CN117431223A - Method for preparing gE and gI double-gene deletion PRV strain by using adenine base editor and application - Google Patents

Abstract

The invention discloses a method for preparing gE and gI double-gene deletion PRV strain by using adenine base editor and application thereof, which relate to the biotechnology field, and the method comprises the steps of selecting initiation codons of gE and gI genes in PRV virus as target sites, designing four sgRNA sequences, respectively synthesizing single-stranded oligonucleotides according to the sgRNA sequences, annealing the single-stranded oligonucleotides to obtain double-stranded DNA fragments with sticky ends, carrying out restriction enzyme digestion on pU6-sgRNA-Puro-2A-EGFP carrier, recovering fragments, and connecting the fragments with the double-stranded DNA fragments with the sticky ends to obtain connection products; converting the connection product into competent cells, plating, screening and culturing, selecting positive bacteria for amplification culture, and extracting plasmids from positive bacteria liquid; the plasmid was transfected into Vero81 cells, after which virus solution was aspirated and the supernatant was collected by centrifugation. The construction method of the invention has high efficiency, small change to virus genes, difficult virus variation and low cost.

Description

Method for preparing gE and gI double-gene deletion PRV strain by using adenine base editor and application

Technical Field

The invention relates to the technical field of biology, in particular to a method for preparing gE and gI double-gene deletion PRV strain by using an adenine base editor and application thereof.

Background

Porcine Pseudorabies (PR) is a highly contagious, septic and virulent infectious disease, pigs of all age groups are susceptible, and abortion, stillbirth, mummy or feeble birth can be caused after pregnant sows are infected; the piglet can cause hyperpyrexia, neurological symptoms and dyspnea after infection, and the newborn piglet mostly shows neurological symptoms after infection, and the death rate is about 100%; after the breeding pigs are infected, the breeding pigs are sterile, the sows are not oestrus, the breeding is difficult, the testes of the boars are swollen and shrink, and the breeding capability is lost. The pathogen of the disease is pseudorabies virus (PRV), which is a double-stranded DNA virus, of which only one serotype is a member of the order Herpesviridae, the subfamily A-Herpesviridae, the genus varicella, the genome being of about 150kb in length and having an average G+C content of up to 74% and having typical structural characteristics of the genome of the Herpesviridae, consisting of a unique long segment UL, a unique short segment US and Terminal Repeats (TR) and Internal Repeats (IR) on both sides. The research finds that the virus can infect various domestic and wild animals such as domestic pigs, wild pigs, cattle, sheep, rabbits, mice, dogs, cats, raccoons and the like, and the pig is an important infectious source of the virus and is the only animal which can survive after the virus infection. In 1947, liu Yongchun, pseudorabies is found in cat body for the first time in China, after 80 years, with the rising of intensive breeding industry, the occurrence of PR is increased year by year and the rising trend is presented, PRV variant strain presents outbreak in pig farm in recent years, great economic loss is caused, and the immune protection effect of the existing classical vaccine strain is limited. The research shows that gE and gI are glycoprotein of the virus and are main virulence genes, and subsequent research shows that the complex formed by gE and gI can promote the release of the virus and the transfer from cell to cell, but is not necessary for the proliferation of the virus, so that the two virulence genes are silenced, the toxicity of the virus can be reduced, and the immunogenicity is not influenced.

Early gene editing mainly utilizes the DNA homologous recombination principle, and the main technologies mainly comprise ZFNs and TALENs, but the development is limited due to a series of defects of complex design, low knockout efficiency, serious off-target, high cost, poor operability and the like. The CRISPR/Cas9 system has become the most popular genetic engineering tool since 2012 discovery because of its high efficiency, convenience, and wide range of applications. Researchers apply CRISPR/Cas9 to drosophila, nematodes, plants, mice, rabbits, pigs, and even non-human primates, not only to achieve successful knockouts of genes, but also to achieve successful knockins of exogenous fragments by providing exogenous donor DNA templates.

