CN113637648A

CN113637648A - Recombinant porcine pseudorabies virus strain capable of simultaneously expressing PEDV variant strain S1 gene CS region and porcine IL-18 and application thereof

Info

Publication number: CN113637648A
Application number: CN202110863467.9A
Authority: CN
Inventors: 郑兰兰; 陈红英; 崔建涛; 韩昊莹; 张远航; 陈曦艋
Original assignee: Henan Agricultural University
Current assignee: Henan Agricultural University
Priority date: 2021-07-29
Filing date: 2021-07-29
Publication date: 2021-11-12

Abstract

The invention belongs to the field of molecular biology, and particularly relates to a recombinant porcine pseudorabies virus strain capable of simultaneously expressing a CS region of a PEDV variant strain S1 gene and porcine IL-18 and application thereof. The classification name is rPRV-PEDV S1-IL18, and the accession number is: CCTCC NO: v201740, date of deposit: 31/10/2017, deposited in the China center for type culture Collection with the address: wuhan, Wuhan university. The application successfully obtains the recombinant porcine pseudorabies virus strain, which can induce piglets to generate specific antibodies aiming at PEDV and PRV and can protect the piglets from lethal attack of the PEDV and PRV strong virus. The PRV specific antibody level generated by the recombinant strain group is higher than that of the rPRV-PEDV S1 group of the recombinant virus without the porcine IL-18, and the recombinant strain group is expected to become a candidate strain of a novel porcine epidemic diarrhea and porcine pseudorabies bivalent attenuated vaccine.

Description

Recombinant porcine pseudorabies virus strain capable of simultaneously expressing PEDV variant strain S1 gene CS region and porcine IL-18 and application thereof

Technical Field

The invention belongs to the field of molecular biology, and relates to a recombinant porcine pseudorabies virus strain, in particular to a recombinant porcine pseudorabies virus strain capable of simultaneously expressing a CS region of a gene S1 of a PEDV variant strain and porcine IL-18 and application thereof.

Background

Porcine Epidemic Diarrhea (PED) is a highly-contact intestinal infectious disease of pigs caused by Porcine Epidemic Diarrhea Virus (PEDV), and is mainly clinically manifested by vomiting, watery diarrhea, dehydration and high mortality rate of suckling piglets, and is mostly seen in cold winter and spring. The disease occurs worldwide, especially in europe and asia. Since the use of PEDV CV777 vaccine in swine farms in our country, PED has been well controlled. However, since 12 months 2010, a new round of PED epidemic has been outbreaked in many pig farms in many countries including China, pigs of all ages have diarrhea, especially piglets within 2 weeks have the most serious disease fatality rate of 90-100%. In 2013, the U.S. first outbreak of PED and rapidly spread to the whole united states. The new epidemic situation causes huge economic loss to the global pig industry. The gene sequence analysis result shows that the new PEDV epidemic strain in China is highly similar to the gene sequence of the U.S. outbreak PEDV epidemic strain in 2013, and has more variation in S gene, especially the N-segment region of S protein, compared with the PEDV CV777 vaccine strain used in China for a long time. PEDV is separated from intestinal tissues and contents of immunized pigs in Kaifeng city, Henan, in 2016, and named as CH-HNKF-2016 (accession number KY 649107), and subjected to whole genome sequencing and genetic evolution analysis. The results show that the strain has the highest homology with the recently isolated PEDV variant strain in China, and is located in one branch in the evolutionary tree with the recently isolated PEDV variant strain in China.

Pseudorabies (PR), Aujeszky's disease, is an acute highly contagious disease of various domestic and wild animals such as cattle, sheep, pigs, etc. caused by Pseudorabies virus (PRV). The main symptoms of PR are fever, extreme itching, encephalomyelitis, neurological and reproductive system disorders. At present, no medicine for treating PR exists, only attenuated vaccines such as PRV Bartha K61 and the like can be inoculated to prevent and control PR, susceptible pigs are effectively protected, PRV gene deletion vaccines and differential diagnosis technologies matched with the PRV gene deletion vaccines promote purification of PRV wild strains in pig farms. However, since the end of 2011, many pig farms immunized Bartha K61 in china have developed a new round of PR. About 60% of 3-7 days old piglets in the sick pig farm have central nervous system diseases, the death rate is 100%, and huge economic loss is caused to the pig industry. PRV have been isolated by many scholars from dead piglets and aborted fetuses immunized with PR vaccines and subjected to sequencing and genetic evolutionary analysis, as well as to tests for the pathogenicity of piglets. The result shows that the PRV epidemic strain is in a relatively independent branch, has a far genetic relationship with the conventional PRV isolate at home and abroad, and the common vaccine strains such as Bartha K61, and has stronger pathogenicity to piglets. The antigenicity of the PRV epidemic strain is mutated, and the conventional attenuated vaccines such as Bartha K61 can not completely protect the infection of the PRV epidemic strain.

A PRV wild strain is isolated from a pig body which is infected by PRV Bartha K61 vaccine and is collected from Nanyang city, Henan province in 2012 and killed in a pig farm, and is named as PRV/HN2012 strain (CCTCC NO. V201314). Based on the homology of genes gE, gB and gC and the genetic evolution analysis result, the isolate has the highest homology with PRV epidemic variant strains separated in recent years in China, and is positioned in the same branch with the PRV epidemic variant strains separated in recent years in China in an evolutionary tree, so that the isolate can be used as a new direction for vaccine development. TK/gE/gI three-gene deletion is carried out on PRV/HN2012 strains to obtain PRV epidemic variant strain three-gene deletion mutant rPRV HN2012-TK^-/gE^-/gI^-. The experiment proves that rPRV HN2012-TK^-/gE^-/gI^-The mouse body generates PRV specific antibody with higher titer, the determination of mouse peripheral blood T lymphocyte subgroup also shows that the PRV specific antibody successfully activates the cell immunity of the mouse body, and has 100% resistance to the attack of PRV/HN2012 strains, thereby creating conditions for eradicating PR in China.

Research on porcine Interleukin 18 (Interleukin 18, IL-18) which is a pleiotropic cytokine produced by mononuclear macrophage and dendritic cell, Kayamuro and the like finds that the IL-1 family can promote Th1 type and Th2 type immune response at the same time, macrophages are target cells with adjuvant effect like DC, and the porcine IL-18 can be used as a vaccine adjuvant to play a regulating effect. Therefore, porcine IL-18 can be used as a natural immunomodulator and vaccine immunopotentiator.

PEDV and PRV are the most important two porcine viruses, and no vaccine for simultaneously preventing porcine epidemic diarrhea and porcine pseudorabies exists so far, so that the development of a recombinant vaccine of the two viruses has important significance for production practice, and the porcine IL-18 is used as a molecular adjuvant, so that the vaccine has an immunity enhancing effect.

Disclosure of Invention

In order to solve the technical problems, the invention provides a recombinant porcine pseudorabies virus strain capable of simultaneously expressing a CS region of an S1 gene of a PEDV variant strain and a porcine IL-18 and application thereof, wherein the PEDV variant strain CH-HNKF-2016 is taken as a research object, firstly, a S1 gene CS epitope region containing the PEDV variant strain CH-HNKF-2016 and a recombinant transfer plasmid pG-CS-IL18 (containing an EGFP fluorescent label) of the porcine IL-18 are constructed, the EGFP expressing green fluorescent protein is taken as a screening marker, and the current PRV variant strain three-gene deletion rPRV HN2012-TK mutant strain is taken as a screening marker^-/gE^-/gI^-After an ST cell is infected, the ST cell is transfected by the recombinant transfer plasmid pG-CS-IL18, homologous recombination is carried out, and the recombinant virus rPRV-PEDV S1-IL18-EGFP for expressing green fluorescence is obtained by screening plaques with green fluorescent protein and purifying. And removing the fluorescent tag EGFP gene by using a CRISPR/Cas9 plasmid knockout vector (PX 459-gRNA1-EZ-gRNA 3-EGFP) to successfully obtain the recombinant virus rPRV-PEDV S1-IL 18.

The invention adopts the following specific scheme:

the recombinant porcine pseudorabies virus strain simultaneously expressing the CS region of the PEDV variant strain S1 gene and the porcine IL-18 is classified as rPRV-PEDV S1-IL18, and the preservation number is as follows: CCTCC NO: v201740, date of deposit: 31/10/2017, deposited in the China center for type culture Collection with the address: wuhan, Wuhan university.

The porcine pseudorabies virus strain comprises an S1 gene CS epitope region of a PEDV variant CH-HNKF-2016 and a porcine IL-18 gene.

The sequence of the CS epitope region of the S1 gene of the PEDV variant CH-HNKF-2016 is shown in SEQ ID No. 1.

The recombinant porcine pseudorabies virus strain is a variant strain PRV/HN2012 strain with the preservation number: CCTCC NO. V201314, and a PRV epidemic variant strain three-gene deletion mutant rPRV HN2012-TK obtained by deleting gI, gE and TK genes of the mutant^-/gE^-/gI^-As the live virus vector, the deposit number is: CCTCC NO. V201748, preservation name: heavy loadGroup porcine pseudorabies virus rPRV HN2012-TK-/gE-/gI-, preservation date: 31/10/2017, deposited in the China center for type culture Collection with the address: wuhan, Wuhan university.

