CN117402902A - Primer composition and application thereof in preparation of T vector - Google Patents

Abstract

The invention provides a primer composition and application thereof in preparing a T vector, wherein the primer composition has 2 complementary sequences pComT-F and pComT-R, and nucleotide sequences of the pComT-F and the pComT-R are respectively shown as SEQ_1 and SEQ_2. The method for preparing the T vector by adopting the primer composition comprises the following steps: two complementary primers form double-stranded DNA with sticky ends after denaturation and annealing, the double-stranded DNA is provided with 2 XcmI enzyme cutting sites, restriction enzyme is used for carrying out enzyme cutting on the vector, the double-stranded DNA formed by the enzyme-cut vector and the primers is connected, and finally competent cells are transformed to obtain a clone body with correct sequence; extracting plasmid from the clone, and cutting by XcmI. The whole process for preparing the T vector has low cost, convenient operation, and the T vector connection efficiency reaches more than 80 percent, even more than 87.5 percent, thereby providing a research foundation for the subsequent molecular cloning, phage antibody library construction and soluble expression vector construction.

Description

Primer composition and application thereof in preparation of T vector

Technical Field

The invention relates to the technical field of plasmid vector construction, in particular to a primer composition and application thereof in preparing a T vector.

Background

The gene cloning method is mainly two methods of homologous recombination and enzyme digestion connection, the homologous recombination has short reaction time (30 min), the success rate is highly favored by scientific researchers, 15-20bp repetition which is the same as that of the two ends of the linearization vector fragment needs to be designed before and after the target gene, the traditional enzyme digestion connection needs to carry out enzyme digestion on the vector and the target gene, and the enzyme digestion connection needs to be carried out overnight after the enzyme digestion for transformation. The T carrier belongs to a gene cloning method of enzyme digestion connection, wherein the T carrier is characterized in that two ends of a linearized carrier are provided with sticky ends T, the T carrier and a target fragment are complementarily paired with each other by A and T-A on two ends under the action of taq DNA polymerase after being subjected to PCR, and the carrier and the target fragment can be well connected under the action of T4 DNA ligase to form circular DNA for transformation. The advantages are that: (1) The primer design is that 15-20bp repetition which is identical to that of the two ends of the linear carrier fragment is not required to be designed, and a primer enzyme cutting site is not required. (2) Directly amplifying target fragments, and not introducing redundant amino acids during protein expression; (3) And during the construction of the gene library, no additional connector is needed, and the PCR amplified product can be directly used for library construction.

At present, reported methods for preparing T vectors are as follows: (1) chemical cleavage; chemical cleavage Using a hot base to cleave the carrier to remove the 5' end A, a T-carrier with a T-sticky end is finally formed (Tian Wenji, yuan Hui, a method for preparing a T-carrier by chemical cleavage [ P ]. CN110129347A. 2019-08-16.). (2) blunt end addition T method; the blunt end addition A is to cut the carrier into blunt ends, and then add dTTP to the blunt end carrier by utilizing the terminal transferase activity of Taq DNA polymerase to form a T carrier. (3) restriction enzyme method. By using a restriction enzyme to cleave the enzyme, the N-modified bases such as XcmI (CCANNNNNNN ∈NNNNTGG), aspEI (GACNNN ∈NNGTC), hphI (GGTGANNNNNNNN ∈), etc. make the cut cohesive end just T, i.e., form a T vector. In the three methods, the restriction enzyme digestion method is most reliable in preparing the T carrier, the DNA is damaged by hot alkali of the chemical cracking method, the flat end and the T method cannot ensure that the T can be added to the flat end of each carrier, and the restriction enzyme digestion method directly obtains the T carrier after enzyme digestion, so that the operation is convenient. However, the existing restriction enzyme method has the following defects: 1) The enzyme digestion efficiency is low, the enzyme digestion time is not easy to control, the plasmid can not be completely cut off too short, and the star activity is easily caused too long. 2) The false positives are high and the direction of insertion of the fragment of interest into the T vector cannot be resolved. 3) The obtained T vector also has self-connection phenomenon.

