point mutation product of the aminotransferase from 118 th N mutation to G or 225 th G mutation to A or 418 th C mutation to T;

(2) Taking the single-point mutation product as a template, and performing inverse PCR by using the site-directed mutation primer to obtain a double-point mutation product; performing inverse PCR (polymerase chain reaction) by using the double-site mutation product as a template and using the site-directed mutation primer to obtain a three-site mutation product;

(3) And (3) converting the single-site mutant product, the double-site mutant product or the triple-site mutant product into host bacteria, screening to obtain a transaminase mutant expression strain, and inducing expression to obtain the transaminase mutant.

Wherein the N at position 118 is mutated to G:

N118G-F:5’-CGCGTGTTTTATACCGGCAGCGGCTCAGAATCAGTG-3’；

N118G-R:5’-CACTGATTCTGAGCCGCTGCCGGTATAAAACACGCG-3’；

the G at position 225 is mutated into the primer required by A:

G225A-F:5’-GTTGCCGCCTTTGTGGCGGAACCGATTCAG-3’；

G225A-R:5’-CTGAATCGGTTCCGCCACAAAGGCGGCAAC-3’；

primer required for mutation of C at 418 to T:

C418T-F:5’-GATTATGCGCGCCACCGGCGATCATATTGTGAGC-3’；

C418T-R:5’-GCTCACAATATGATCGCCGGTGGCGCGCATAATC-3’；

preferably, the original vector of the recombinant plasmid is pET30a; the host bacteria are E.coli BL21.

It is a further object of the present invention to provide the use of said transaminase mutants in the preparation of (R) -3-aminobutanol, said use comprising asymmetrically catalyzing the amination of 4-hydroxy-2-butanone to (R) -3-aminobutanol with the addition of an amine donor.

The transaminase mutant provided by the invention asymmetrically catalyzes 4-hydroxy-2-butanone to be aminated under the condition of adding an amine donor, and generates (R) -3-amino butanol with high optical purity, wherein the optical purity is more than 99%, and the transaminase mutant has good industrial application prospect.

The application comprises: the preparation method comprises the steps of fermenting and culturing engineering bacteria containing transaminase mutant encoding genes, centrifuging to obtain wet bacteria, immobilizing cells of the wet bacteria, ultrasonically crushing the wet bacteria, extracting enzyme or immobilized enzyme serving as a catalyst, taking 4-hydroxy-2-butanone as a substrate under the condition of externally adding alanine and pyridoxal phosphate, taking buffer solution with the pH value less than or equal to 8 containing an organic solvent as a reaction medium, reacting at the temperature of 25-37 ℃ and the speed of 150-300rpm, and separating and purifying reaction liquid after the reaction is finished to obtain (R) -3-aminobutanol.

The transaminase mutants of the invention can be used in the form of whole cells of engineering bacteria, as crude enzymes without purification, as partially purified or completely purified enzymes. The transaminase mutants of the invention can also be made into immobilized enzymes or biocatalysts in the form of immobilized cells using immobilization techniques known in the art.

Preferably, the catalyst is used in an amount of 20-100g/L based on the weight of wet bacteria, wherein the wet bacteria have a water content of 70-90%. More preferably 50g/L.

Preferably, the concentration of the substrate in the reaction system is 0.5 to 2g/L, more preferably 1.8g/L.

Preferably, the concentration of alanine in the reaction system is 2-10g/L, more preferably 9g/L.

Preferably, the pyridoxal phosphate concentration in the reaction system is 0.2 to 0.4g/L, more preferably 0.25g/L.

Preferably, the pH buffer solution is phosphate buffer, i.e., naH ₂ PO ₄ -Na ₂ HPO ₄ The buffer has a pH of 7.0 to 8.0, more preferably 7.4 to 7.6, still more preferably 7.5.

Preferably, the organic solvent is isopropanol or dimethyl sulfoxide, and the volume fraction of the organic solvent in the pH buffer solution is 8-12%, more preferably 10%.

The addition concentrations of the above raw materials, such as wet cell, substrate, alanine, pyridoxal phosphate, were calculated as 1L pH buffer.

Preferably, the reaction temperature is 37 ℃.

The reaction time is 3 to 6 hours, preferably 4 hours.

Preferably, the oscillation rate is 220rpm.