The recombinant porcine pseudorabies virus strain selects gG glycoprotein of a variant strain PRV/HN2012 strain as an insertion site, fragments of 416 bp in total of 23bp-438bp on a gG gene are firstly deleted, and then a gG promoter is utilized to express a CS epitope region of PEDV.

The gG gene sequence is shown as SEQ ID No. 2.

The construction method of the recombinant porcine pseudorabies virus strain comprises the following steps:

(1) designing primer pairs CS-F/CS-R and IL18- (II) according to the gene sequence of the CS region of the PEDV variant S1 gene, the gene sequence of the pig IL-18 and the sequence of the pBapo-EF1alpha _ Pur _ DNA plasmidBamH I)F/IL18-(HindIII) R, and pBapo (A), (B), (C)BstZ17I)-F/pBApo(BstZ17I)-R；

(2) Taking cDNA of the PEDV variant strain as a template, taking the primer pair CS-F/CS-R in the step (1) as a primer, carrying out amplification and enzyme digestion, and recovering a CS region target fragment;

(3) taking pBapo-EF1alpha _ Pur _ DNA plasmid as a template, and taking the primer pair pBapo (pBapo) of the step (1)BstZ17I)- F/pBApo(BstZ17I) -R is used as a primer for amplification and enzyme digestion and pG vector recovery;

(4) connecting and transforming the pG vector recovered in the step (2) and the CS region fragment to obtain a pBapo-EF1alpha _ Pur _ DNA eukaryotic expression plasmid, and performing enzyme digestion to recover the vector fragment, namely the pG-CS vector;

(5) extracting RNA from pig blood, reverse transcribing to cDNA as template, and using primer pair IL18-, (1)BamH I)F/IL18-(HindIII) taking R as a primer, carrying out amplification, transformation and screening of positive bacteria, and then utilizing a primer pair pBapo (b)Bstz17I)-F/ pBApo(Bstz17I) -R amplifies an expression cassette of the IL-18 gene, and carries out enzyme digestion and recovery;

(6) connecting the pG-CS vector recovered in the step (4) with the expression cassette of the IL-18 gene in the step (5), and transforming and identifying to obtain a recombinant transfer plasmid pG-CS-IL 18;

(7) the parent strain rPRV HN2012-TK^-/gE^-/gI^-Inoculating the cells on ST cells, incubating in an incubator for 2 h, then removing the culture medium, washing, transfecting the ST cells with the recombinant transfer plasmid pG-CS-IL18 obtained in the step (6), and collecting virus-containing supernatant when all cells fall off;

(8) and (3) screening plaques with green fluorescent protein, purifying to obtain recombinant virus rPRV-PEDV S1-IL18-EGFP expressing green fluorescence, removing a fluorescent tag EGFP gene by using a CRISPR/Cas9 plasmid knockout vector PX459-gRNA1-EZ-gRNA3-EGFP, and successfully obtaining the recombinant virus rPRV-PEDV S1-IL18, namely the recombinant porcine pseudorabies virus strain.

The CS-F sequence of the primer in the step (1) is GA GGA TCC CTATGGTTACTTTG CATCA, the sequence of the primer CS-R is GC GGA TCC TCAAATACTCATACT, respectively; primer IL18-, (BamH I) the F sequence isGA AGA TCT GCCACCATGGCTGCTGAACCGGAAG, primer IL18-, (HindIII) the R sequence is GG GAA TTC GTTCTTGTTTTGAACAG, respectively; primer pBapo (BstZ17I) -F sequence is GTATAC TGA GGCTCCGGTGCCCGT primer pBapo (A)BstZ17I) -R sequence is GTATAC TGA GGCTCCGGTGCCCGT。

The recombinant porcine pseudorabies virus strain is applied to the preparation of attenuated vaccines for resisting novel porcine epidemic diarrhea and porcine pseudorabies virus simultaneously.

The recombinant porcine pseudorabies virus strain is used as a candidate strain of a novel porcine epidemic diarrhea and porcine pseudorabies bivalent attenuated vaccine.

The invention has the following beneficial effects:

the recombinant virus rPRV-PEDV S1-IL18 was tested for culture characteristics, growth characteristics, genetic stability, safety, and immunopotency in piglets. The results showed that the recombinant virus rPRV-PEDV S1-IL18 was successfully obtained, TCID determined on ST cells₅₀The result was 10^7.875mL, growth characteristics of same as parent strain rPRV NY-gE^-/gI^-/TK^-The virus titer has similar growth trend and is genetically stableThe piglet anti-virus vaccine has good sex and is safe to mice, can induce piglets to generate specific antibodies aiming at PEDV and PRV, and can protect the piglets from being attacked by PEDV and PRV which are virulent and lethal. In addition, the recombinant virus rPRV-PEDV S1-IL18 group produced higher levels of PRV-specific antibodies than the recombinant virus rPRV-PEDV S1 group without porcine IL-18. The recombinant virus rPRV-PEDV S1-IL18 is expected to become a candidate strain of a novel porcine epidemic diarrhea and porcine pseudorabies bivalent attenuated vaccine.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the drawings without creative efforts.

FIG. 1 shows the construction of recombinant transfer plasmid pG-CS-IL 18.

FIG. 2 shows the construction of recombinant virus rPRV-PEDV S1-IL 18.

FIG. 3 shows the results of detection of fragments in CS epitope region, wherein M. DNA Marker 2000+; 1. CS; 2. negative control.

FIG. 4 shows the PCR amplification results of the pig IL-18 gene and the expression cassette, wherein M. DNA Marker 2000+,. 1. pig IL-18 gene, 2. pig IL-18 expression cassette, and 3-4. negative control.

FIG. 5 shows the PCR amplification results of the CS epitope region fragment and the porcine IL-18 expression cassette, wherein M. DNA Marker 2000+; 1. CS epitope region; 2. porcine IL-18 expression cassette; and 3-4. negative control.

FIG. 6 shows plaques (40X) after purification of recombinant virus rPRV-PEDV S1-IL 18-EGFP.

FIG. 7 shows plaques (20X) after lesions with recombinant virus rPRV-PEDV S1-IL 18.

FIG. 8 shows the results of PCR detection of the CS epitope region fragments of 10 rPRV-PEDV S1-IL18 plaques, wherein M. DNA Marker 2000+; 1-10. CS; 11. negative control.

FIG. 9 shows the PCR detection results of porcine IL-18 genes of 10 recombinant virus rPRV-PEDV S1-IL18 plaques, wherein M. DNA Marker 2000+,. 1-10 porcine IL-18 genes, and 11 negative controls.

FIG. 10 shows the result of transcription detection of CS epitope region fragment of rPRV-PEDV S1-IL18, wherein M. DNA Marker 2000+; 1. CS; 2. negative control.

FIG. 11 shows the transcription detection result of porcine IL-18 in recombinant virus rPRV-PEDV S1-IL18, M. DNA Marker 2000+; 1. porcine IL-18 gene, and 2. negative control.

FIG. 12 shows Western blot identification of CS proteins in rPRV-PEDV S1-IL18 recombinant virus, wherein M. Protein marker, 1. CS Protein, and 2. parental strain control.

FIG. 13 shows Western blot identification of porcine IL-18 in recombinant virus rPRV-PEDV S1-IL18, M. Protein marker, 1. porcine IL-18, and 2. parental strain control.

FIG. 14 shows morphological changes (40X) of rPRV-PEDV S1-IL18 seeded ST cells at different times.

FIG. 15 shows morphological changes (40X) of rPRV-PEDV S1-IL18 inoculated PK-15 cells at different times.

FIG. 16 shows the morphological changes (40X) of rPRV-PEDV S1-IL18 inoculated Vero cells at different times.

FIG. 17 shows the morphological changes (40X) of rPRV-PEDV S1-IL18 inoculated IPEC cells at different times.

FIG. 18 shows recombinant viruses rPRV-PEDV S1-IL18 and rPRV HN2012-TK^-/gE^-/gI^-One step growth curve on ST cells.

FIG. 19 shows CS epitope region homology of recombinant virus rPRV-PEDV S1-IL 18.

FIG. 20 shows porcine IL-18 gene homology of recombinant virus rPRV-PEDV S1-IL 18.

FIG. 21 shows ELISA antibody levels (OD values) of PEDV in serum after immunization.

Figure 22 is the neutralizing antibody levels of PRV in serum.

Detailed Description

The technical solutions of the present invention will be described clearly and completely with reference to the following embodiments of the present invention, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be obtained by a person skilled in the art without inventive effort based on the embodiments of the present invention, are within the scope of the present invention.

