CN117402758A - Non-saccharomyces cerevisiae and application thereof - Google Patents

Non-saccharomyces cerevisiae and application thereof Download PDF

Info

Publication number
CN117402758A
CN117402758A CN202311382511.XA CN202311382511A CN117402758A CN 117402758 A CN117402758 A CN 117402758A CN 202311382511 A CN202311382511 A CN 202311382511A CN 117402758 A CN117402758 A CN 117402758A
Authority
CN
China
Prior art keywords
strain
sive8901
fruit wine
saccharomyces cerevisiae
tolerance
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202311382511.XA
Other languages
Chinese (zh)
Inventor
钟轲
孙玉霞
肖建
丁燕
汤晓宏
李志宇
李蕊蕊
韩晓梅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong Grape Research Institute
Original Assignee
Shandong Grape Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong Grape Research Institute filed Critical Shandong Grape Research Institute
Priority to CN202311382511.XA priority Critical patent/CN117402758A/en
Publication of CN117402758A publication Critical patent/CN117402758A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/16—Yeasts; Culture media therefor
    • C12N1/165—Yeast isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12G—WINE; PREPARATION THEREOF; ALCOHOLIC BEVERAGES; PREPARATION OF ALCOHOLIC BEVERAGES NOT PROVIDED FOR IN SUBCLASSES C12C OR C12H
    • C12G3/00—Preparation of other alcoholic beverages
    • C12G3/02—Preparation of other alcoholic beverages by fermentation
    • C12G3/024—Preparation of other alcoholic beverages by fermentation of fruits other than botanical genus Vitis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C12R2001/85—Saccharomyces
    • C12R2001/865—Saccharomyces cerevisiae
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Mycology (AREA)
  • Virology (AREA)
  • Botany (AREA)
  • Biomedical Technology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides a non-saccharomyces cerevisiae and application thereof, wherein the strain SIVE8901 is preserved in China Center for Type Culture Collection (CCTCC) in the year 05 and 31 of 2023; address: china university of Wuhan and Wuhan with preservation number of CCTCC NO: M2023882, latin nameStarmerella bacillarisThe strain SIVE8901 is candida lycopi prine; the strain SIVE8901 has good flavone tolerance, and after fermentation by non-saccharomyces cerevisiae and saccharomyces cerevisiae mixed bacteria, special aroma components such as ethyl decanoate, ethyl palmitate and the like are produced, and the coconut aroma and the cream aroma of the fruit wine are endowed, so that the strain SIVE8901 has important significance in improving the flavor and quality of the fruit wine.