Preferably, the wet bacterial cells are E.coli BL21/pET30a-CvATA-N118G/G225A/C418T. The yield of the mutant to (R) -3-amino butanol can reach 45%, and the optical purity is more than 99%.

The fermentation culture method comprises the following steps: inoculating recombinant engineering bacteria into LB liquid medium containing kanamycin (final concentration is 50 mug/mL), and shake culturing at 37 ℃ for 18h; inoculating the seed solution into fresh LB liquid medium containing kanamycin (final concentration of 50 μg/mL) at 1% volume ratio, and shake culturing at 37deg.C and 220rpm until bacterial OD ₆₀₀ isopropyl-beta-D-thiogalactopyranoside (IPTG) was added at a final concentration of 0.1mM at 0.6, and the cells were collected by induction culture at 25℃and 220rpm for 16 hours and centrifugation at 3500rpm for 10 minutes at 4 ℃.

The invention has the beneficial effects that:

(1) Compared with wild transaminase, the transaminase mutant provided by the invention has higher enzyme activity, 4-hydroxy-2-butanone can be used as a substrate to prepare (R) -3-amino butanol, the yield of the product is high, and no by-product is produced.

(2) The invention uses the aminotransferase mutant as the dolutegravir chiral intermediate biocatalyst, so that the chiral product with high optical purity is obtained more economically and simply, and the production method has the advantages of simple operation, low cost and the like, greatly reduces the production cost and has good industrialized application prospect.

Drawings

FIG. 1 shows the relative spatial positions of amino acid residues 118, 225 and 418.

FIG. 2 is a recombinant plasmid map.

FIG. 3 is a liquid chromatogram of the product obtained by reacting (S/R) -3-aminobutanol standard, E.coli BL21 blank, aminotransferase CvATA with substrate 4-hydroxy-2-butanone.

Detailed Description

The invention will be further illustrated with reference to specific examples. The following examples are only for illustrating the present invention and are not intended to limit the scope of the present invention. Modifications and substitutions to methods, procedures, or conditions of the present invention without departing from the spirit and nature of the invention are intended to be within the scope of the present invention.

Unless otherwise indicated, all materials used in the present invention are commercially available or are commonly used in the art. Unless otherwise indicated, the methods in the examples below are all conventional in the art.

Nucleic acids are written in a 5 'to 3' direction from left to right, while amino acid sequences are written in an amino-to carboxyl-terminal direction from left to right.

Example 1: construction of engineering bacteria capable of expressing each mutant

1. The corresponding coding gene was synthesized by Shanghai JieRui Bioengineering Co., ltd according to the amino acid sequence of 6S4G (purple-color bacillus-derived transaminase, www.rcsb.org/structure/6S 4G) protein in PDB protein library. The amino acid sequence of the purple color bacillus source aminotransferase wild type is shown as SEQ ID NO.1, and the nucleotide sequence of the encoding gene is shown as SEQ ID NO. 2.

Then taking plasmid pET30a as a vector, obtaining recombinant plasmid pET30a containing the coding gene through conventional preparation operation, transferring the recombinant plasmid into E.coli BL21 to obtain an engineering recombinant strain of wild type aminotransferase, activating the recombinant strain on an LB plate containing 1%o kanamycin resistance, culturing at 37 ℃ for 18h, picking single colony in a 50mL LB conical flask also containing 1%o kanamycin resistance, culturing at 37 ℃ and 220rpm to OD ₆₀₀ About 0.6, plasmids were extracted according to the plasmid miniprep kit instructions.

2. Construction of aminotransferase single site 118, 225, 418 mutants

Construction of mutant plasmids was completed using the plasmids extracted in step 1 as templates and using QuikChange Lightning Site-Directed Mutagenesis Kit point mutation kit (Agilent, united States).

Specifically, asparagine (N) at position 118, glycine (G) at position 225, and cysteine (C) at position 418 in the wild-type amino acid sequence were subjected to single point mutation, and corresponding primers were designed as shown in table 1.