Example 1: rescue of PEDV variant S1 gene CS region and porcine IL-18 recombinant porcine pseudorabies virus strain

1 materials and methods

1.1 materials

1.1.1 plasmids, cells and viruses

PRV universal transfer plasmid pG, PRV epidemic variant three-gene deletion mutant rPRV HN2012-TK^-/gE^-/gI^-(CCTCC NO. V201748), PEDV variant CH-HNKF-2016 (accession number KY 649107) cDNA and CRISPR/Cas9 plasmid knockout carrier (PX 459-gRNA1-EZ-gRNA 3-EGFP) are constructed and stored in a pig major epidemic disease prevention and control key laboratory in Zhengzhou city; the pig testicular cells (ST cells) and Vero cells are passed and stored in a key laboratory for preventing and controlling the serious epidemic disease of the pigs in Zhengzhou city.

1.1.2 Primary reagents

cDNA Synthesis Kit (reverse transcription Kit) purchased from Nanjing Novozam; the transfection reagent ZLIP 2000 was purchased from Beijing Jianzhu alliance;BamH I、Hind III、Bstthe Z17I restriction enzyme, alkaline phosphatase (CIAP) was purchased from Takara Bio Inc.; horse Radish Peroxidase (HRP) marked goat anti-rabbit IgG and DAB kits are purchased from Strobilanthes Wuhan, Dr, Bio-Inc; endotoxin-free plasmid extraction kit (6948-01B) was purchased from OMEGA.

1.1.3 Main Instrument

Arktik type PCR instrument, Alphalmager HP type ultraviolet gel and CO₂Incubators and the like were purchased from Thermo corporation, usa; a small high speed 4 ℃ centrifuge was purchased from Sigma, germany; nikon TS100 fluorescence microscope from Lyca Germany.

1.2 methods

1.2.1 construction of recombinant Virus rPRV-PEDV S1-IL18 technical scheme

Technical scheme 1 construction of recombinant transfer plasmid pG-CS-IL18, as shown in FIG. 1; technical scheme 2 recombinant virus rPRV-PEDV S1-IL18 was constructed as shown in FIG. 2.

1.2.2 primer design and Synthesis

According to the sequence of a CS neutralization epitope region in the S1 gene of PEDV CH-HNKF-2016 strain (accession number KY 649107), 1 pair of specific primers (CS-F/CS-R) are designed by using Primer 5.0 Primer software, and 5' ends of the upstream and downstream primers are addedBamH I restriction site (underlined) and the amplification length was 895 bp (Table 1). Based on the pig IL-18 gene sequence (AF 191088) in GenBank, 1 pair of primers containingBamH I andHindIII restriction enzyme site (underlined part), the amplification length is 613 bp. In addition, based on the pBapo-EF1alpha _ Pur _ DNA plasmid, design 1 pairs containingBstThe primer for the cleavage site (underlined) of Z17I, with an amplification length of 1980 bp, was used to amplify an expression cassette comprising the EF 1. alpha. promoter. The primers were synthesized by Wuhan Oakco Ltd.

TABLE 1 primer sequences

1.2.3 amplification and purification of CS epitope regions

The CS epitope region was amplified using the cDNA of PEDV variant strain CH-HNKF-2016 (accession number KY 649107) as a template with the primer CS-F/R. The reaction system is as follows: 2 XFtaq Master Mix 25. mu.L, 1. mu.L of each of the upstream and downstream primers, 1. mu.L of template, and ddH₂O to 50. mu.L. Recovering the target fragment in CS region, and storing in refrigerator at-20 deg.C.

1.2.4 construction of recombinant transfer plasmid pG-CS

1.2.4.1 of the CS epitope regionBamH I enzyme digestion and purification: by usingBamH I, the recovered CS region target fragment is subjected to enzyme digestion, and the enzyme digestion system is as follows: 5 mu L of 10 XQuickCut Buffer, wherein the target fragment in the CS region is less than 5 mu g, and the QuickCutBamH I5 μ L, supplemented with ddH₂O to 50. mu.L. Placing in a 30 ℃ constant temperature water bath kettle for 30 min, adding a sample loading buffer to terminate the reaction, recovering the target fragment of the CS region after enzyme digestion, and storing in a refrigerator at-20 ℃.

1.2.4.2 recombinant transfer of plasmid pGBamH I enzyme digestion and purification: the pG transfer plasmid is digested as described above and then dephosphorylatedThe reaction system comprises the following steps: 30 mu L of pG reaction product after enzyme digestion, 1 mu L of CIAP and 5 mu L of AP buffer are supplemented with ddH₂O to 50. mu.L. After 30 min of water bath at 37 ℃ and overnight at 4 ℃, the pG vector after enzyme digestion is recovered by a DNA gel recovery kit and stored in a refrigerator at-20 ℃ for later use.

1.2.4.3 ligation and transformation: the recovered pG vector is ligated with the fragment of CS region as follows: pG vector 20 ng/. mu.L, CS region fragment 40 ng/. mu.L, T4 DNA ligase 1.0. mu.L, ligase Buffer 1.0. mu.L, supplemented with ddH₂O to 10. mu.L, and connecting the trough overnight at 16 ℃. The ligation product was transformed to DH5 alpha competence.

1.2.4.4 identification of recombinant transfer plasmid pG-CS: and selecting spots for bacteria liquid PCR identification, and sending the positive bacteria liquid to sequencing for further identification.

PCR amplification of CS target gene and electrophoretic identification were carried out using the bacterial solution of the recombinant transfer plasmid pG-CS as a template, and the results showed that a specific band (FIG. 3) appeared at about 895 bp, corresponding to the expected size of the amplified fragment.

And extracting recombinant plasmids of the recombinant bacteria liquid which is identified as positive by PCR, and sequencing. The results showed that the CS epitope region fragment was successfully inserted into the recombinant transfer vector pGBamH I point.

1.2.5 construction of eukaryotic expression plasmid pBapo-IL18

1.2.5.1 RT-PCR amplification of porcine IL-18 Gene: collecting blood of healthy pig from Henan pig farm, extracting total RNA, reverse transcribing into cDNA as template, and using primer IL18- (B)BamH I)F/IL18-(HindIII) R, carrying out pig IL-18 gene amplification, recovering the pig IL-18 gene, and storing at-20 ℃ for later use.

1.2.5.2 restriction enzyme digestion and recovery of porcine IL-18 gene: by usingBamH I andHindIII, carrying out enzyme digestion on the recovered porcine IL-18 target gene, recovering the porcine IL-18 gene subjected to enzyme digestion, and storing in a refrigerator at the temperature of-20 ℃.

1.2.5.3 cleavage and purification of pBapo-EF1alpha _ Pur _ DNA expression plasmid: using restriction endonucleasesBamH I andHindIII the eukaryotic expression plasmid pBapo-EF1alpha _ Pur _ DNA is subjected to enzyme digestion, the vector fragment is recovered, and the vector fragment is stored in a refrigerator at the temperature of-20 ℃ for later use。

1.2.5.4 connection and characterization of eukaryotic expression plasmid pBapo-IL 18: connecting the recovered expression vector with a porcine IL-18 gene, converting the gene into DH5 alpha competence, selecting spots for bacteria liquid PCR identification, and sending positive bacteria liquid to sequencing for further identification.

1.2.6 construction of recombinant transfer plasmid pG-CS-IL18

1.2.6.1 amplification of porcine IL-18 expression cassetteBstAnd z17I enzyme cutting and purification: using primer pBapo (Bstz17I)-F/ pBApo(Bstz17I) -R expression cassette amplification of IL-18. Recovering the complete expression cassetteBstz 17I.

1.2.6.2 method for the recombination of transfer plasmid pG-CSBstAnd z17I enzyme cutting and purification: the transfer plasmid pG-CS was subjected toBstAnd z17I enzyme cutting, dephosphorizing, recovering pG-CS carrier, and storing in refrigerator at-20 deg.C for use.

1.2.6.3 ligation of recombinant transfer plasmid pG-CS-IL 18: and connecting the recovered pG-CS vector with a porcine IL-18 expression cassette, transforming the connection product to DH5 alpha competence, selecting spots for bacteria liquid PCR identification, and sending positive bacteria liquid to sequencing for further identification.

The bacterial liquid of eukaryotic expression plasmid pBapo-IL18 is used as a template to carry out PCR amplification on the porcine IL-18 target gene and the expression cassette. The results showed that specific bands appeared at about 613 bp, 1980 bp, respectively (FIG. 4), consistent with the expected amplified fragment size. Indicating that the porcine IL-18 gene expression cassette is successfully constructed.

1.2.7 endotoxin-free plasmid extraction of recombinant transfer plasmid pG-CS-IL18

And (3) extracting the recombinant transfer plasmid pG-CS-IL18 from the positive bacterium liquid according to the extraction instruction of the OMIGA endotoxin-removing plasmid.

And (3) PCR amplification of a CS epitope region and a porcine IL-18 expression cassette is carried out by taking a bacterial liquid of the recombinant transfer plasmid pG-CS-IL18 as a template. The results showed that specific bands appeared at about 895 bp, 1980 bp, respectively (FIG. 5), consistent with the expected amplified fragment size. And extracting the recombinant plasmid from the positive recombinant bacterial liquid, and sequencing. The sequencing result shows that the recombinant transfer plasmid pG-CS-IL18 is successfully constructed.