Description

Non-saccharomyces cerevisiae and application thereof
Technical Field
The invention relates to the technical field of biological brewing, in particular to non-saccharomyces cerevisiae and application thereof.
Background
The fermentation process of fruit wine is a complex and multi-level biochemical reaction process, and relates to the metabolic activity of various microorganisms, and the product also changes along with the change of the growth environment of the microorganisms. The fermentation of the fruit wine mainly relates to two major types of Saccharomyces cerevisiae and non-Saccharomyces cerevisiae, wherein the Saccharomyces cerevisiae mainly produces alcohol in the fermentation of the fruit wine, and the non-Saccharomyces cerevisiae can produce substances such as esters, aldehydes, alcohols and the like in the fermentation of the fruit wine, thereby contributing to the fragrance of the fruit wine.
After the fruit wine is fermented by non-saccharomyces cerevisiae, aroma components are increased; after the fermentation of the saccharomyces cerevisiae, trace elements and bioactive substances in fresh fruits can be reserved, and a large amount of metabolites can be produced, so that the obtained fruit wine is rich in microorganisms and amino acids, and is favorable for absorption and utilization; namely, after the mixed fermentation of the saccharomyces cerevisiae and the non-saccharomyces cerevisiae, not only alcohol can be generated, but also aroma compounds such as alcohols, esters, terpenes and the like can be generated, so that the purposes of improving the taste of the fruit wine and improving the flavor of the fruit wine are achieved; thus, in recent years, the use of mixed fermentation of Saccharomyces cerevisiae and non-Saccharomyces cerevisiae in fruit wine fermentation is increasing, and attention is paid.
Citrus is one of the most important fruits in the world, has high nutritional value and health care effect, and is popular with people with the improvement of health consciousness; navel orange is known as "the king of oranges and tangerines", and the current market consumption is mainly fresh food and juice, however, along with the annual increase of navel orange planting area and yield, the problem of excessive production, difficult storage and the like is faced at present, the fruit wine brewed by using the navel orange as raw materials is mellow and fresh in taste, is rich in nutrients such as multiple vitamins, citric acid, flavone and the like, has the characteristics of clearing bowels, improving immunity and the like, and therefore, the fruit wine easy to store brewed by fresh processing becomes another way for the navel orange to develop.
In the fermentation process, non-saccharomyces cerevisiae is mainly participated in the initial stage of fermentation, but navel orange has the characteristics of large acidity and high content of flavonoid substances, the flavonoid substances have the functions of resisting bacteria, resisting oxidation and the like, so that the metabolism activity of the non-saccharomyces cerevisiae is blocked and is difficult to start or the starting time is long, when the non-saccharomyces cerevisiae cannot compete with the advantages in the initial stage of fermentation, the saccharomyces cerevisiae can be started in advance, and the phenomenon of autolysis and apoptosis can be generated along with the gradual increase of the alcohol content in the fermentation liquid, so that the non-saccharomyces cerevisiae cannot contribute to the aroma of the navel orange fruit wine, and the obtained navel orange fruit wine has unbalanced aroma and thin taste. Therefore, the non-saccharomyces cerevisiae which is high in flavonoid tolerance and can contribute to the aroma of the navel orange fruit wine is of great significance for the utilization of the navel orange.
Disclosure of Invention
In view of the above, the invention provides a non-saccharomyces cerevisiae and application thereof, wherein the non-saccharomyces cerevisiae is numbered as SIVE8901 and is preserved in China Center for Type Culture Collection (CCTCC) for short in the year 2023, month 05 and 31; address: china university of Wuhan and Wuhan with preservation number of CCTCC NO: M2023882, latin nameStarmerella bacillarisThe strain SIVE8901 is candida lycopi prine; the strain SIVE8901 has good flavone tolerance, can be preferentially propagated and fermented in navel orange juice with the flavone content of 5.0mg/mL, and adds isoamyl caproate, methyl caprylate, methyl caprate and propyl caprate in the obtained navel orange fruit wine, thereby contributing to the aroma of the obtained navel orange fruit wine; in addition, after mixed fermentation of the strain SIVE8901 and the saccharomyces cerevisiae, the content of ethyl decanoate in the navel orange fruit wine is improved, so that the typical aroma in the navel orange fruit wine is more prominent; meanwhile, the mixed bacteria fermentation also adds ethyl palmitate and 1-decene to the navel orange fruit wine, endows the fruit wine with coconut aroma and cream aroma, and improves the flavor of the fruit wine and promotesThe quality of the fruit wine has important significance.
The technical scheme of the invention is as follows:
a non-saccharomyces cerevisiae with the serial number of SIVE8901, wherein the strain SIVE8901 is preserved in China Center for Type Culture Collection (CCTCC) in the year 2023, month 05 and 31; address: china university of Wuhan and Wuhan with preservation number of CCTCC NO: M2023882, latin nameStarmerella bacillarisThe strain SIVE8901 is candida lycopi prine; the strain SIVE8901 has good flavone tolerance.
Preferably, the strain SIVE8901 has a resistance to flavone of < 5.5mg/mL; in the range of 2.0-5.0mg/mL of flavone content, the strain SIVE8901 can be smoothly started, propagated and fermented.
Preferably, the strain SIVE8901 is screened from natural fermentation mash of the navel orange of the Eden section; the nucleotide sequence of the 26S rDNA D1/D2 region is shown as SEQ ID NO: 1.
SEQ ID NO：1