TABLE 1 mutant primers

Primer(s)	Sequence (5 '-3')
		N118G-F：	CGCGTGTTTTATACCGGCAGCGGCTCAGAATCAGTG
N118G-R：	CACTGATTCTGAGCCGCTGCCGGTATAAAACACGCG
		G225A-F：	GTTGCCGCCTTTGTGGCGGAACCGATTCAG
G225A-R：	CTGAATCGGTTCCGCCACAAAGGCGGCAAC
		C418T-F：	GATTATGCGCGCCACCGGCGATCATATTGTGAGC
C418T-R：	GCTCACAATATGATCGCCGGTGGCGCGCATAATC

Transferring the constructed mutant plasmid into E.coli BL21 competent cells, uniformly mixing, placing the E.coli BL21 competent cells on ice for 25min, placing the E.coli BL21 competent cells on ice for heat shock at 42 ℃ for 90s after finishing, placing the E.coli BL21 competent cells on ice for moderating for 5min, adding 1mL of LB culture medium, culturing at 37 ℃ for 50min, centrifuging at 12000rpm for 1min after finishing, taking 100 mu L of supernatant to resuspension thalli, coating on an LB plate containing 1 permillage kanamycin, and culturing for 18h in a constant temperature incubator at 37 ℃.

Single colonies on the plates are picked up and placed in a test tube containing 5mL of LB culture medium, 1mL of the culture medium is taken for sequencing after 8h of culture, the sequencing result is correct, the rest bacterial liquid is added with 40% glycerol solution with equal volume, and the mixture is placed in a refrigerator at the temperature of minus 80 ℃ for standby.

The transaminase mutant engineering bacteria E.coli BL21/pET30a-CvATA-N118G, E.coli BL21/pET30a-CvATA-G225A and E.coli BL21/pET30a-CvATA-C418T are respectively obtained. Sequencing results showed that the codon AAT encoding asparagine (N) at position 118 was mutated to the codon GGC encoding glycine (G); the codon GGC encoding glycine (G) at position 225 is mutated to the codon GCG encoding alanine (A); the codon TGT encoding cysteine (C) at position 418 is mutated to the codon ACC encoding threonine (T). The amino acid sequences of the mutant N118G, G225A, C418T are SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5.

3. Construction of transaminase combination mutants

And (3) taking the pET30a-CvATA-N118G constructed in the step (2) as a template, and completing construction of a mutant plasmid by using a point mutation kit, wherein the method is the same as that described above.

And (3) accurately obtaining the transaminase mutant engineering bacteria E.coli BL21/pET30a-CvATA-N118G/G225A and E.coli BL21/pET30a-CvATA-N118G/C418T according to the sequencing result. Sequencing results showed that the codon GGC encoding glycine (G) at position 225 was mutated to the codon GCG encoding alanine (A); the codon TGT encoding cysteine (C) at position 418 is mutated to the codon ACC encoding threonine (T). The amino acid sequences of the mutant N118G/G225A, N G/C418T are SEQ ID NO.6 and SEQ ID NO.7.

And further taking the pET30a-CvATA-N118G/G225A plasmid as a template to obtain the transaminase mutant engineering bacterium E.coli BL21/pET30a-CvATA-N118G/G225A/C418T, wherein the corresponding amino acid sequence is SEQ ID NO.8.

Example 2: inducible expression of each mutant

The engineering bacteria expressing the wild enzymes constructed in example 1 and the engineering bacteria expressing the mutants were inoculated into 5mL LB liquid medium test tubes containing 50. Mu.g/mL kanamycin, respectively, and cultured at 37℃for 18 hours. Then inoculating into 50mL LB medium containing 50 μg/mL kanamycin at 1% inoculum size (v/v), culturing at 37deg.C and 220rpm to cell concentration OD ₆₀₀ About 0.6 mmol/L of IPTG was added thereto and the mixture was induced and cultured at 25℃and 220rpm for 16 hours. And (3) centrifuging at 3500rpm for 10min at 4 ℃ to collect wet thalli, so as to obtain engineering bacteria expressing wild enzymes and wet thalli of engineering bacteria expressing mutants respectively.

Example 3: preparation of (R) -3-aminobutanol at substrate concentration of 1.8g/L

NaH having pH of 7.5 and containing 9g/L alanine, 0.25g/L pyridoxal phosphate, 1.8 g/L4-hydroxy-2-butanone, 10% isopropyl alcohol was prepared ₂ PO ₄ -Na ₂ HPO ₄ Buffer was used as the reaction solution.

Each of the wet cells of the mutants obtained in example 2 was resuspended in a reaction solution so that the wet cell content was 50g/L, and a reaction system solution was prepared. 1mL of the reaction system solution is taken and placed in a constant temperature shaking table at 37 ℃ and 220rpm for reaction for 4 hours. After the reaction, it was extracted with ethyl acetate and centrifuged, and vacuum-distilled at 37℃for 1.5 hours, followed by redissolution with a liquid mobile phase (aqueous perchloric acid at pH 1.0).