1.2.8 rescue of recombinant virus rPRV-PEDV S1-IL18-EGFP

rPRV HN2012-TK^-/gE^-/gI^-Parent strain (10)^-4) Inoculating on ST cells growing up to 80%, 5% CO at 37 ℃₂The incubator was incubated for 2 h and the medium was aspirated off. Cells were washed three times with 2 mL of D-hanks solution per well. Then, the recombinant transfer plasmid pG-CS-IL18 was transfected into ST cells according to the instructions of the cell transfection reagent ZLip 2000. When all cells are desquamated, collecting virus-containing supernatant, and storing in a refrigerator at-80 deg.C for use. One well for normal cells and one well for transfection with only non-inoculated transfection were set as negative controls.

1.2.9 plaque screening and purification of recombinant viruses

The virus supernatants collected above were serially diluted 10-fold with DMEM (10 times)^-1-10^-5) Separately, inoculated into 6-well plates of 80% monolayer ST cells, 5% CO at 37 ℃₂The incubator was discarded after 2 h virus adsorption and washed 3-5 times with D-Hanks, followed by 2 mL of DMEM (2% fetal bovine serum) medium containing 1.3% low melting point nutrient agarose. When the cells are diseased, the green fluorescence condition can be observed, and the diseased focus emitting green fluorescence can be seen. Selecting green fluorescent plaques in the maximum dilution cell wells each time, repeatedly freezing and thawing for three times in a refrigerator at the temperature of minus 80 ℃, and performing proliferation and expansion culture until all plaque strains fluoresce.

rPRV HN2012-TK^-/gE^-/gI^-After the parent strain is infected with ST cells, the recombinant transfer plasmid pG-CS-IL18 with a fluorescent label is transfected into the ST cells, and the collected virus supernatant is inoculated into the cells for plaque purification. After screening and purification of 7 rounds of green fluorescent plaques, all plaque strains fluoresce green (FIG. 6). The recombinant virus containing the target gene is shown to be purified and is named as rPRV-PEDV S1-IL18-EGFP, and is stored at the temperature of minus 80 ℃ for later use.

1.2.10 rescue of recombinant Virus rPRV-PEDV S1-IL18

A CRISPR/Cas9 EGFP knock-out plasmid (PX 459-gRNA1-EZ-gRNA 3-EGFP) was transfected into ST cells. 4h after transfection, the transfection solution was aspirated and washed 3 times with D-Hanks, and the rPRV-PEDV S1-IL18-EGFP strain (10)^-4) Inoculation ofOn 6-well plate monolayer ST cells, 5% CO at 37 ℃₂And (3) after the incubator is incubated for 2 h, absorbing the virus adsorption solution, adding 2% serum DMEM cell maintenance solution, and collecting virus-containing supernatant to store in a refrigerator at the temperature of minus 80 ℃ for later use when all cells fall off. One well for normal cells and one well for transfection with only non-inoculated transfection were set as negative controls.

1.2.11 plaque screening and purification of recombinant viruses

The collected virus supernatant was serially diluted 10-fold, and then inoculated with ST cells for plaque assay, and lesions without green fluorescence were screened. And selecting the plaque which does not emit green fluorescence in the maximum dilution cell hole each time, carrying out proliferation and amplification culture, and carrying out 5-8 rounds of purification and screening until all plaque strains do not emit fluorescence. Randomly picking out non-fluorescent plaques, extracting virus DNA, and amplifying a CS epitope region and a porcine IL-18 gene by PCR.

The CRISPR/Cas9 EGFP knock-out plasmid is firstly transfected to ST cells, then the rPRV-PEDV S1-IL18-EGFP strain is infected, and the collected virus supernatant is inoculated to the cells for plaque purification. The target strains with EGFP green fluorescence labels successfully knocked out are screened reversely, and all the plaque strains do not fluoresce after 5 rounds of screening and purification without green fluorescence plaques (figures 7 and A, B are pictures observed under white light and exciting light respectively). Then 10 fluorescent plaques are randomly picked, viral DNA is extracted, the CS epitope region and the porcine IL-18 gene are amplified by PCR, and the result shows that specific bands appear at about 895 bp and 613 bp respectively (figure 8 and figure 9) and are consistent with the size of an expected amplified fragment, which indicates that the recombinant virus is purified cleanly and is named as rPRV-PEDV S1-IL18 and is stored at-80 ℃ for later use.

1.2.12 transcription and expression characterization of the CS epitope region and porcine IL-18 of recombinant viruses

Inoculating the recombinant virus rPRV-PEDV S1-IL18 to Vero cells which are full and single-layered, scraping the cells when 80% of the cells are diseased, extracting the total RNA (and removing DNA genome) by a TRlzon method, carrying out reverse transcription into cDNA according to the instructions of a reverse transcription Kit (HiScript II 1st Strand cDNA Synthesis Kit), and detecting a CS target gene and a pig IL-18 gene by PCR amplification. In addition, the recombinant virus rPRV-PEDV S1-IL18 is inoculated to a full monolayer of ST cells, when 80% of the cells are diseased, repeated freeze thawing is carried out, centrifugation is carried out for 5 min at 8000 rpm, supernatant fluid is taken, supernatant protein is concentrated, protein loading buffer solution is added, boiling is carried out for 10 min, and Western blot identification is carried out. The rabbit anti-PEDV protein and the rabbit anti-porcine IL-18 serum were used as primary antibodies (1: 200 dilution), and horseradish peroxidase (HRP) -labeled goat anti-rabbit IgG was used as a secondary antibody (1: 5000 dilution), respectively, and the color was developed with DAB kit.

The total RNA of the recombinant virus rPRV-PEDV S1-IL18 inoculated with Vero cells is extracted, the virus DNA genome is removed, the total RNA is reversely transcribed into cDNA, a CS epitope region is amplified by PCR, and the result shows that a specific band appears at about 895 bp (figure 10), which indicates that the CS region segment is successfully transcribed. In addition, the porcine IL-18 gene was PCR-amplified, and the result showed that a specific band appeared at about 613 bp (FIG. 11), indicating that the porcine IL-18 was successfully transcribed.

After the recombinant virus rPRV-PEDV S1-IL18 is inoculated to ST cells to generate lesions, repeated freeze thawing is carried out, supernatant protein is concentrated, and rabbit-derived PEDV-resistant S protein is used as primary antibody to carry out Western blot identification, and the result shows that a specific band (figure 12) exists at 32.2 kDa, and the expected sizes are consistent, which indicates that the CS protein of the recombinant virus rPRV-PEDV S1-IL18 can be successfully expressed.

After the recombinant virus rPRV-PEDV S1-IL18 is inoculated to Vero cells to generate lesions, repeated freeze thawing is carried out, supernatant protein is concentrated, rabbit source anti-pig IL-18 serum is used as a primary antibody to carry out Western blot identification, the result shows that a specific band (figure 13) exists at a position of about 23 kDa, and the specific band is consistent with the expected size, which indicates that the pig IL-18 protein of the recombinant virus rPRV-PEDV S1-IL18 can be successfully expressed in the Vero cells.

The parent strain adopted in the test is a mutant strain PRV/HN2012 strain (CCTCC NO. V201314) separated from a pig farm in which PRV is outbreak in 2012, and a pseudorabies virus attenuated strain obtained by deletion of genes gI, gE and TK of the mutant strain is used as a live virus vector, so that the test has important significance for the prevention and control of the currently epidemic PRV.

The S protein of PEDV is a type I membrane glycoprotein that is essential for the virus to enter the host cell. Studies have shown that the neutralizing epitope is mainly located in S1, and that 4 major neutralizing epitopes (aa 499-, 638, 748-, 771, and 1368-1374) have been demonstrated to be present on the surface of the PEDV S protein. PEDV S protein or truncated S gene expressed by virus as vector shows potential in developing subunit vaccine against PEDV. The CS epitope region of PEDV selected in the test contains the first three main neutralizing epitopes of the S gene, and is used for constructing a recombinant live vector vaccine.

In this experiment, we first extracted total RNA from pig blood, amplified the pig IL-18 gene, and then added primers at both endsBamH I andHindIII enzyme cutting site, inserting the enzyme cutting site into eukaryotic expression plasmid pBapo-EF1alpha _ Pur _ DNA of mammal, and introducing KozaK sequence (GCCACC) in front of the porcine IL-18 sequence to enhance the expression of the porcine IL-18 protein. And amplifying a porcine IL-18 expression cassette from the vector, wherein an EF1alpha promoter is used in the expression cassette, and the promoter is not easy to inactivate, has good stability, is not limited by a cell cycle and is beneficial to stable transcription of an exogenous gene.