In 2015, huang Jun of university of Zhongshan used the CRISPR/Cas9 editing system for human embryo for the first time, and proved the feasibility of CRISPR/Cas9 in human embryo editing at embryo level, and also proved the effectiveness of the CRISPR/Cas9 in beta thalassemia treatment. However, like ZFNs, TALENs, CRISPR/Cas9 implementation of gene editing relies on the production of DSBs, which inevitably triggers NHEJ repair patterns, causing random indel mutations, resulting in higher frequency of unintended base mutations or off-target cleavage. To overcome this technical difficulty, researchers have made many searches in which the advent of single base editing techniques has brought promise for achieving accurate and efficient base substitution.

The single base editing technology is used for modifying Cas protein in a CRISPR/Cas9 system, so that nuclease cutting activity is lost or a single chain can be cut only to generate gaps, the base editing technology is used for fusing the modified Cas9 protein and deaminase based on a base deamination principle (A-I, G-U), the base editing enzyme is anchored to a target site by means of sgRNA, and accurate editing of single base conversion without introducing DNA double-chain break is realized through DNA replication and repair, so that accuracy and efficiency of base editing are improved. Gaudelli et al fused Escherichia coli derived tRNA adenylate deaminase (TadA) with nCas9, and developed a novel single base conversion system (Adenine base editor, ABE) capable of accurately converting adenine to guanine after multiple rounds of screening and protein modification, and formed more efficient and specific single base substitution systems with the development of biotechnology. The ABE system is subjected to 7 rounds of transformation, and the ABE version ABE7.10 with higher efficiency is screened, and the effective editing window is at the 4 th-7 th position of the sgRNA.

The use of ABE is limited by the limited compatibility of deoxyadenosine deaminase with Cas homologs other than SpCas9, richter et al uses phage-assisted discontinuous and continuous evolution, single base substitution systems BE3 and ABE7.10 developed based on the CRISPR/Cas9 system, continuing to improve the deaminase component of ABE7.10, resulting in a version of ABE with higher current editing efficiency: ABE8e. ABE8e contains 8 additional mutations compared to ABE7.10, can increase activity 590-fold, and can greatly increase editing efficiency when paired with various Cas9 or Cas12 homologs. After the ABE tool is developed, the Jin-Soo Kim subject group is first applied to the construction of mouse disease models and the correction of genetic diseases. Subsequently, the experimental results of the institute of neuroscience of Chinese sciences Liu Zhen subject group further confirm the significance of ABE7.10 for clinical treatment. Several studies have now demonstrated that single base editors ABE can work efficiently in multiple species. However, the application of the traditional Chinese medicine composition to pseudorabies viruses is not reported at present.

Disclosure of Invention

The invention aims to at least solve one of the technical problems in the prior art, and provides a method for preparing gE and gI double-gene deletion PRV strain by using an adenine base editor and application thereof.

The technical scheme of the invention is as follows:

a gE and gI double-gene deleted PRV strain which is preserved in China Center for Type Culture Collection (CCTCC) at the 6 th month of 2023, wherein the preservation address is the preservation number CCTCC NO: v202324, named: PRV-DeltagE/DeltagI-ABE. The gE sequence is shown as SEQ ID No.1, and the gI sequence is shown as SEQ ID No. 2.

A method for preparing a gE and gI double gene deleted PRV strain using an adenine base editor, comprising the steps of:

s1: constructing a sgRNA framework plasmid;

selecting initiation codons of gE and gI genes in PRV virus as target sites, designing four sgRNA sequences by using an adenine base editor, respectively synthesizing single-stranded oligonucleotides according to the sgRNA sequences, annealing the single-stranded oligonucleotides to obtain double-stranded DNA fragments with sticky ends, carrying out restriction enzyme digestion on pU6-sgRNA-Puro-2A-EGFP vectors, recovering fragments, and connecting the fragments with the double-stranded DNA fragments with the sticky ends to obtain a connecting product, namely the sgRNA expression vector;

converting the connection product into competent cells, plating, screening and culturing, selecting positive bacteria for amplification culture, and extracting plasmids from positive bacteria liquid;

s2: plasmid transfection;

the plasmid was transfected into Vero81 cells, after which virus solution was aspirated and the supernatant was collected by centrifugation.

As a preferable scheme of the invention, the four sgRNA sequences are respectively shown as SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO. 6.

As a preferred embodiment of the present invention, the restriction enzyme is Bbs I enzyme.