AAGCTGTACATTTAGTAGACTGAGATCCTCGCGCTCGGGTGGGAATATGAACTGCATCTATAATACTCCGAGGAGCTACATTCTACAGCATTTATCTTCCCCCCAAACACGGCTCTACATGGTTAGCGGCCTACCCTTCCATTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAAAGTTCTTTTCATCTTTCCCTCACAGTACTTGTTTACTATCGGTCTCTCGCAGATATTTAGCTTTAGATGGAGCATACCACCCATTTGAGCTGCATTCCCAAACAACTCGACTCCATGTTAAGATCCTATATGAGGTCAATGCTAGACGGGGCTATCACCCTCCATGGCGCTCCTTTCCAGAAGACTTAAGCATCGTTTCTCAGGACCCTAACTTCAGAATACAACGGCACAAAAGTGCCTTTCAAATCTGAGCTCTTGCCTGTTCACTCGCCGTTACTAGGGCAATCCCTGTTGGTTTCTTTTCCTCCG。
Preferably, the strain SIVE8901 has a glucose tolerance of 100-500g/L, a fructose tolerance of 100-500g/L, an osmotic pressure tolerance of 0.8-1.2mol/L based on KCl concentration, a pH tolerance of 3.0-5.0, an ethanol tolerance of 6-14% (v/v), and SO 2 Tolerance is between 100 and 500mg/L, and temperature tolerance is between 12 and 38 ℃; the above properties of the strain SIVE8901 make it suitable for fruit wine fermentation.
The strain SIVE8901 can be used for improving fragrance of fruit wine.
Preferably, the strain SIVE8901 is applied to the fermentation of the navel orange fruit wine, and the obtained navel orange fruit wine contains isoamyl caproate, methyl caprylate, methyl caprate and propyl caprate, so that the fragrance of the navel orange fruit wine is more balanced, and the fragrance of the navel orange fruit wine is contributed to.
Preferably, the strain SIVE8901 and Saccharomyces cerevisiae are subjected to mixed fermentation; the saccharomyces cerevisiae is BV818; the strain SIVE8901 and BV818 are subjected to mixed fermentation, so that the content of ethyl decanoate in the navel orange fruit wine can be effectively improved, and the fruit wine has coconut fragrance and cream fragrance; in the obtained navel orange fruit wine, 1-decene and ethyl palmitate are added, so that the fruit wine is endowed with cream fragrance, and the navel orange fruit wine is plump in fragrance.
Preferably, in the above application, strain SIVE8901 is added 48 hours later, BV818 is added; adding according to a mass ratio of 1:1, and fermenting at 20 ℃ for 10-20 days until the content of soluble solids is stable and unchanged.
Compared with the prior art, the invention has the beneficial effects that:
1. the invention provides a non-saccharomyces cerevisiae, the strain number SIVE8901, the strain is preserved in China center for type culture collection (CCTCC for short) in the year 05 and 31 of 2023; address: china university of Wuhan and Wuhan with preservation number of CCTCC NO: M2023882, latin nameStarmerella bacillarisThe strain is screened out from natural fermentation mash of navel orange, and can be fermented preferentially in navel orange juice with higher flavone content.
2. When the non-saccharomyces cerevisiae SIVE8901 provided by the invention is applied to fruit wine fermentation, glycerol can be produced at high yield, the softness of the fruit wine is improved, the navel orange fruit wine obtained by mixed fermentation of the saccharomycetes has strong fragrance and higher quality, ester compounds account for 84.29% of the total compounds, the content of ethyl decanoate in the fruit wine can be improved, the fruit wine has coconut fragrance, and the method has important significance in improving the taste of the fruit wine and the flavor of the fruit wine.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the description of the embodiments or the prior art will be briefly described below, and it will be obvious to those skilled in the art that other drawings can be obtained from these drawings without inventive effort.
FIG. 1 shows the cell morphology of strain SIVE8901 under an electron microscope.
FIG. 2 shows colony morphology of strain SIVE8901 on different fixed media; the left panel shows the colony morphology of strain SIVE8901 on YPD solid medium, and the right panel shows the colony morphology of strain SIVE8901 on WL solid medium.
FIG. 3 is a GC-MS ion of strain SIVE 8901.
Detailed Description
In order that those skilled in the art will better understand the technical solutions of the present invention, the technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention, and it is apparent that the described embodiments are only some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the present invention without making any inventive effort, shall fall within the scope of the present invention.
Example 1 isolation and identification of a non-Saccharomyces cerevisiae SIVE8901 Strain
1. Isolation of strains
(1) Crushing vone navel orange, weighing 200g in 500mL triangular flask, sealing bottle mouth with air-permeable sealing film, enriching for 3d in biochemical incubator at 28deg.C, taking out fermentation liquid, and diluting with sterile water to 10 -4 Obtaining a diluent;
(2) And (3) sucking 100 mu L of the diluent, uniformly coating the diluent in a WL solid culture medium, culturing the mixture at a constant temperature of 28 ℃ for 48 hours, observing colony characteristics, selecting single colonies with different performance characteristics, carrying out 2-3 times of plate streak purification, inoculating the obtained single colonies into a YPD solid culture medium for culturing, simultaneously picking up a monoclonal strain, observing cell morphology under a microscope, and separating 38 strains from the vone navel orange.
2. Authentication
Extracting genome DNA of the pure strain by kit extraction method with primers NL1 (5'-GCATATCAATAAGCGGAGGAAAAG-3') and NL4 (5'-GGTCCGTGTTTCAAGACGG-3')Amplifying the D1/D2 region of 26S rDNA, and carrying out PCR amplification by adopting a 50 mu L reaction system, wherein the reaction system is as follows: master mix (2X) 25. Mu. L, NL1 1. Mu. L, NL4 1. Mu. L, templap 4. Mu. L, ddH 2 O19. Mu.L; amplification conditions: pre-denaturing at 95 ℃ for 5min, then denaturing at 95 ℃ for 15s, annealing at 53 ℃ for 20s, extending at 72 ℃ for 1min, repeating 28 times, extending at 72 ℃ for 5min, and preserving at 4 ℃;
and (3) performing agarose gel electrophoresis detection on the PCR product: 2 mu L of PCR products are sampled, 3 mu L of markers are sampled, and the samples are separated in 1.0% agarose gel electrophoresis; 120V,20min, and analyzing with a gel imager;