The test selects the gG glycoprotein of PRV as the insertion site. The gG gene encodes a non-essential glycoprotein of the virus, and deletion of this gene has no effect on viral proliferation. The gG glycoprotein is an early viral protein expressed from one of the strongest PRV promoters. The gG promoter is commonly used to drive the expression of foreign proteins. Therefore, this study utilized the gG promoter to express the CS epitope region of PEDV by deleting 416 bp from the gG gene. The pG transfer vector used in the experiment is a gene containing a left homology arm gD gene and a right homology arm PK gene constructed in the laboratory, a target gene is inserted into a PRV genome by using a homologous recombination method, and the occurrence principle of the homologous recombination is consistent with the research of Pfion. Through multiple test optimization, the result shows that 10 times of the test is firstly carried out⁴And (3) inoculating the ST cells for 2 h by 100 mu L of PRV virus, then transfecting the constructed recombinant transfer plasmid pG-CS to the cells for 4h, and after the cytopathic effect is completed, harvesting virus liquid, wherein the homologous recombination achieves the highest efficiency, and the screening and purification of the virus are facilitated. In the reverse screening process, namely when the EGFP fluorescent label is knocked out, a CRISPR/Cas9 EGFP knock-out plasmid (PX 459-gRNA1-EZ-gRNA 3-EGFP) is firstly transfected into an ST cell to express the Cas9 protein, then the ST cell is inoculated with a recombinant virus rPRV-PEDV S1-IL18-EGFP with a green fluorescent label, and at the moment, the expressed Cas9 protein can increase the EGFP fluorescence labelSynchronous knockout is carried out on the green fluorescent label of the cloned recombinant virus, and the maximum knockout efficiency is achieved. The EGFP green fluorescent label is only used as a screening marker, and after a target gene is recombined on a PRV genome, the label is knocked out, so that the problems of food safety and the like caused by immunization of animals by the recombinant virus are avoided, and the biological safety of the recombinant virus is improved.

The PRV genome has large capacity and can be inserted by exogenous genes, so the PRV vector shows good superiority in the aspects of gene expression, live vector vaccine development, drug screening and the like. The experiment successfully constructs rPRV-PEDV S1-IL18 which expresses CS protein of a PEDV neutralization epitope region and porcine IL-18. After the PRV recombinant virus is used for immunizing animals, immune system presenting reaction which is very close to a natural infection mode can occur in the bodies of the animals, and after the animals are immunized, the bodies can be stimulated to generate humoral immunity and cellular immunity and mucosal immunity of the bodies to a certain extent, so that the research on the PRV recombinant vaccine with multiple genes can better serve the pig industry, and better economic benefit is brought. Meanwhile, by utilizing the characteristic that the stimulation of the PRV on an immune system is close to natural infection and combining with the modern immune labeling technology, the recombinant PRV is likely to play more and more important roles in the fields of immune mechanisms and the like in the future.

Example 2: biological Properties of recombinant Virus rPRV-PEDV S1-IL18

1 materials and methods

1.1 materials

1.1.1 cells, strains and plasmids

ST passage cell, PK-15 passage cell, IPEC passage cell, Vero passage cell, parent strain rPRV HN2012-TK^-/gE^-/gI^-The PEDV variant CH-HNKF-2016 and the PRV epidemic variant PRV/HN2012 are stored in a pig major epidemic disease prevention and control key laboratory in Zhengzhou city; the recombinant virus rPRV-PEDV S1-IL18 was purified from assay one construct and stored.

1.1.2 Primary reagents and instruments

Reagents and instrumentation were the same as in test one.

1.2 methods

1.2.1 culture Properties of recombinant viruses on different cells

The recombinant virus rPRV-PEDV S1-IL18 is inoculated with ST, PK-15, Vero and IPEC cells respectively, and cytopathic effect is observed at 6 h, 12 h, 24 h and 36 h after inoculation.

The recombinant virus rPRV-PEDV S1-IL18 was inoculated to ST cells and then the cytopathic condition was observed. No obvious cytopathic effect was observed between 0 h and 6 h. At 12 h, a large number of cells become round, the cell gaps are not obvious, and the cell contour disappears. After 24 h the cells were rounded and crimped. After 36 h, cytopathy was evident, and cells became large, round and shed to fragmentation (FIG. 14).

1.2.2 recombinant Virus TCID on different cells₅₀Measurement of

The recombinant virus rPRV-PEDV S1-IL18 was inoculated to ST, PK-15, Vero and IPEC cells, respectively, and continuously transmitted for 3 generations. After the virus is stably proliferated, culturing the virus on different cells for 36 h, and respectively measuring the TCID of the recombinant virus₅₀Calculation of Virus TCID Using Karber method₅₀The titer.

The recombinant virus rPRV-PEDV S1-IL18 was inoculated to PK-15 cells to observe cytopathic condition. No cytopathic effects were observed between 0 h and 6 h. At 12 h all the cell gaps were not evident and the cell contours disappeared. After 24 h the cells were rounded and crimped. After 36 h, cytopathic effect was evident, and the cells became enlarged, rounded and exfoliated (FIG. 15).

And (3) inoculating the recombinant virus rPRV-PEDV S1-IL18 into Vero cells, and observing the cytopathic condition. No cytopathic effects were observed between 0 h and 6 h. The cell was vacuolated at 12 h. After 24 h, the cells become round and shrink, and syncytia all appear. After 36 h, cytopathy was evident, and cells became large, round and shed to rupture (FIG. 16).

Cytopathic condition was observed after inoculation of IPEC cells with recombinant virus rPRV-PEDV S1-IL 18. Slight cytopathic effects began to appear at 0 h to 6 h. At 12 h, the cells become vacuous, round and shriveled. After 24 h, cytopathic effect was evident, and the cells became large, round and exfoliated (FIG. 17).

As shown in Table 2, TCID₅₀The assay results showed that the most proliferating cells of the recombinant virus rPRV-PEDV S1-IL18 were ST cells, followed by PK-15 cells and Vero cells, and were the least sensitive on IPEC cells. The results show that ST cells are more suitable for recombinant virus rPRV-PEDV S1-IL18 proliferation culture.

TABLE 2 TCID of recombinant virus rPRV-PEDV S1-IL18 on different cells₅₀Measurement results

1.2.3 one-step growth curves of recombinant viruses

According to the literature (Trapp, S. mutagenetics of a bone science type 1 genetic bound as an infectious bacterial organism: analysis of Glycoprotein E and G double deletion mutants [ J]Journal of General Virology, 2003, 84(2): 301-306.) the one-step growth curve of the recombinant virus rPRV-PEDV S1-IL18 was determined. rPRV-PEDV S1-IL18 and rPRV HN2012-TK^-/gE^-/gI^-Respectively at 10 μ L (10)^6.0TCID₅₀/100. mu.L) were inoculated into 12-well plates, virus solutions were collected at 0 h, 2 h, 4h, 6 h, 8 h, 12 h, 18 h, 24 h, 30 h and 36 h after inoculation, and recombinant virus rPRV-PEDV S1-IL18 and parental strain rPRV HN2012-TK were determined separately^-/gE^-/gI^-TCID of₅₀And drawing a one-step growth curve graph.

rPRV-PEDV S1-IL18 and rPRV HN2012-TK^-/gE^-/gI^-Inoculating ST cells, collecting

virus solution

0 h, 2 h, 4h, 6 h, 8 h, 12 h, 18 h, 24 h, 30 h and 36 h after inoculation, and determining TCID₅₀A one-step growth graph is plotted (fig. 18). The results showed that the recombinant viruses rPRV-PEDV S1-IL18 and rPRV HN2012-TK in the period of 4-8 h^-/gE^-/gI^-All increase exponentially, slowly increase in 8-24 h, and the virus titer reaches the highest in 24 h. Recombinant viruses rPRV-PEDV S1-IL18 and rPRV HN2012-TK^-/gE^-/gI^-The virus titer has similar increasing trend, which indicates that the insertion of the foreign gene does not influence the proliferation of the virus vector.

1.2.4 detection of physicochemical Properties of recombinant viruses

Detecting ultraviolet sensitivity, formaldehyde sensitivity, high temperature sensitivity, acid sensitivity and alkali sensitivity of recombinant virus rPRV-PEDV S1-IL18Sex, ether sensitivity and chloroform sensitivity. A100-L tube of rPRV-PEDV S1-IL18 virus solution 8 was used for the following procedures: irradiating with ultraviolet for 30 min; adding formaldehyde to a final concentration of 0.15%, and standing at 37 deg.C for 24 h; water bath is carried out for 1 h at the temperature of 60 ℃; adjusting the pH value to 3.037 ℃, standing for 1 h and then adjusting the pH value to 7.0; adjusting the pH value to 11.037 ℃, standing for 1 h and then adjusting the pH value to 7.0; adding diethyl ether with a final concentration of 20%, and standing at 4 deg.C for 24 h; adding chloroform with final concentration of 4.8%, and standing for 30 min. The TCID of the treated recombinant virus rPRV-PEDV S1-IL18 was then determined₅₀。

The recombinant virus rPRV-PEDV S1-IL18 lost infectivity after inactivation (Table 3) as follows: adding formaldehyde to a final concentration of 0.15%, and standing at 37 deg.C for 24 h; water bath is carried out for 1 h at the temperature of 60 ℃; adjusting the pH value to 3.037 ℃, standing for 1 h and then adjusting the pH value to 7.0; adjusting the pH value to 11.037 ℃, standing for 1 h and then adjusting the pH value to 7.0; adding diethyl ether with a final concentration of 20%, and standing at 4 deg.C for 24 h. The recombinant virus rPRV-PEDV S1-IL18 is partially inactivated after being treated by ultraviolet irradiation for 30 min, and most of the virus is inactivated after being treated by chloroform (4.8%) for 30 min.