The yield and ee were determined by High Performance Liquid Chromatography (HPLC) analysis, and the liquid chromatogram of the (S/R) -3-aminobutanol standard is shown in FIG. 3. The final product ee and yield were measured as shown in Table 2.

TABLE 2 ee value and yield of preparation of (R) -3-aminobutanol for each mutant

Description of mutants	Yield (%)	ee(％)
			Wild type CvATA	29.6	28.3(R)
N118G	22.1	>99(R)
			G225A	44.0	33.8(R)
C418T	32.7	30.0(R)
			N118G/G225A	41.1	>99(R)
N118G/C418T	24.8	>99(R)
			N118G/G225A/C418T	45	>99(R)

Analysis of experimental results: compared with the wild type aminotransferase CvATA from the purple color bacillus, the aminotransferase mutant provided by the invention has better catalytic activity and high stereoselectivity, the highest space-time yield of the chiral amine synthesized by the CvATA mutant in a catalytic way can reach 4.8 g/L/day, the ee value is more than 99%, and the optical purity is high. The catalyst is easy to prepare, mild in reaction condition, wide in substrate adaptability and environment-friendly, can efficiently catalyze the asymmetric amination reaction of the latent chiral ketone, and has good industrial application and development prospects.

The foregoing has shown and described the basic principles, principal features and advantages of the invention. It will be appreciated by persons skilled in the art that the above embodiments are not intended to limit the invention in any way, and that all technical solutions obtained by means of equivalent substitutions or equivalent transformations fall within the scope of the invention.

Claims

1. A high stereoselectivity aminotransferase mutant is characterized in that the aminotransferase mutant is a mutant which is obtained by mutating aminotransferase from chromobacterium violaceum with an amino acid sequence shown as SEQ ID NO.1, wherein the site of the amino acid mutation is at least one of 118 th, 225 th and 418 th, asparagine at 118 th is mutated to glycine, glycine at 225 th is mutated to alanine, and cysteine at 418 th is mutated to threonine.

2. The high stereoselective aminotransferase mutant according to claim 1, wherein the amino acid sequence of the mutant is as shown in SEQ ID No.3 to SEQ ID No.8.

3. A transaminase mutant gene encoding a highly stereoselective transaminase mutant according to claim 1 or 2.

4. A recombinant expression vector comprising a gene encoding the amino acid sequence of the high stereoselective aminotransferase mutant of claim 1 or 2.

5. The recombinant expression vector of claim 4, wherein the recombinant expression vector comprises pET30a as a vector plasmid.

6. A genetically engineered bacterium for producing the high stereoselective aminotransferase mutant of claim 1 or 2, comprising the recombinant expression vector of claim 4 or 5.

7. The genetically engineered bacterium of claim 6, wherein the host bacterium is escherichia coli.

8. Use of a highly stereoselective transaminase mutant according to claim 1 or 2 for the preparation of (R) -3-aminobutanol, wherein the use comprises asymmetrically catalyzing the amination of 4-hydroxy-2-butanone to (R) -3-aminobutanol with the addition of an amine donor.

9. The application of claim 8, wherein the application comprises: the preparation method comprises the steps of fermenting and culturing engineering bacteria containing transaminase mutant encoding genes, centrifuging to obtain wet bacteria, immobilizing cells of the wet bacteria, ultrasonically crushing the wet bacteria, extracting enzyme or immobilized enzyme serving as a catalyst, taking 4-hydroxy-2-butanone as a substrate under the condition of adding alanine and pyridoxal phosphate, taking buffer solution containing an organic solvent and having a pH value of less than or equal to 8 as a reaction medium, reacting at 25-37 ℃ under the condition of 150-300rpm, and separating and purifying reaction liquid after the reaction is finished to obtain (R) -3-aminobutanol.

10. The use according to claim 9, wherein in the reaction system, the substrate concentration is 0.5-2g/L, the alanine concentration is 2-10g/L, the pyridoxal phosphate concentration is 0.2-0.4g/L, the organic solvent is isopropanol or dimethyl sulfoxide, the volume fraction is 8-12%, the catalyst amount is 20-100g/L based on the weight of wet bacteria, and the water content of the wet bacteria is 70-90%.