the PCR product containing the target fragment was sent to detection company for sequencing, and the results were aligned by BLAST homology search at NCBI. Through homologous sequence search and comparison, 15 non-saccharomyces cerevisiae strains are detected in total, the 15 non-saccharomyces cerevisiae strains are subjected to Du Shixiao pipe gas production experiments and sensory evaluation analysis, 3 non-saccharomyces cerevisiae strains with special aroma are obtained, the strain numbers are SIVE8901, SIVE8902 and SIVE8903 respectively, and the 3 yeasts are transferred to YPD agar culture inclined planes respectively and are preserved for standby at 4 ℃; wherein, the nucleotide sequence of the 26S rDNA D1/D2 region of the strain SIVE8901 is shown in SEQ ID NO:1, as follows:
SEQ ID NO：1
AAGCTGTACATTTAGTAGACTGAGATCCTCGCGCTCGGGTGGGAATATGAACTGCATCTATAATACTCCGAGGAGCTACATTCTACAGCATTTATCTTCCCCCCAAACACGGCTCTACATGGTTAGCGGCCTACCCTTCCATTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAAAGTTCTTTTCATCTTTCCCTCACAGTACTTGTTTACTATCGGTCTCTCGCAGATATTTAGCTTTAGATGGAGCATACCACCCATTTGAGCTGCATTCCCAAACAACTCGACTCCATGTTAAGATCCTATATGAGGTCAATGCTAGACGGGGCTATCACCCTCCATGGCGCTCCTTTCCAGAAGACTTAAGCATCGTTTCTCAGGACCCTAACTTCAGAATACAACGGCACAAAAGTGCCTTTCAAATCTGAGCTCTTGCCTGTTCACTCGCCGTTACTAGGGCAATCCCTGTTGGTTTCTTTTCCTCCG；
primer NL1, as set forth in SEQ ID NO:2 is shown in the figure;
SEQ ID NO：2
5'-GCATATCAATAAGCGGAGGAAAAG-3'；
primer NL4, as set forth in SEQ ID NO:3 is shown in the figure;
SEQ ID NO：3
5'-GGTCCGTGTTTCAAGACGG-3'。
the strain SIVE8901 was inoculated on YPD solid medium plates and WL nutrient agar plates by streaking, the results are shown in FIG. 2; the left panel in FIG. 2 shows colony morphology on YPD solid medium plates and the right panel in FIG. 2 shows colony morphology on WL nutrient agar plates.
Example 2 tolerability test
3 strains of bacteria with numbers SIVE8901, SIVE8902 and SIVE8903 deposited in example 1 were subjected to tolerance test as follows:
(1) Huang Tongnai susceptibility test
The tolerance experiments of the strain SIVE8901, the strain SIVE8902 and the strain SIVE8903 are carried out by the following steps: grinding orange peel into powder by adopting liquid nitrogen, inoculating 3 strains of yeast into YPD liquid culture with Du test tubes and different flavone contents, wherein the flavone contents are respectively 2.0mg/mL, 3.0mg/mL, 4.0mg/mL, 5.0mg/mL and 5.5mg/mL, the inoculation amount is 1uL (1 loop is scraped by an inoculating loop), the YPD liquid culture medium is 10mL, culturing at constant temperature for 7d, and observing the growth conditions, and the results are shown in Table 1;
table 1 Huang Tongnai results of the sexual experiments
As can be seen in Table 1, among the 3 non-Saccharomyces cerevisiae strains selected in example 1, the strain SIVE8901 had the highest resistance to flavones; to see if non-Saccharomyces cerevisiae is suitable for use in navel orange fruit wine fermentation, glucose tolerance, fructose tolerance, osmotic pressure tolerance, ethanol tolerance, SO are continued 2 Tolerance, temperature tolerance and pH tolerance experiments:
(2) Glucose tolerance
Glucose tolerance experiments were performed on strain SIVE8901, strain SIVE8902 and strain SIVE8903, inoculated into YPD liquid cultures with Du test tubes and different glucose concentrations, the glucose concentrations were 100g/L, 200g/L, 300g/L, 400g/L, 500g/L, the inoculum size was 1uL (1 loop was scraped from the inoculating loop), the YPD liquid culture medium was 10mL, the growth conditions were observed at 28℃for 7d, and the results are shown in Table 2;
TABLE 2 glucose tolerance results
(3) Fructose tolerance
Performing fructose tolerance experiments on the strain SIVE8901, the strain SIVE8902 and the strain SIVE8903, inoculating the strain SIVE8901, the strain SIVE8902 and the strain SIVE8903 into YPD liquid cultures with Du test tubes and different fructose concentrations, wherein the fructose concentration is 100g/L, 200g/L, 300g/L, 400g/L and 500g/L, the inoculation amount is 1uL (1 loop is scraped by an inoculating loop), the YPD liquid culture medium is 10mL, culturing the strain in a constant temperature of 28 ℃ for 7d, and observing the growth conditions of the strain, and the results are shown in Table 3;
TABLE 3 results of fructose tolerance
(3) Osmotic pressure tolerance
Performing an osmotic pressure tolerance experiment on the strain SIVE8901, the strain SIVE8902 and the strain SIVE8903, inoculating the strain SIVE8901, the strain SIVE8902 and the strain SIVE8903 into YPD liquid culture with Du test tubes of different osmotic pressure concentrations (calculated by KCl), wherein the KCl concentration is 0.8mol/L, 1.0mol/L, 1.2mol/L and 1.6mol/L, the inoculation amount is 1uL (1 loop is scraped by an inoculating loop), the YPD liquid culture medium is 10mL, and culturing the strain in constant temperature at 28 ℃ for 7d, and observing the growth condition of the strain, wherein the result is shown in Table 4;
TABLE 4 osmotic pressure tolerance results
(5) Ethanol tolerance
Ethanol tolerance experiments are carried out on the strain SIVE8901, the strain SIVE8902 and the strain SIVE8903, the strain SIVE8901, the strain SIVE8903 and the strain SIVE are inoculated into YPD liquid cultures with Du test tubes and different ethanol concentrations, the ethanol concentrations are 6% (v/v), 8% (v/v), 10% (v/v), 12% (v/v), 14% (v/v) and 16% (v/v), the inoculation amount is 1uL (1 loop is scraped by an inoculating loop), the YPD liquid culture medium is 10mL, the YPD liquid culture medium is cultivated for 7 days at the constant temperature of 28 ℃, and the growth conditions are observed, and the results are shown in Table 5;
TABLE 5 results of ethanol tolerance
（6）SO 2 Tolerance to
SO was performed on strain SIVE8901, strain SIVE8902 and strain SIVE8903 2 Tolerance experiments, inoculated on different SO with Du tubes 2 SO in YPD liquid culture at a concentration 2 The concentrations are 100mg/L, 200mg/L, 300mg/L, 400mg/L and 500mg/L, the inoculation amount is 1uL (1 loop is scraped by an inoculating loop), YPD liquid culture medium is 10mL, the liquid culture medium is cultivated for 7d at the constant temperature of 28 ℃, and the growth condition is observed, and the result is shown in Table 6;
TABLE 6SO 2 Tolerability results
(7) Temperature tolerance