In addition, yuan Hui et al (Yuan Hui, tian Wenji, a preparation method of T vector [ P ]. CN109266672A.2019-01-25.) have developed a new preparation method of T vector, which belongs to an improved method of blunt end addition T method, specifically, a linearization vector is amplified by PCR method, then circular DNA in a template is removed by DpnI, and 5' -end thio modified A base is removed by exonuclease to obtain T vector. However, this method has a disadvantage that the linearized product is a PCR product, the 5' -end of which is not phosphorylated, and finally the ligation efficiency of the T vector is reduced (as reported in detail in Ukai H, ukai-Tadenuma M, ogiu T, tsuji H. A new technique to prevent self-ligation of DNA. Journal of biotechnology 2002;97 (3): 233-42.). Chen Defu et al (Chen Defu, yang Peng, chen Xiwen, pG7X-T vector for T-A cloning and its preparation method [ P ]. CN 1614018.2005-05-11) uses the primer with XcmI cleavage site to amplify linearization vector, then enzyme-cutting the PCR product to recover to obtain T vector, but the method adopts conventional TaKaRa Ex Taq enzyme to amplify long fragment, on one hand, the base mutation easily occurs in the vector sequence, on the other hand, the PCR product is linear DNA, the cleavage efficiency is not high as circular DNA, the incomplete cleavage can reduce the connection efficiency, thereby affecting the conversion efficiency.

Disclosure of Invention

The invention aims to provide a primer composition and application thereof in preparing a T carrier, wherein the primer composition is provided with two complementary primers, and the two complementary primers form double-stranded DNA with sticky ends after denaturation annealing and have 2 XcmI restriction sites, so that the primer composition has high preparation and connection efficiency, simple operation and low cost.

In order to achieve the technical purpose, the technical scheme adopted by the application is as follows:

in a first aspect, the present invention provides a primer composition having 2 complementary sequences pComT-F and pComT-R, the nucleotide sequences of pComT-F and pComT-R being shown in SEQ_1 and SEQ_2, respectively.

In a second aspect, the invention provides the use of said primer composition for the preparation of a T vector.

In a third aspect, the present invention provides a method of preparing a T-vector comprising the steps of:

s1, preparing pComT-F and pComT-R, and performing annealing treatment to form double-stranded DNA;

s2, carrying out enzyme digestion on the carrier by adopting restriction enzyme to obtain an enzyme digestion product;

s3, connecting the double-stranded DNA with the enzyme digestion product and converting the double-stranded DNA into competent cells to obtain a clone;

s4, extracting plasmid from the clone, and then obtaining the T vector after XcmI enzyme digestion.

Preferably, the final concentration of pComT-F and pComT-R in the annealing treatment is 1-10. Mu.M.

Preferably, the restriction enzyme is SfiI.

Preferably, the vector is pComb-3XTT.

In a fourth aspect, the present invention provides a T-vector obtainable by the preparation method.

Preferably, the nucleotide sequence of the T vector is shown in SEQ_3.

In a fifth aspect, the invention provides the use of said T vector in molecular cloning, phage antibody library construction, and soluble expression vector construction.

According to the invention, two complementary primers are designed, double-stranded DNA with sticky ends is formed after denaturation and annealing, and the double-stranded DNA is provided with 2 XcmI enzyme cutting sites, then a pComb-T vector is constructed by utilizing an enzyme cutting connection method, then pComb-T is amplified based on a bacterial plasmid extraction culture method, finally T vector preparation is performed by utilizing a restriction enzyme method, the technological process cost is low, the operation is convenient, the T vector connection efficiency reaches more than 80%, even more than 87.5%, and a research foundation is provided for subsequent molecular cloning, phage antibody library construction and soluble expression vector construction.

Drawings

FIG. 1 shows the PCR results of pCom-T construct colonies of example 3 of the present invention, wherein 1 to 6: pCom-T6 monoclonal; 7: a negative control; 8: positive control with pComb-3XTT as template; m: (Takara DL5000, 3428A, presence of degradation) DNA marker: 5000. 3000, 2000, 1500, 1000, 750, 500, 250, 100bp.