TABLE 3 physicochemical Properties of recombinant Virus rPRV-PEDV S1-IL18

1.2.5 genetic stability of recombinant viruses

The recombinant virus rPRV-PEDV S1-IL18 is continuously passaged for 20 generations, virus DNA of 5 th generation, 10 th generation, 15 th generation and 20 th generation is extracted, a CS epitope region and a porcine IL-18 gene are subjected to PCR amplification and are sequenced, and whether a target gene on the recombinant virus is mutated or not is detected on a molecular level.

Viral DNA of recombinant virus rPRV-PEDV S1-IL18 at 5 th, 10 th, 15 th and 20 th generations was extracted, and the CS epitope region and the porcine IL-18 gene were amplified by PCR and sequenced, showing that no base mutation, deletion or insertion occurred (FIGS. 19 and 20).

1.2.6 safety testing of recombinant viruses

5 female Kunming mice with the age of 6 weeks were inoculated with the recombinant virus rPRV-PEDV S1-IL18, and the safety of the recombinant virus rPRV-PEDV S1-IL18 to the mice was evaluated.

Mice within two weeks after inoculation of the recombinant virus rPRV-PEDV S1-IL18 did not have any itching symptoms, were fed normally, and did not respond to stress, indicating that the recombinant virus rPRV-PEDV S1-IL18 is safe for the mice.

Growth characteristics of recombinant virus rPRV-PEDV S1-IL18 were determined on ST cells, PK-15 cells, IPEC cells, Vero cells, and at 0 h to 6 h the virus was in the initial stage of adsorption, penetration, uncoating, and replication, and no significant cytopathic effect was observed. At 6-12 h, the virus begins to replicate exponentially, a large number of cells become round, the cell gaps are not obvious, the cell contour disappears, and the cells become round and shrink. After 36 h, the virus is released, the cytopathic effect is obvious, and the cells fall off to be broken, thereby conforming to the general property of the pseudorabies virus. The result of the one-step growth curve shows that the virus titer can reach the highest after the recombinant virus is inoculated for 24 hours, and the recombinant virus rPRV-PEDV S1-IL18 and the parent strain rPRV HN2012-TK^-/gE^-/gI^-The virus titer has similar increasing trend, which indicates that the insertion of the foreign gene does not influence the proliferation of the virus vector.

TCID determined on ST cells by recombinant virus rPRV-PEDV S1-IL18₅₀The result was 10^7.875and/mL. Parent strain rPRV HN2012-TK^-/gE^-/gI^-TCID of₅₀The result was 10^7.375mL, recombinant Virus TCID of this assay₅₀The higher the result compared with the parent strain, it is possible that the virus is adapted to cell proliferation by continuous passage, and the genetic character of the recombinant virus is stable. The proliferation titer of the recombinant virus rPRV-PEDV S1-IL18 on ST cells, Vero cells, PK-15 cells and IPEC cells is gradually reduced, which shows that the ST cells are more suitable for the proliferation culture of the recombinant virus rPRV-PEDV S1-IL18 and are used for preparing candidate vaccine strains.

The results of physicochemical properties of the recombinant virus rPRV-PEDV S1-IL18 show that the recombinant virus is sensitive to formaldehyde with a final concentration of 0.15%, high temperature of 60 ℃, pH adjusted to 3.0 or 7.0, diethyl ether with a final concentration of 20% and chloroform with a final concentration of 4.8%, and most virus particles lose infectivity after treatment. After the recombinant virus rPRV-PEDV S1-IL18 is treated for 30 min by ultraviolet irradiation, the virus is partially inactivated and still has infectivity. This is consistent with the physico-chemical properties of pseudorabies virus mentioned in the literature, indicating that the recombinant virus rPRV-PEDV S1-IL18 conforms to the general properties of pseudorabies virus.

The recombinant virus rPRV-PEDV S1-IL18 is continuously passaged for 20 generations, virus DNA of 5 th, 10 th, 15 th and 20 th generations is extracted, and a CS epitope region and a porcine IL-18 gene are sequenced, so that the results show that no base mutation, deletion and insertion occur, and the genetic stability is good. Animal safety tests are carried out on the recombinant virus, mice immunized within two weeks do not have any itching symptom, are normally fed, have no stress reaction, and are healthy, so that the safety of the recombinant virus is good, and the recombinant virus accords with the excellent characteristics of vaccine strains.

In conclusion, the recombinant virus rPRV-PEDV S1-IL18 conforms to the general biological characteristics of pseudorabies viruses, the insertion of foreign genes can be stably expressed, the genetic stability is good, and the recombinant virus rPRV-PEDV S1-IL18 is expected to become a vaccine candidate strain.

Example 3: immunoassay research of recombinant virus rPRV-PEDV S1-IL18 in pigs

1 materials and methods

1.1 materials

1.1.1 cells, strains and vaccines

ST cells, Vero passage cells, PEDV variant strain CH-HNKF-2016, PRV variant strain PRV/HN2012(CCTCC NO. V201314) and recombinant pseudorabies virus rPRV-PEDV S1, wherein the classification name of the strain is rPRV-PEDVS1, and the preservation number is as follows: CCTCC NO: v201750, date of deposit: 31/10/2017, deposited in the China center for type culture Collection with the address: wuhan, Wuhan university. The rPRV-PEDV S1-IL18 strain was constructed by test one; PEDV inactivated vaccine (PEDV-TGEV bivalent inactivated vaccine, including PEDV AJ1102 strain) was purchased from Wuhan Kogyo. PRV BarthaK61 attenuated vaccine was purchased from Nobewei Biotechnology Inc., Zhejiang.

1.1.2 Experimental animals

Healthy piglets of 2 weeks were purchased from a pig farm in Henan.

1.1.3 Primary reagents and instruments

ELISA antibody detection kit (IgG) for porcine epidemic diarrhea (indirect method) was purchased from Wuhanke department, Projet Limited; DMEM was purchased from wuhan doctor de bioengineering, ltd; fetal bovine serum was purchased from Hangzhou Biotechnology GmbH, Zhejiang.

1.2 methods

1.2.1 piglet immunization test

24 healthy piglets aged 2 weeks were randomly divided into 5 groups, and the specific groups and inoculation of the experiment are shown in table 4. The inoculation route is subcutaneous split-point injection at the back, and the clinical reaction condition of the piglets is observed and recorded every day after immunization. Collecting blood of ear vein of piglets before and after immunization every week until 4 weeks, separating serum, and storing at-20 deg.C.

TABLE 4 grouping of piglets and immunization profiles

1.2.2 serum ELISA assay for PEDV

Taking weekly piglet serum, adopting a porcine epidemic diarrhea ELISA antibody detection kit, and detecting the porcine serum anti-PEDV antibody according to the kit specification.

1.2.3 serum neutralization assay of PRV

Weekly piglet sera were taken and subjected to PRV serum neutralization assay, and the anti-PRV antibody levels in the piglet sera of the rPRV-PEDVS1 group, the rPRV-PEDV S1-IL18 group, the Bartha K61 vaccine group and the DMEM cell culture medium (negative control) group were measured by the fixed virus dilution serum method. The method comprises the following specific steps:

the serum is inactivated in 56 ℃ water bath for 30 min, and diluted by 2 times in series to obtain 1:2, 1:4, 1:8, 1:16, 1:32, 1:64, 1:128, 1:256, 1:512 and 1:1024 dilutions. Different dilutions of serum were combined with 200 TCID₅₀PRV virulent strains are mixed at a ratio of 1:1 and are induced at 37 ℃ for 1 h. Then added to a 96-well Vero cell plate grown to a monolayer, adsorbed for 2 h, and then changed to a virus maintenance solution, 4 replicates for each dilution. The culture was continued for 72 hours, and the half protection amount (PD) of the neutralization test was determined and calculated by the Karber method₅₀). The calculation formula is as follows: log50% neutralization titers = L + d (S-0.5), where L = Log of lowest dilution, d = difference between Log of dilutions, S is the sum of the protection rates of the groups, then calculatedAnd potency.

The piglet serum collected weekly was subjected to detection of anti-PEDV antibodies using PEDV ELISA antibody detection kit (IgG), and the anti-PEDV antibody levels in the piglet serum of the rPRV-PEDVS1 group, the rPRV-PEDV S1-IL18 group, the PEDV inactivated vaccine group and the DMEM group were evaluated. The results showed that antibodies were produced 7 d after immunization in the rPRV-PEDV S1-IL18 group, the rPRV-PEDVS1 group and the PEDV inactivated vaccine group (FIG. 21), and the antibodies produced in 7-28 d were gradually increased. The antibody level generated by the PEDV inactivated vaccine group is slightly higher than that of the rPRV-PEDVS1 and rPRV-PEDV S1-IL18 in the test group, and the difference is not significant (P>0.05). In addition, the antibody level produced by the rPRV-PEDV S1-IL18 in the test group was slightly higher than that in the rPRV-PEDVS1 group.