Performing temperature tolerance experiments on the strain SIVE8901, the strain SIVE8902 and the strain SIVE8903, inoculating the strains into YPD liquid culture with a Du test tube, standing and culturing at different temperatures of 10 ℃, 12 ℃, 14 ℃, 38 ℃, 40 ℃ respectively, wherein the inoculation amount is 1uL (1 loop is scraped by an inoculating loop), the YPD liquid culture medium is 10mL, culturing at 28 ℃ for 7d at constant temperature, and observing the growth condition of the YPD liquid culture medium, wherein the results are shown in Table 7;
TABLE 7 temperature tolerance results
(8) pH tolerance
Performing a pH tolerance experiment on the strain SIVE8901, the strain SIVE8902 and the strain SIVE8903, inoculating the strain SIVE8901, the strain SIVE8902 and the strain SIVE8903 into YPD liquid cultures with Du test tubes and different pH concentrations, wherein the pH is 2.0, 3.0, 4.0 and 5.0 respectively, the inoculum size is 1uL (1 loop is scraped by an inoculating loop), the YPD liquid culture medium is 10mL, and the growth condition of the strain SIVE8903 is observed at a constant temperature of 28 ℃ for 7d, and the result is shown in Table 8;
TABLE 8pH tolerance results
As can be seen by combining tables 1 to 8, the strain SIVE8901 and Huang Tongnai screened by the invention has the tolerance of 2.0-5.5mg/mL and the tolerance of 2.0-5.0 mg/mL; the strain SIVE8901 has glucose tolerance of 100-500g/L, fructose tolerance of 100-500g/L, osmotic pressure tolerance of 0.8-1.2mol/L based on KCl concentration, pH tolerance of 3.0-5.0, ethanol tolerance of 6-14% (v/v), SO 2 The tolerance is between 100 and 500mg/L, and the temperature tolerance is between 12 and 38 ℃.
Compared with the strain SIVE8902 and the strain SIVE8903, the strain SIVE8901 has the best performance; the strain SIVE8901 is indicated to be well suitable for the fermentation environment of the navel orange fruit wine, and the strain SIVE8901 is preserved, and the preservation information is: the strain is preserved in China center for type culture collection (CCTCC for short) in the year 2023, month 05 and day 31; address: the preservation number of the Chinese university of Wuhan is CCTCC NO: M2023882; latin name ofStarmerella bacillaris。
Example 3 application of Strain SIVE8901 in navel orange wine
The application process is as follows:
(1) Sorting, cleaning, peeling and squeezing navel orange to obtain juice, centrifuging at 20deg.C and 8000r/min for 5min, filtering the supernatant with 0.45 μm sterile filter membrane for sterilization, detecting physical and chemical index of the juice, total acid 10.50g/L, sugar 14Brix, pH3.5, and flavone content 4.36mg/mL;
(2) Regulating sugar content of fruit juice to 20Brix to obtain fermentation raw material, packaging the fermentation raw material into 1000mL blue cap bottles, and storing 600mL fermentation raw material per bottle for use;
(3) Activating the strain SIVE8901 preserved in example 1 in YPD liquid culture medium overnight, inoculating again, centrifuging at 20deg.C and 6000r/min for 5min, and collecting fresh bacteria for use;
(4) Experiment setting:
experiment 1: adding 0.5g of the strain SIVE8901 preserved in example 1 into the subpackaged fermentation raw materials to prepare 3 repetitions;
experiment 2: adding Angel wine active dry yeast BV818 (hereinafter referred to as BV 818) into the subpackaged fermentation raw materials according to 0.5g to prepare 3 repetitions;
experiment 3: putting the strain SIVE8901 preserved in example 1 into the fermentation raw material after split charging according to 0.25g of fresh bacteria, and fermenting to prepare 3 repetitions; after 48h of fermentation, BV818 was added at 0.25g to ferment;
experiment 4: adding LALVIN active dry yeast CY3079 into the fermentation raw material after sub-packaging according to the weight of 0.5g, and preparing 3 repetitions;
experiment 5: putting the strain SIVE8901 preserved in example 1 into the fermentation raw material after split charging according to 0.25g of fresh bacteria, and fermenting to prepare 3 repetitions; after 48h of fermentation, 0.25g of LALVIN active dry yeast CY3079 is added to the mixture for fermentation;
(5) After experimental setting, controlling the fermentation temperature at 19+/-0.5 ℃, observing the time for generating bubbles to be regarded as starting fermentation until the content of soluble solids is stable and unchanged, and measuring physical and chemical indexes of the navel orange fruit wine, and measuring indexes such as ethanol, total acid, residual sugar and the like: reference is made to GB/T15038-2006 general analysis methods for wine and fruit wine; and the glycerol content after fermentation is measured by adopting a high performance liquid chromatography. The results are shown in Table 9, below:
physical and chemical indexes of navel orange fruit wine prepared in Table 9
As can be seen from the table 9, in the experiment of adding the strain SIVE8901, fermentation starts on the first day, such as experiment 1, experiment 3 and experiment 5, which shows that the strain SIVE8901 provided by the invention has good adaptability and can rapidly propagate and metabolize in the navel orange juice, that is, compared with Saccharomyces cerevisiae, the strain SIVE8901 provided by the invention can preferentially ferment in the navel orange juice with high flavone content;
according to the fermentation result of the combination test 1, the strain SIVE8901 can produce glycerol with high yield, which can reach 8.04g/L, so that the taste is more flexible, and the strain has a positive effect on the quality of fruit wine.
Example 4 Effect of Strain SIVE8901 on navel orange wine aroma
The navel orange fruit wine obtained after fermentation in experiment 1, experiment 2 and experiment 3 in example 3 is taken, aroma compounds thereof are respectively detected, and the results are shown in table 10;
TABLE 10CG-MS detection results