FIG. 2 is a map of pCom-T plasmid in example 4 of the present invention.

FIG. 3 shows the PCR results of three genes (G1, G2, G3) linked to a T vector colony in example 5 of the present invention, wherein 1-8 are 8 single clones of the G1, G2, G3 transformants, respectively, and M is (Shanghai, B500350) DNA marker:2000 1000, 750, 500, 250, 100, bp.

Detailed Description

In the description of the present invention, it is to be noted that the specific conditions are not specified in the examples, and the description is performed under the conventional conditions or the conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

The invention will now be described in further detail with reference to the drawings and to specific examples, which are given by way of illustration and not limitation.

Example 1

An insert with XcmI cleavage site was prepared as follows:

primer pComT-F (5 '-3'): SEQ-1,

CGGCCCCATCGGTTCTCTGGGGTGGCGGTGGCTCTCCAGTTGAAACTTGGGGCCAGGC；

primer pComT-R (5 '-3'): SEQ-2-the sequence of which is set forth in SEQ ID NO,

TGGCCCCAAGTTTCAACTGGAGAGCCACCGCCACCCCAGAGAACCGATGGGGCCGCCT；

the underlined part is the XcmI cleavage site.

The primers were synthesized by Shanghai, centrifuged and sterilized water was added to give a primer concentration of 10. Mu.M, and the mixture was prepared in the system shown in Table 1, and after instantaneous centrifugation, the mixture was naturally cooled in 500ml of boiling water to obtain denatured and annealed double-stranded DNA having an insert of 2 XcmI cleavage sites.

TABLE 1

；

Example 2

The digestion of pCom-3XTT is specifically as follows:

the system shown in Table 2 was prepared, and the target fragment was excised by electrophoresis on a 1% agarose gel in a 50℃water bath overnight, and then subjected to linear vector recovery according to the DNA gel recovery kit (Omega) to give a concentration of 110 ng/. Mu.L.

TABLE 2

；

Example 3

Ligation and transformation of the double-stranded DNA of example 1 and the cleavage product of example 2 are as follows:

the system shown in Table 3 was prepared, after overnight (dry constant temperature metal bath) at 16℃and heating at 65℃for 30min to inactivate T4 DNA ligase, pre-cooling on ice, adding to 100. Mu.L DH 5. Alphase:Sub>A. Competence, gently mixing in ice bath for 30min, heat-shock at 42℃for 90s, immediately placing on ice for 2min, adding 700. Mu.L LB medium, shaking at 180rpm for 45min, taking 100. Mu.L of the plate coated with LB-A (LB solid medium containing 100. Mu.g/ml carbenicillin), inversely culturing at 37℃overnight, picking 6 clones for colony PCR identification, adding negative control (template sterile water) and positive control (template pCom-3 XTT), and sequencing results show that 3 clones are correct.

TABLE 3 Table 3

；

Colony PCR primers:

puc57-R： TAGCTCACTCATTAGGCAC（SEQ_4）

pCom-R： CCTTATTAGCGTTTGCCATC（SEQ_5）

the reaction system is shown in Table 4, the reaction procedure is shown in Table 5, the result is shown in FIG. 1, the candidate clone is sent to Shanghai worker for sequencing, and the sequence comparison is correct, which shows that pCom-T is constructed successfully, and the nucleotide sequence is shown in SEQ_3.

TABLE 4 Table 4

；

TABLE 5

；

Example 4

T carrier preparation, specifically as follows:

the correct clone in example 3 was inoculated into 50mL of LB overnight culture, extracted according to plasmid extraction kit (Magen), and the plasmid was obtained and diluted to 200 ng/. Mu.L, the system shown in Table 6 was prepared, and the mixture was subjected to water bath overnight at 37℃to carry out 1% agarose gel electrophoresis, the target fragment was excised, linear vector recovery was carried out according to DNA gel recovery kit (Omega), the concentration was measured at 93 ng/. Mu.L after recovery, and 10. Mu.L of the mixture was dispensed and frozen at-80 ℃. The obtained linear vector plasmid map is shown in FIG. 2.

TABLE 6

；

Example 5

T carrier connection efficiency test, concretely as follows:

the T vector obtained in example 4 was ligated, and 3 target gene fragments G1, G2, G3 (800-1400 bp) were PCR amplified for ligation and transformation.

The specific steps of connection are as follows:

(1) The ligation reaction was prepared according to the system shown in Table 7.

TABLE 7

；

(2) The ligation was carried out overnight at 16 ℃.

(3) The mixture was inactivated at 65℃for 30min and then subjected to ice bath for transformation.

The specific steps of the transformation are as follows:

(1) Top10 competent cells were removed from the-80℃refrigerator and rapidly inserted into the ice bank to allow dissolution.

(2) 10. Mu.L of ligation product was added and gently mixed, and left to stand in ice for 30 minutes.

(3) And (3) carrying out heat shock for 45 seconds in a 42 ℃ water bath, quickly putting back in ice, and placing for about 2 minutes, wherein the user needs to pay attention to not shake. 700. Mu.L of sterile medium without antibiotics was added and mixed well.

(4) Shaking culture is carried out for 1 hour at 37 ℃ (160-225 rpm), 200 mu L of the solution is absorbed and uniformly spread on LB-A (containing 100ug/ml ampicillin) agar medium plates, and the solution is inverted and cultured overnight at 37 ℃.

(5) The colony PCR was performed by selecting a monoclonal antibody, and the same procedure as in example 3 was performed.

The ligation efficiency was high by colony PCR, and the ligation efficiencies of the three genes G1, G2, and G3 were high, respectively, 7/8, and 7/8 (the statistics herein did not consider the forward and reverse directions of the insertion direction of the target fragment). The results are shown in FIG. 3 and Table 8. The nucleotide sequences of G1, G2 and G3 are obtained by Shanghai biochemical engineering, and are respectively shown as SEQ_6, SEQ_7 and SEQ_8.

TABLE 8T vector efficiency Table for three genes (G1, G2, G3) linked

；

As shown in Table 8, the connection efficiency of the 3 genes of G1, G2 and G3 can reach more than 87.5%, G1, G2 and G3 are only related cases of the invention, the T vector of the invention can be applicable to genes of other elongation factors and enzyme types, and provides a research foundation for subsequent molecular cloning of the genes, phage antibody library construction and soluble expression vector construction.

The foregoing examples illustrate only a few embodiments of the invention and are described in detail herein without thereby limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.

Claims (9)

1. The primer composition is characterized by having 2 complementary sequences pComT-F and pComT-R, and the nucleotide sequences of pComT-F and pComT-R are shown as SEQ_1 and SEQ_2 respectively.

2. Use of the primer composition of claim 1 for the preparation of a T vector.

3. A method for preparing a T-vector comprising the steps of:

s1, preparing pComT-F and pComT-R, and performing annealing treatment to form double-stranded DNA;

s2, carrying out enzyme digestion on the carrier by adopting restriction enzyme to obtain an enzyme digestion product;

s3, connecting the double-stranded DNA with the enzyme digestion product and converting the double-stranded DNA into competent cells to obtain a clone;

s4, extracting plasmid from the clone, and then obtaining the T vector after XcmI enzyme digestion.

4. A method according to claim 3, wherein the final concentration of pComT-F and pComT-R in the annealing treatment is 1-10 μm.

5. The method of claim 3, wherein the restriction enzyme is SfiI.

6. The method of claim 3, wherein the vector is pComb-3XTT.

7. A T-vector obtained by the method of any one of claims 3 to 6.

8. The T vector of claim 7, wherein the nucleotide sequence of the T vector is set forth in seq_3.

9. Use of the T-vector of claim 7 or 8 in molecular cloning, phage antibody library construction, and soluble expression vector construction.