PRV serum neutralization tests were performed on weekly-collected swine serum by the fixed virus dilution serum method to evaluate the anti-PRV antibody levels in swine serum of the rPRV-PEDVS1 group, the rPRV-PEDV S1-IL18 group, the Bartha K61 vaccine group and the DMEM group. The results show that the rPRV-PEDV S1-IL18 group, the rPRV-PEDVS1 group and the Bartha K61 vaccine group can generate neutralizing antibodies at 7 d after immunization (FIG. 22), the level of the neutralizing antibodies generated at 14-21 d is obviously increased, and the level of the neutralizing antibodies generated at 21-28 d is slowly increased. The rPRV-PEDV S1-IL18 group produced slightly higher levels of neutralizing antibodies than the rPRV-PEDVS1 and Bartha K61 vaccine groups. In addition, there was no significant difference in the levels of antibody produced by the rPRV-PEDVS1 group and Bartha K61 group (R) ((R) ())P>0. 05)。

1.2.4 challenge protection test

4 weeks after immunization, 3 piglets of rPRV-PEDV S1 group, rPRV-PEDV S1-IL18 group, PEDV inactivated vaccine group and DMEM group were used respectively^7.0 TCID₅₀PEDV variant CH-HNKF-2016 was used for challenge-protection experiments, and 4 mL of virus culture was orally administered to each piglet. For the rest pig 10⁴ TCID₅₀The PRV variant PRV/HN2012 was subjected to challenge protection test, and each piglet was injected with 1 mL of the vaccine at multiple points on the back. After the toxin is attacked, the pigs are observed daily for mental changes, body temperature changes, food intake, vomiting, diarrhea, cough and other conditions, and death conditions.

4 weeks after immunization, 4 mL10 was used^7.0 TCID₅₀PEDV variant CH-HNKF-2016 on recombinant virus rPRV-PEDV S1 group, rPRV-PEDV S1-IL18 group, PEDV inactivated vaccineThe piglets in the vaccine group and the DMEM group are subjected to the challenge protection test. Oral administration of 4 mL10^7.0 TCID₅₀After 24 h of PEDV CH-HNKF-2016 virus culture, the DMEM group had 2 piglets with mild diarrhea, lassitude and anorexia, and then the other piglets of the DMEM group began to get ill with the incidence rate of 100%. With the time being prolonged, the clinical symptoms become more serious, and symptoms such as watery diarrhea, serious anus and hind limb excrement pollution, limb weakness, unstable standing, rough fur, no luster and the like appear. In 14d of PEDV culture taken orally, 1 pig died in the DMEM group, and 2 piglets gradually recovered. Dead pigs were dissected and found to have a thin, clear, bleeding intestinal wall, which was filled with gas and contained a large amount of yellow contents. And piglets immunized by the rPRV-PEDV S1, the rPRV-PEDV S1-IL18 and the PEDV inactivated vaccine group have normal appetite and good mental state.

After 4 weeks of immunization, 1 mL of 10 was used⁴ TCID₅₀The PRV variant PRV/HN2012 performs a challenge protection test on piglets of a recombinant virus rPRV-PEDV S1 group, an rPRV-PEDV S1-IL18 group, a BarthaK61 vaccine group and a DMEM group. After 96 hours of attack of PRV/HN2012 strains, 2 piglets in the DMEM group have neurological symptoms, diarrhea, vomiting and the like which begin to appear first, and 1 other piglets in the DMEM group have diseases successively with the incidence rate of 100 percent. Within 14 days of toxin attacking, 2 piglets die in the DMEM group, and 1 piglet gradually recovers. After 120 hours of attack on PRV/HN2012 strains, one piglet of the BarthaK61 vaccine group starts to have PR clinical symptoms such as neurological symptoms, diarrhea, vomiting and the like, and then recovers, and other 2 piglets grow healthily in an observation period of 4 weeks with the morbidity rate of 25%. And the piglets immunized by the rPRV-PEDV S1 and the rPRV-PEDV S1-IL18 have no morbidity within 2 weeks of the challenge of the PRV HN2012 strain.

1.2.5 statistical analysis

The data were statistically analyzed and plotted using GraphPad Prism 7.0 software,Pa value of less than 0.05 is significant,Pvalues less than 0.01 are of great significance.

The effective strategy for preventing and controlling PED is to carry out immunization vaccine on pigs, and currently, widely used PEDV vaccines comprise inactivated vaccine, attenuated vaccine, genetic engineering vaccine, combined vaccine and the like, wherein the combined vaccine of porcine epidemic diarrhea-porcine transmissible gastroenteritis combined vaccine, porcine epidemic diarrhea-porcine transmissible gastroenteritis-porcine rotavirus combined vaccine and the like can achieve the purpose of one-time prevention and multiple-prevention. The live vaccine can induce an organism to generate secretory IgA, mainly depends on mucosal immunity, and provides comprehensive protection for virus virulent attack. Novel genetically engineered vaccines such as live vector vaccines expressing foreign genes and the like have become hot spots of current research.

In the test, recombinant viruses rPRV-PEDVS1 and rPRV-PEDV S1-IL18, PEDV inactivated vaccine, BarthaK61 attenuated vaccine and DMEM which are obtained by early purification and express the PEDV S1 neutralizing epitope region CS are respectively inoculated to healthy piglets with the age of 2 weeks, then ELISA antibodies for resisting PEDV and neutralizing antibodies for resisting PRV are determined, and PEDV and PRV challenge-protection tests are respectively used for evaluating the safety and the immune efficacy of the recombinant virus rPRV-PEDV S1-IL 18. The result shows that the recombinant virus rPRV-PEDV S1-IL18 is safe and effective for piglets and can induce the piglets to generate specific immune response against PRV and PEDV.

ELISA detection results show that the rPRV-PEDV S1-IL18 of the test group generates slightly higher level of anti-PEDV antibody than the rPRV-PEDV S1 group. The results of the neutralization test show that the test group rPRV-PEDV S1-IL18 produces the anti-PRV neutralizing antibody with higher level than the recombinant virus rPRV-PEDV S1 group and BarthaK61 attenuated vaccine^-. The porcine IL-18 cytokine has a certain immunity enhancing effect, can be used as a vaccine adjuvant, and has a good application prospect. Although the antibody level generated against PEDV was lower than that of the PEDV inactivated vaccine group (PEDV-TGEV bivalent inactivated vaccine), the difference was not significant (P>0.05), which is consistent with the research result of the Nie Min financial affairs. Neutralization test results based on PRV-specific antibodies showed that all test groups produced low levels of antibodies two weeks after immunization, followed by a significant increase in neutralizing antibody levels and a slow increase in 21-28 d antibody levels. There was no significant difference in antibody levels produced between the experimental group and the BarthaK61 attenuated vaccine group: (P>0.05), indicating that the foreign antigen CS epitope region and porcine IL-18 insertion did not affect PRV immunogenicity, consistent with the results of the ZHENG et al study.

The result of toxicity attack protection shows that 4 mL10 is used^7.0 TCID₅₀After PEDV variant CH-HNKF-2016 is orally taken, DMEM group is generated after 24 hThe piglets with slight diarrhea, lassitude, anorexia and other symptoms are treated, one pig in 14 days is dead, 2 piglets are gradually recovered, and the piglets immunized by the rPRV-PEDV S1, the rPRV-PEDV S1-IL18 and the PEDV inactivated vaccine group have normal appetite and good mental state. Using 1 mL of 10⁴ TCID₅₀After the PRV variant PRV/HN2012 was attacked, the DMEM group piglets started to have nervous symptoms, diarrhea, vomiting and the like in 4d, 2 piglets died within 2 weeks, and 1 piglet gradually recovered. One piglet developed after 120 h in the BarthaK61 attenuated vaccine group, and recovered later, and the other 2 piglets did not develop the disease. And the piglets immunized by the rPRV-PEDV S1 and the rPRV-PEDV S1-IL18 have no morbidity within 2 weeks of the challenge of the PRV HN2012 strain. Indicating rPRV HN2012-TK^-/gE^-/gI^-The vector is used as a live vector, has complete protective power on a PRV variant PRV/HN2012, and has no influence on a parent strain due to the insertion of a foreign gene.

In conclusion, the piglet immunized with the recombinant virus rPRV-PEDV S1-IL18 can obtain immunity equivalent to that of PEDV inactivated vaccine and BarthaK61 attenuated vaccine, can protect the piglet from being attacked by PEDV variant strains and PRV variant strains, and has complete protection on both the PEDV and the PRV variant strains. Therefore, the recombinant virus rPRV-PEDV S1-IL18 is expected to become a bivalent attenuated vaccine candidate strain for preventing and treating PEDV and PRV, provides a powerful tool for effectively preventing and purifying PEDV and PRV, and lays theoretical and technical support for the research and development of gene engineering live vector vaccines.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

<110> Henan university of agriculture

<120> recombinant porcine pseudorabies virus strain simultaneously expressing PEDV variant strain S1 gene CS region and porcine IL-18 and application thereof

<141> 2021-07-29

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 895

<212> DNA

<213> PEDV variant CH-HNKF-2016(Sus)

<400> 1

gaggatccat ggttactttg ccatcattta atgatcattc ttttgttaac attactgtct 60

ctgcgtcctt tggtggtcat agtggtgcca accttattgc atctgacact actatcaatg 120

ggtttagttc tttctgtgtt cacactagac aatttaccat ttcactgttt tataacgtta 180

caaacagtta tggttatgtg tctaactcac aggacagtaa ttgccctttc accttgcaat 240

ctgttaatga ttacttgtct tttagtaaat tttgtgtttc caccagcctt ttggctagtg 300

cctgtaccat agatcttttt ggttaccctg agtttggtag tggtgttaag tttgcgtccc 360

tttactttca attcacaaag ggtgagttga ttactggcac gcctaaacca cttgaaggtg 420

tcacggacgt ttcttttatg actctggatg tgtgtaccaa gtataatatc tatggcttta 480

aaggtgaggg tattattacc cttacaaatt ctagcttttt ggcaggtgtt tattacacat 540

ctgattctgg acagttgtta gcctttaaga atgtcactag tggtgctgtt tattctgtta 600

cgccatgttc tttttcagag caggctgcat atgttgatga tgatatagtg ggtgttattt 660

ctagtttgtc taactccact tttaacagta ctagggagtt gcctggtttc ttctaccatt 720

ctaatgatgg ctctaattgt acagagcctg tgttggtgta tagtaacata ggtgtttgta 780

aatctggcag tattggctac gtcccatctc agtctggcca agtcaagatt gcacccacgg 840

ttactgggaa tattagtatt cccaccaact ttagtatgag tatttgagga tccgc 895

<210> 2

<211> 1500

<212> DNA

<213> variant PRV/HN2012 Strain (Sus)

<400> 2

atgaagtggg caacgtggat cctcgccctc gggctcctcg tggtccgcac cgtcgtggcc 60

agagaggccc ctcgggagct ctgctacggc caccccgtcc acgacgaccg gcggcccgtc 120

gggcccgcga ccgacgccca gcccgtgaac ccgctcgccc ccgccaacgc caccgggacg 180

gactactctc gcggctgcga gatgcgcctc ctggatccgc ctctcgacgt atcgtcccgc 240

tcctcggacc ccgtcaacgt gaccgtcgcc tggttctttg acggcggcca ctgcaaggtg 300

cccctcgtcc accgcgagta ctacggctgc cccggggacg ccatgccctc cgtcgagacg 360

tgcaccggcg ggtactcgta cacccgcacg cgcatcgaca ccctgatgga gtacgccctc 420

gtgaacgcca gcctcgtgct gcagcccggg ctgtacgacg ccggcctgta catcgtcgtg 480

ctcgtctttg gcgacgacgc ctacctcggc accgtctccc tgtcggtgga ggccaacctg 540

gactacccct gcggcatgaa gcacgggctc acgatcaccc gccccggggc caccctccca 600

cccatcgccc ccacggccgg cgaccaccag cgctggcgcg ggtgcttccc ctcgaccgac 660

gagggcgcct gggagaacgt gaccgccgcc gagaagggcc tgtccgacga ctacgccgac 720

tactacgacg tgcacatctt ccgcctggag tctgacgacg aggtcgtcca cggcgatgcc 780

cccgaggccc ccgagggcga ggaggtgacc gaggaggagg ccgagctgac ctccagcgac 840

ctcgacaaca tcgagatcga ggtcgtgggc tctcccgccg ctcccgtcga gggcgccggc 900

gacggcgagg aggggcacgg ggacgaggag gacgaggagc tgacctccag cgacctcgac 960

aacatcgaga tcgaggtcgt gggctcgccc gcggccgccc gcttcttcgc cgcctccacc 1020

accccccgcg cccccacccg cgcggccgag atcacgacca tgaccacggt caccaccgtg 1080

cggacgaccg aggaccccag cggcatcacc gactgccgcc ggagcgactt cgtctcgccc 1140

tctgacatct tcgtgacccc caccggcagc cccgccctgc tcctgggctt cctgggcagc 1200

gcgctcgcct cgcgccccct gcacctgacg gccggggaga cggcccagca cgtgcgcgag 1260

gcccagcaga agagccgcca cgcccgctcc ctcggcggcc tccagctctc ggtcgagacc 1320

gagaccacca acaccaccac cacccagacg ggcctgtcgg gcgacatccg cacctcgatc 1380

tacatctgcg tcgccctcgc cggcctggtc gtcgtgggca tcgtcatcat gtgcctccac 1440

atggcgatca tcagggcccg ggcccggaac gacggctacc gccacgtggc ctccgcctga 1500

Claims

1. The recombinant porcine pseudorabies virus strain simultaneously expressing the CS region of the PEDV variant strain S1 gene and the porcine IL-18 is classified as rPRV-PEDV S1-IL18, and the preservation number is as follows: CCTCC NO: v201740, date of deposit: 31/10/2017, deposited in the China center for type culture Collection with the address: wuhan, Wuhan university.

2. The recombinant porcine pseudorabies virus strain according to claim 1, characterized in that: the porcine pseudorabies virus strain comprises an S1 gene CS epitope region of a PEDV variant CH-HNKF-2016 and a porcine IL-18 gene.

3. The recombinant porcine pseudorabies virus strain according to claim 2, characterized in that: the sequence of the CS epitope region of the S1 gene of the PEDV variant CH-HNKF-2016 is shown in SEQ ID No. 1.

4. The recombinant porcine pseudorabies virus strain according to claim 1, characterized in that: the recombinant porcine pseudorabies virus strain is a variant strain PRV/HN2012 strain with the preservation number: CCTCC NO. V201314, and a PRV epidemic variant strain three-gene deletion mutant rPRV HN2012-TK obtained by deleting gI, gE and TK genes of the mutant^-/gE^-/gI^-The preservation number is: CCTCC NO. V201748 as a live virus vector.

5. The recombinant porcine pseudorabies virus strain according to claim 4, characterized in that: the recombinant porcine pseudorabies virus strain selects gG glycoprotein of a variant strain PRV/HN2012 strain as an insertion site, fragments of 416 bp in total of 23bp-438bp on a gG gene are firstly deleted, and then a gG promoter is utilized to express a CS epitope region of PEDV.

6. The recombinant porcine pseudorabies virus strain according to claim 5, characterized in that: the gG gene sequence is shown as SEQ ID No. 2.

7. The method of constructing a recombinant porcine pseudorabies virus strain according to any of claims 1 to 6, characterized in that the steps are as follows:

(3) taking pBapo-EF1alpha _ Pur _ DNA plasmid as a template, and taking the primer pair pBapo (pBapo) of the step (1)BstZ17I)-F/pBApo(BstZ17I) -R is used as a primer for amplification and enzyme digestion and pG vector recovery;

(4) connecting the pG vector recovered in the step (2) and the step (3) with the CS region fragment, simply converting to obtain a pBapo-EF1alpha _ Pur _ DNA eukaryotic expression plasmid, and performing enzyme digestion to recover the vector fragment, namely the pG-CS vector;

(5) extracting RNA from pig blood, reverse transcribing to cDNA as template, and using primer pair IL18-, (1)BamH I)F/IL18-(HindIII) using R as primer to make amplification, transformation and screening of positive bacteria, using primer pair pBapo (B)Bstz17I)-F/ pBApo(Bstz17I) -R amplifies an expression cassette of the IL-18 gene, and carries out enzyme digestion and recovery;

8. The construction method according to claim 7, wherein: the CS-F sequence of the primer in the step (1) is GA GGA TCC CTATGGTTACTTTG CATCA, the sequence of the primer CS-R is GC GGA TCC TCAAATACTCATACT, respectively; primer IL18-, (BamH I) the F sequence isGA AGA TCT GCCACCATGGCTGCTGAACCGGAAG, primer IL18-, (HindIII) R sequence isGG GAA TTC GTTCTTGTTTTGAACAG, respectively; primer pBapo (BstZ17I) -F sequence is GTATAC TGA GGCTCCGGTGCCCGT primer pBapo (A)BstZ17I) -R sequence is GTATAC TGA GGCTCCGGTGCCCGT。

9. Use of the recombinant porcine pseudorabies virus strain according to claim 1 for the preparation of a low virulent vaccine against both new porcine epidemic diarrhea and porcine pseudorabies virus.

10. Use according to claim 9, characterized in that: the recombinant porcine pseudorabies virus strain is used as a candidate strain of a novel porcine epidemic diarrhea and porcine pseudorabies bivalent attenuated vaccine.