As can be seen from table 10, compared with experiment 2 (BV 818 pure-seed fermentation), in the navel orange fruit wine obtained in experiment 1 (strain SIVE8901 pure-seed fermentation), the esters increased isoamyl caproate, methyl caprylate, methyl caprate and propyl caprate, and correspondingly, in experiment 3 (mixed fermentation), the isoamyl caprate, methyl caprylate, methyl caprate and propyl caprate were also increased, and as compared with experiment 2, the fragrance components in the navel orange fruit wine after mixed fermentation were increased by non-saccharomyces cerevisiae, so that the fragrance of the navel orange fruit wine was more balanced;
compared with the combination of the experiment 1 and the experiment 2, the navel orange fruit wine obtained in the experiment 3 is newly added with the ethyl palmitate and the 1-decene, wherein the addition of the ethyl palmitate endows the fruit wine with light cream flavor, and therefore, the aroma components of the navel orange fruit wine can be enriched through mixed fermentation;
compared with the combination of the experiment 1 and the experiment 2, the amount of the ethyl decanoate in the navel orange fruit wine obtained in the experiment 3 is obviously improved, the ethyl decanoate has pleasant coconut aroma, and after the navel orange fruit wine obtained in the experiment 3 is enriched, the characteristic aroma of the navel orange fruit wine is more obvious;
compared with the combination of the experiment 1 and the experiment 2, the acid content in the navel orange fruit wine obtained in the experiment 3 is obviously reduced, so that the fruit wine has more mellow and softer taste, wherein only caproic acid is detected in the experiment 3, so that the fruit wine has more refreshing taste.
Therefore, through the fermentation process of the experiment 3, the aroma components in the navel orange fruit wine are enriched, and various aroma substances are mutually coordinated and mutually promoted, so that the aroma is more full and three-dimensional, and the quality of the navel orange fruit wine is improved.
Example 5 sensory evaluation of fermented navel orange fruit wine
The navel orange fruit wine obtained in experiment 1, experiment 2 and experiment 3 in example 3 is subjected to sensory scoring by 10 panelists trained in profession, the average value of the sensory scoring is taken as a scoring result, 100 minutes are fully divided, sensory scoring criteria are shown in table 11, and the scoring result is shown in table 12, and is as follows:
TABLE 11 navel orange wine sensory scoring criteria
Table 12 sensory evaluation of navel orange fruit wine
Example 6 Effect of Strain SIVE8901 on fragrance of Small Mandson wine
The application process is as follows:
(1) Squeezing grape skin of Amerson to obtain juice, centrifuging at 20deg.C and 8000r/min for 5min, filtering the supernatant with 0.45 μm sterile filter membrane, and sterilizing;
(2) Regulating sugar content of fruit juice to 20Brix to obtain fermentation raw material, packaging the fermentation raw material into 1000ml blue cap bottles, and storing 600ml fermentation raw material per bottle for use;
(3) Activating the strain SIVE8901 preserved in example 1 in YPD liquid culture medium overnight, inoculating again, centrifuging at 4deg.C and 6000r/min for 5min, and collecting fresh bacteria for use;
(4) Experiment setting:
experiment 6: adding 0.5g of the strain SIVE8901 preserved in example 1 into the subpackaged fermentation raw materials to prepare 3 repetitions;
experiment 7: adding Angel wine active dry yeast BV818 into the fermentation raw materials after split charging according to 0.5g, and preparing 3 repetitions;
experiment 8: putting the strain SIVE8901 obtained in the example 2 into the fermentation raw material after subpackaging according to 0.25g of fresh bacteria, and fermenting to prepare 3 repetitions; after 48h fermentation, angel wine active dry yeast BV818 was added at 0.25g for fermentation;
(5) After experimental setting, the fermentation temperature is controlled to be 19+/-0.5 ℃ and the content of soluble solids is stable and unchanged, and the detection of the aroma compounds of the navel orange fruit wine is regarded as the end of alcoholic fermentation, and the results are shown in table 13 and are as follows:
TABLE 13CG-MS detection results
From Table 13, it can be seen that in experiment 6 (strain SIVE8901 pure fermentation), the contents of phenethyl alcohol and ethyl palmitate of Xiaomangsen wine were increased, and pleasant rose fragrance and fruit fragrance and coconut fragrance were brought to the wine;
in experiment 8 (mixed fermentation of strain SIVE8901 and BV 818), the content of esters is rich, wherein the content of isooctanol and ethyl decanoate is obviously increased, and citrus flavor and fruit flavor are added to the wine; after mixed bacteria fermentation, ethyl palmitate is added into the Xiaomangsen wine, so that the aroma components in the product wine are increased, and the aroma components of the product are enriched.
According to the embodiment 4 and the embodiment 6, in the process of using the strain SIVE8901 provided by the invention, ethyl palmitate is added into the fruit wine in the mixed fermentation process, so that the obtained fruit wine has pleasant coconut aroma; in addition, after mixed fermentation, compared with single strain fermentation, the aroma components are more abundant, and the quality of the fruit wine product is improved.
The experimental methods involved in the above experiments were as follows:
and (3) measuring indexes such as ethanol, total acid, total sugar and the like: reference is made to GB/T15038-2006 general analysis methods for wine and fruit wine; detection of aroma compounds: aglient GC 7890B/MS 5977A gas mass spectrometer.
Although the present invention has been described in detail by way of reference to preferred embodiments, the present invention is not limited thereto. Various equivalent modifications and substitutions may be made in the embodiments of the present invention by those skilled in the art without departing from the spirit and scope of the present invention, and it is intended that all such modifications and substitutions be within the scope of the present invention/be within the scope of the present invention as defined by the appended claims. Therefore, the protection scope of the present invention shall be subject to the protection scope of the claims.