As a preferred embodiment of the present invention, the method for synthesizing a single-stranded oligonucleotide is as follows:

NG-ABE8e-gI-1M-F：CACCGCATCATCGACGCCGGTACTG；

NG-ABE8e-gI-1M-R：AAACCAGTACCGGCGTCGATGATGc；

NG-ABE8e-gI-2M-F：CACCGATGATGATGGTGGCGCGCGA；

NG-ABE8e-gI-2M-R：AAACTCGCGCGCCACCATCATCATc；

NG-ABE8e-gI-3M-F：CACCGGATGATGGTGGCGCGCGACG；

NG-ABE8e-gI-3M-R：AAACCGTCGCGCGCCACCATCATC；

NG-ABE8e-gE-F：CACCGGCCGCATGGTCTCAACCCC；

NG-ABE8e-gE-R：AAACGGGGTTGAGACCATGCGGCC。

as a preferred embodiment of the present invention, the NG-ABE8e is a plasmid expressing nCas9 protein.

As a preferred embodiment of the present invention, vero81 cells are cultured in a culture medium containing fetal bovine serum to a logarithmic growth phase prior to the transfection.

The invention also discloses a gE and gI double-gene deleted PRV strain, which is prepared by adopting any one of the construction methods.

The invention also discloses application of the gE and gI double-gene deleted PRV strain in preparation of pseudorabies vaccine.

The beneficial effects of the invention are as follows: the construction method of the invention has high efficiency, small change to virus genes, difficult virus variation and low cost.

Drawings

FIG. 1 is a graph of sequencing peaks after editing of gI according to the present invention;

FIG. 2 is a graph of the sequencing peaks of PRV edited toxicity after stable passage according to the present invention;

FIG. 3 is a graph showing the detection of PRV editing toxins gE and gI protein expression. .

Detailed Description

The technical scheme of the invention is further described in the following specific examples.

The test materials used in the examples described below, unless otherwise specified, were purchased from conventional biochemical reagent stores.

NG-ABE8e vector: adedge, cat No.: 138491;

in the NG-ABE8e vector, the CMV promoter starts the expression of the related protein;

the single base editor NG-ABE8e expresses adenine deaminase for point mutation;

the sgRNA backbone plasmid includes a binding region that binds to the target sequence and a binding region that binds to cas9 protein.

1. Construction of sgRNA backbone plasmids

In this example, the start codons of the gE and gI genes were selected as target sites; four sgrnas were designed, whose recognition sequences were:

NG-ABE8e-gI-1M：CATCATCGACGCCGGTACTG(SEQ ID NO.3)

NG-ABE8e-gI-2M：ATGATGATGGTGGCGCGCGA(SEQ ID NO.4)

NG-ABE8e-gI-3M：GATGATGGTGGCGCGCGACG(SEQ ID NO.5)

NG-ABE8e-gE：GGCCGCATGGTCTCAACCCC(SEQ ID NO.6)

single-stranded oligonucleotides were synthesized according to the designed sequences, respectively, as follows:

NG-ABE8e-gI-1M-F：CACCGCATCATCGACGCCGGTACTG；(SEQ ID NO.7)

NG-ABE8e-gI-1M-R：AAACCAGTACCGGCGTCGATGATGC；(SEQ ID NO.8)

NG-ABE8e-gI-2M-F：CACCGATGATGATGGTGGCGCGCGA；(SEQ ID NO.9)

NG-ABE8e-gI-2M-R：AAACTCGCGCGCCACCATCATCATC；(SEQ ID NO.10)

NG-ABE8e-gI-3M-F：CACCGGATGATGGTGGCGCGCGACG；(SEQ ID NO.11)

NG-ABE8e-gI-3M-R：AAACCGTCGCGCGCCACCATCATC；(SEQ ID NO.12)

NG-ABE8e-gE-F：CACCGGCCGCATGGTCTCAACCCC；(SEQ ID NO.13)

NG-ABE8e-gE-R：AAACGGGGTTGAGACCATGCGGCC。(SEQ ID NO.14)

annealing the corresponding primer to obtain a double-stranded DNA fragment with a sticky end;

the pU6-sgRNA-Puro-2A-EGFP vector is digested by Bbs I, then fragments are recovered, and then the fragments are connected with the double-stranded DNA fragments with the sticky ends, so that the sgRNA expression vector is obtained;

the single base editor NG-ABE8e includes Cas9 (N), in this example, specifically a plasmid expressing Cas9 (N) protein.

(1) Construction of double-stranded sgRNA

The following table shows the system of phosphorylation annealing.

Table 1 shows a system for phosphorylation annealing

The gradient annealing procedure is shown in table 2:

table 2 shows a gradient annealing procedure

(2) Construction of expression linearization backbone vector plasmids

The following Table shows the cleavage System of pU6-sgRNA-Puro-2A-EGFP vector

Table 3 shows the cleavage System of pU6-sgRNA-Puro-2A-EGFP vector

The reaction procedure: the enzyme digestion system is placed in a water bath kettle at 37 ℃ for reaction for 2 hours to obtain enzyme digestion products

Detecting the enzyme-cut product by agarose gel electrophoresis, and recovering the target band by gel after electrophoresis

(3) Construction of backbone plasmid expressing sgRNA

The following table shows the connection reaction system

Table 4 shows a connection reaction system

The connection product is transformed into Top10 competent cells by a conventional method, a proper amount of bacterial liquid is coated on an LB plate containing ampicillin, after the surface liquid of the plate is evaporated, the plate is inverted and cultured overnight at 37 ℃ for 16-18 hours, the transformation condition is observed, 5 monoclonal colonies are selected, sequencing is carried out after shake culture, positive clones which are successfully sequenced are selected for further expansion culture, non-endotoxinic particles for cell transfection are extracted, and the non-endotoxinic particles are placed at-20 ℃ for preservation and named as ABE-gI1M-sgRNA, ABE-gI2M-sgRNA, ABE-gI3M-sgRNA and ABE-gE-sgRNA.

2. Plasmid transfection

(1) One day before transfection, well-grown Vero81 cells were digested with trypsin, 1X 10 ⁶ Cells were transferred to a six-well plate, and 2mL of DMEM medium (all available from Gibco) containing 10 (v/v)% fetal bovine serum was added thereto, 37℃and 5 (v/v)% CO ₂ Culturing to logarithmic phase

(2) Cell transfection was performed with reference to Lipofectamine3000 official instructions, the total amount of transfected DNA was 3. Mu.g, including viral genomic DNA and NG-ABE8e plasmid, ABE-gI1M-sgRNA and ABE-gI2M-sgRNA and ABE-gI3M-sgRNA, the transfection mass was 1. Mu.g each.

(3) 24h after transfection, observing whether PRV characteristic lesions exist or not by using a microscope, after observing the lesions, placing a six-hole plate at-80 ℃ to normal temperature for three times, collecting a virus liquid, centrifuging at 8000rpm for 5 minutes, sucking the supernatant, and taking a part of extracted genes for sequencing.

(4) And after the sequencing is successful, comparing the sequencing result with a wild PRV gene to obtain detailed mutation information.

As a result, as shown in FIG. 1, the first three initiation codons of gI were successfully mutated to achieve the desired editing objective, except that the second ATG was slightly less efficient to edit and did not exceed the 50% editing scale. 3. Plaque purified mutant strains

(1) Viral supernatants were serially diluted 10 to 10 at ten fold ratio ⁶ Multiple inoculation of various dilutions of virus into the overgrowth VerIn a 12-well plate of o81 monolayer cells, 200 μl of each well was inoculated, the cell plate was shaken once every half an hour, incubated for 2h, virus solution was aspirated, and the cell surface was washed 3 times with serum-free DMEM medium for use.

(2) After 2% (w/v) of low-culturing point agarose sterilized by high pressure is heated and dissolved by microwave, the low-culturing point agarose is cooled to about 37 ℃ and is fully and uniformly mixed with an equal volume of 2 XDMEM culture medium containing 4% FBS, 1mL of the medium is added into a 12-pore plate rapidly, the mixture is placed for about 5min at room temperature, and after the culture medium is naturally solidified, the mixture is placed into a carbon dioxide cell incubator for culturing.

(3) Incubating for 48h, observing cytopathy and plaque formation, randomly picking a plurality of single plaques in a low-dilution hole as much as possible by using a 10 mu L small gun head, respectively blowing 200 mu L of DMEM culture medium into the single plaques, uniformly mixing the single plaques, and inoculating Vero81 cells in a 24-well plate for expanding culture.

(4) After a large number of lesions appear on the cells, observing and collecting virus liquid, extracting virus DNA, amplifying target fragments by using primers, and then carrying out the next round of purification according to the corresponding sequencing result.

(5) After three generations of purification, the viral genome was extracted and subjected to cell transfection with ABE-gE-sgRNA and NG-ABE8e plasmids, each 1 μg in transfection quality, and the above steps were repeated, followed by ten successive passages of the virus after three generations of purification.

(6) Sequencing to verify whether the mutant gene can stably express genetically and collect virus liquid.

PRV-DeltagE/DeltagI-ABE is continuously transmitted for 10 generations, the virus after the transmission is sequenced, and the sequencing result in FIG. 2 shows that the genetic stability of three mutation sites of gI gene and one mutation site of gE is good. The PRV strain with the gE and gI double gene deletion obtained above is preserved in China Center for Type Culture Collection (CCTCC) at the year 2023 and the month 6 and 30, and the preservation number is CCTCC NO: v202324, named: PRV-DeltagE/DeltagI-ABE. The gE sequence is shown as SEQ ID No.1, and the gI sequence is shown as SEQ ID No. 2.

4. Analysis of Gene-silenced viral protein expression

(1) Western blot detection of whether expression of target gene is silenced

And (3) inoculating the purified virus into Vero81 cells, collecting viral proteins 24h after virus inoculation, performing Western blot, and detecting the expression of gI genes and gE.

(2) The experimental results are shown in fig. 3, and the results show that compared with the wild strain, the mutated gE and gI genes do not detect the expression of the protein, and the mutation of the start codon can effectively inhibit the expression of gI protein and gE.

(3) The result shows that after the initial codon of the gene is mutated by using the NG-ABE base editor, the expression of gI and gE in the virus can be inhibited, thereby achieving better gene silencing effect.

The foregoing examples have shown only the preferred embodiments of the invention, which are described in more detail and are not to be construed as limiting the scope of the invention. It should be pointed out that various other corresponding changes and modifications can be made by those skilled in the art in light of the above description of the technical solution and the idea, and all such changes and modifications are intended to be within the scope of the invention as defined in the appended claims.

Claims (7)

1. A gE and gI double-gene deleted PRV strain, which is characterized by being preserved in China Center for Type Culture Collection (CCTCC) NO: v202324, named: PRV-DeltagE/DeltagI-ABE.

2. The gE and gI double gene deleted PRV strain according to claim 1, wherein the gE sequence is shown in SEQ ID No.1 and the gI sequence is shown in SEQ ID No. 2.

3. A method for preparing a gE and gI double gene deleted PRV strain using an adenine base editor, comprising the steps of:

s1: constructing a sgRNA framework plasmid;

selecting initiation codons of gE and gI genes in PRV virus as target sites, designing four sgRNA sequences by using an adenine base editor, respectively synthesizing single-stranded oligonucleotides according to the sgRNA sequences, annealing the single-stranded oligonucleotides to obtain double-stranded DNA fragments with sticky ends, carrying out restriction enzyme digestion on pU6-sgRNA-Puro-2A-EGFP vectors, recovering fragments, and connecting the fragments with the double-stranded DNA fragments with the sticky ends to obtain a connecting product, namely the sgRNA expression vector;

converting the connection product into competent cells, plating, screening and culturing, selecting positive bacteria for amplification culture, and extracting plasmids from positive bacteria liquid;

s2: plasmid transfection;

the plasmid was transfected into Vero81 cells, after which virus solution was aspirated and the supernatant was collected by centrifugation.

4. The method for preparing the gE and gI double-gene deleted PRV strain using an adenine base editor according to claim 3, wherein the four sgRNA sequences are shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, respectively.

5. The method for preparing a gE and gI double gene deleted PRV strain using an adenine base editor according to claim 3, wherein said restriction enzyme is Bbs I enzyme.

6. The method for preparing a gE and gI double gene deleted PRV strain using an adenine base editor according to claim 3, wherein before said transfection, vero81 cells are cultured in a culture solution containing fetal bovine serum to a logarithmic growth phase.

7. Use of a strain of PRV with a deletion of both the gE and gI genes as claimed in claim 1 or 2 in the preparation of a pseudorabies vaccine.