Claims (8)

1. The non-saccharomyces cerevisiae is characterized by having the serial number of SIVE8901, and the strain SIVE8901 is preserved in China Center for Type Culture Collection (CCTCC) in the year 2023, month 05 and day 31; address: china university of Wuhan and Wuhan with preservation number of CCTCC NO: M2023882, latin nameStarmerella bacillarisThe strain SIVE8901 is candida lycopi prine; the strain SIVE8901 has good flavone tolerance.
2. The non-saccharomyces cerevisiae according to claim 1 wherein the strain SIVE8901 has a resistance to flavonoids < 5.5mg/mL; in the range of 2.0-5.0mg/mL of flavone content, the strain SIVE8901 can be smoothly started, propagated and fermented.
3. The non-saccharomyces cerevisiae according to claim 1 wherein said strain SIVE8901 is selected from the group consisting of ravone navel orange natural beer; the nucleotide sequence of the 26S rDNA D1/D2 region is shown as SEQ ID NO:1 is shown as follows:
SEQ ID NO：1
AAGCTGTACATTTAGTAGACTGAGATCCTCGCGCTCGGGTGGGAATATGAACTGCATCTATAATACTCCGAGGAGCTACATTCTACAGCATTTATCTTCCCCCCAAACACGGCTCTACATGGTTAGCGGCCTACCCTTCCATTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAAAGTTCTTTTCATCTTTCCCTCACAGTACTTGTTTACTATCGGTCTCTCGCAGATATTTAGCTTTAGATGGAGCATACCACCCATTTGAGCTGCATTCCCAAACAACTCGACTCCATGTTAAGATCCTATATGAGGTCAATGCTAGACGGGGCTATCACCCTCCATGGCGCTCCTTTCCAGAAGACTTAAGCATCGTTTCTCAGGACCCTAACTTCAGAATACAACGGCACAAAAGTGCCTTTCAAATCTGAGCTCTTGCCTGTTCACTCGCCGTTACTAGGGCAATCCCTGTTGGTTTCTTTTCCTCCG。
4. the non-Saccharomyces cerevisiae according to claim 1, wherein the strain SIVE8901 has a glucose tolerance of between 100 and 500g/L, a fructose tolerance of between 100 and 500g/L, an osmotic pressure tolerance of between 0.8 and 1.2mol/L based on KCl concentration, a pH tolerance of between 3.0 and 5.0, an ethanol tolerance of between 6 and 14% (v/v), and SO 2 The tolerance is between 100 and 500mg/L, and the temperature tolerance is between 12 and 38 ℃.
5. Use of a strain SIVE8901 according to any one of claims 1 to 4 in the fermentation of fruit wine, characterised in that the strain SIVE8901 is capable of adding aroma to fruit wine.
6. The use according to claim 5, wherein the fruit wine is navel orange fruit wine; after the strain SIVE8901 and the saccharomyces cerevisiae are added respectively and simultaneously, the obtained navel orange fruit wine contains isoamyl caproate, methyl caprylate, methyl caprate and propyl caprate, so that the fragrance of the navel orange fruit wine is more balanced, and the navel orange fruit wine contributes to the fragrance of the fruit wine.
7. The use according to claim 6, wherein the strain SIVE8901 is subjected to mixed fermentation with saccharomyces cerevisiae; the saccharomyces cerevisiae is BV818; the strain SIVE8901 and BV818 are subjected to mixed fermentation, so that the content of ethyl decanoate in the navel orange fruit wine can be effectively improved, and the fruit wine has coconut fragrance and cream fragrance; the obtained navel orange fruit wine is added with 1-decene and ethyl palmitate, and has creamy flavor.
8. The use of claim 7, wherein BV818 is added 48 hours after the addition of strain SIVE 8901; adding according to a mass ratio of 1:1, and fermenting at 20 ℃ for 10-20 days.
CN202311382511.XA 2023-10-24 2023-10-24 Non-saccharomyces cerevisiae and application thereof Pending CN117402758A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311382511.XA CN117402758A (en) 2023-10-24 2023-10-24 Non-saccharomyces cerevisiae and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311382511.XA CN117402758A (en) 2023-10-24 2023-10-24 Non-saccharomyces cerevisiae and application thereof

Publications (1)

Publication Number Publication Date
CN117402758A true CN117402758A (en) 2024-01-16

Family

ID=89492122

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311382511.XA Pending CN117402758A (en) 2023-10-24 2023-10-24 Non-saccharomyces cerevisiae and application thereof

Country Status (1)

Country Link
CN (1) CN117402758A (en)

Similar Documents

Publication Publication Date Title
CN108239608B (en) Torulaspora delbrueckii and application thereof in wine brewing
CN111961603B (en) Saccharomyces cerevisiae and bacterial agents and their use in the preparation of fermented products, in particular in the brewing of Huai drop of water basin wines
CN109182156B (en) Saccharomyces cerevisiae suitable for brewing red-core pitaya wine and application thereof
CN113717867B (en) Pichia pastoris capable of producing no ethanol and application thereof
CN106753994B (en) Method for improving alcohol content of alcohol fermentation liquor and reducing isoamyl alcohol content by using high-ester-yield indigenous aroma-producing yeast enhanced yeast
CN108251318A (en) A kind of Dell is furnished with spore torula and its application in Wine Aroma quality is improved
CN112553091A (en) Non-saccharomyces cerevisiae and fermentation method for increasing fragrance of blueberry fruit wine by using same
CN109988685A (en) The production method of fruity and fragrance of a flower fragrance in a kind of raising grape wine
CN113215006A (en) Pichia pastoris and application thereof
CN108179120A (en) One Accharomyces cerevisiae and its application
CN108179119B (en) Fermentation process for improving aroma quality of ice wine by using non-saccharomyces cerevisiae
CN110305804A (en) A kind of Non-Saccharomyces bacterial strain and its application
CN113999782B (en) Saccharomyces cerevisiae, starter and preparation method thereof, application of starter and starter in preparation of fermented food, and preparation method of beer
CN110343625B (en) Saccharomyces cerevisiae strain and application thereof
CN114574375A (en) Saccharomyces cerevisiae, leavening agent and application of saccharomyces cerevisiae and leavening agent in preparation of fermented food
CN108384728B (en) Saccharomyces cerevisiae and application thereof
CN111621430B (en) Saccharomyces cerevisiae suitable for brewing yellow peach fruit wine and application thereof
CN113564061A (en) Saccharomyces cerevisiae SG35, fermentation inoculant containing Saccharomyces cerevisiae SG35 and application of fermentation inoculant
CN117448182A (en) Aroma-producing yeast and culture method and application thereof
CN104560517A (en) Method for brewing yellow rice wine by using compound lactobacillus
CN104017740B (en) Glycerin high-yielding saccharomyces cerevisiae strain and application thereof to dry white wine
CN116376729A (en) Wick yeast, microbial preparation and medlar western style wine and brewing method thereof
CN110218662A (en) A kind of thermophilic low temperature produces fragrant characteristic U.S. pole plum surprise yeast outstanding and its application
CN109988721A (en) One plant of methamidophos strain that can increase sauce based food fragrance
CN113528361B (en) Saccharomyces cerevisiae suitable for brewing rice wine by liquefaction method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination