CN117385077A - Molecular marker M1147 closely linked with soybean aphid resistance gene and application - Google Patents

Molecular marker M1147 closely linked with soybean aphid resistance gene and application Download PDF

Info

Publication number
CN117385077A
CN117385077A CN202311216131.9A CN202311216131A CN117385077A CN 117385077 A CN117385077 A CN 117385077A CN 202311216131 A CN202311216131 A CN 202311216131A CN 117385077 A CN117385077 A CN 117385077A
Authority
CN
China
Prior art keywords
soybean
aphid
molecular marker
resistant
primer pair
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202311216131.9A
Other languages
Chinese (zh)
Inventor
邱丽娟
郭勇
杨静
刘广阳
王秀君
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute Of Crop Resources Heilongjiang Academy Of Agricultural Sciences
Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Original Assignee
Institute Of Crop Resources Heilongjiang Academy Of Agricultural Sciences
Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute Of Crop Resources Heilongjiang Academy Of Agricultural Sciences, Institute of Crop Sciences of Chinese Academy of Agricultural Sciences filed Critical Institute Of Crop Resources Heilongjiang Academy Of Agricultural Sciences
Priority to CN202311216131.9A priority Critical patent/CN117385077A/en
Publication of CN117385077A publication Critical patent/CN117385077A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a molecular marker M1147 closely linked with soybean aphid resistance genes and application thereof, and relates to the technical field of molecular marker assisted breeding. The soybean aphid-resistant gene is positioned between physical positions 30,700,000 ～ 30,900,000 on chromosome 13 of a soybean genome, and a molecular marker and a corresponding molecular marker detection method are designed based on the soybean aphid-resistant gene. The molecular markers are used for auxiliary selection, so that the screening efficiency is greatly improved, and the breeding period for cultivating aphid-resistant varieties is shortened.

Description

Molecular marker M1147 closely linked with soybean aphid resistance gene and application
The application is a divisional application of China patent application of 2022, 01 and 05 days, which is submitted to China patent office, application number 202210003867.7 and the invention name of 'a soybean aphid resistance gene and molecular markers and application', and the original application is the institute of crop science of China academy of agricultural sciences.
Technical Field
The invention belongs to the technical field of molecular marker assisted breeding, and particularly relates to a soybean aphid resistance gene, a molecular marker and application thereof.
Background
Soybean aphid (Aphisglycines Mats mu mura) is one of the main pests of soybean, and is widely distributed in various soybean main producing areas in China, and plant viruses are transmitted to influence the yield and quality of soybean by sucking soybean phloem photosynthesis products. Soybean aphids often accumulate in tender stems and leaves of plants, causing the plants to be damaged by chlorophyll disappearance, curled leaves, severely damaged plants, shrunken stems and leaves, yellowing, dwarf plants, reduced branching and pod formation, thereby affecting soybean yield. When the aphid in the seedling stage is serious, the whole plant can die, and if the aphid is large, the aphid can not take control measures timely, the yield can be reduced by 20-40%, and the yield can be reduced by more than 50% when the aphid is serious. At present, the prevention and control of soybean aphids depend on the use of pesticides, so that the production cost is increased, natural enemies of the aphids can be killed, the environment is endangered, and the resistance of host plants is an effective method for preventing and controlling the aphids.
Researchers at home and abroad have screened some aphid-resistant soybean resources and have found Dowling, jackson, PI 71506, PI 567543C, PI 567597C and other sources of resistance in sequence (HILL and 2004; MENSAH and 2005; MIAN and 2008; BHUSAL and 2013). The domestic screening and identification of the local varieties green-peel flat-top, du Lu Dou, wild soybean 85-32 and the like, and the resources are difficult to be directly applied to breeding due to poor agronomic characters. The traditional breeding means are limited by conditions of long period, low efficiency and the like, and the molecular marker assisted breeding technology utilizes the characteristic that a molecular marker is closely linked with a target trait gene, and can detect the existence of the target gene by detecting the molecular marker, so that the breeding efficiency can be remarkably improved. However, the research on soybean aphid resistance is relatively few in China at present, excellent resistance resources and molecular markers which can be used for breeding are lacked, and the discovered resistance resources cannot be well utilized.
Disclosure of Invention
In view of the above, the invention aims to provide a soybean aphid-resistant gene, a molecular marker and application thereof, and develop and fully utilize the molecular marker closely linked with the aphid-resistant gene for screening excellent aphid-resistant strains and cultivating aphid-resistant soybean varieties.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a soybean aphid-resistant gene, which is positioned between physical positions 30,700,000 ～ 30,900,000 on chromosome 13 of soybean genome.
The invention also provides a molecular marker closely linked with the aphid resistance gene, wherein the molecular marker comprises a combination of one or more of SNPM20, SNPM80, M1147 and M1151;
the SNPM20 is positioned at 30,702,907 position of chromosome 13 of soybean, the base of aphid-resistant soybean is T, and the base of aphid-sensitive soybean is G;
the SNPM80 is positioned at 30,855,712 position of chromosome 13 of soybean, the base of aphid-resistant soybean is T, and the base of aphid-sensitive soybean is G;
the amplified fragment of M1147 in aphid-resistant soybean is 228bp, and the amplified fragment in aphid-sensitive soybean is 211bp;
the amplification fragment of M1151 in aphid-resistant soybean is 286bp, and the amplification fragment in aphid-sensitive soybean is 239bp.
The invention also provides a primer pair for identifying the molecular marker, wherein the primer pair designed for the SNPM20 comprises SNPM20-F and SNPM20-R, the nucleotide sequence of the SNPM20-F is shown as SEQ ID NO.1, and the nucleotide sequence of the SNPM20-R is shown as SEQ ID NO. 2;
the primer pair designed for the SNPM80 comprises SNPM80-F and SNPM80-R, wherein the nucleotide sequence of the SNPM80-F is shown as SEQ ID NO.3, and the nucleotide sequence of the SNPM80-R is shown as SEQ ID NO. 4;
the primer pair designed for the M1147 comprises M1147-F and M1147-R, wherein the nucleotide sequence of the M1147-F is shown as SEQ ID NO.5, and the nucleotide sequence of the M1147-R is shown as SEQ ID NO. 6;
the primer pair designed for the M1151 comprises M1151-F and M1151-R, wherein the nucleotide sequence of the M1151-F is shown as SEQ ID NO.7, and the nucleotide sequence of the M1151-R is shown as SEQ ID NO. 8.
The invention also provides application of the aphid resistance gene or the molecular marker or the primer pair in soybean molecular marker assisted breeding.
The invention also provides a detection method of the soybean aphid-resistant molecular marker, which comprises the following steps: mixing soybean genome DNA as template with the primer pair to prepare PCR reaction system for PCR amplification.
Preferably, the PCR amplification procedure comprises: pre-denaturation at 95℃for 3min; denaturation at 95℃for 25s, annealing at 58℃for 25s, extension at 72℃for 10s,34 cycles; extending at 72℃for 5min.
Preferably, the PCR reaction system comprises, in 20. Mu.L: 1. Mu.L of template, 2. Mu.L of each of the upstream and downstream primers, 2 х M5 HiPerplus Taq HiFi PCRMix. Mu.L and the balance ddH 2 O。
The invention also provides a method for screening aphid-resistant soybeans, which comprises the following steps: mixing soybean genome DNA as a template with the primer pair to prepare a PCR reaction system, and carrying out PCR amplification;
detecting PCR products, wherein the variety or strain with any one of the following characteristics is aphid-resistant soybean:
(1) Amplifying T at 30,702,907 position of soybean chromosome 13 by using a molecular marker SNPM 20;
(2) Amplifying T at 30,855,712 position of soybean chromosome 13 by using a molecular marker SNPM 80;
(3) The molecular marker M1147 amplifies a DNA fragment of 228 bp;
(4) The molecular marker M1151 amplifies a 286bp DNA fragment.
The beneficial effects are that: the invention utilizes the population hybridized by the aphid-resistant soybean germplasm square-top fodder beans and the aphid-sensitive soybean variety North Feng No. 9 to locate a new aphid-resistant gene locus by a map cloning method. Genetic analysis shows that aphid resistance of square-top forage beans is controlled by dominant single genes, and new aphid resistance genes are finely positioned in a 152.8kb interval through fine positioning. The two molecular markers SNPM20 and SNPM80 in this region are linked to this gene, and the material containing the target gene is screened by using these two markers with high reliability. In addition, other molecular markers, M1147 and M1151, which are closely linked thereto, can be used to screen materials containing the gene of interest. The molecular markers are used for auxiliary selection, so that the screening efficiency is greatly improved, and the breeding period for cultivating aphid-resistant varieties is shortened.
Drawings
FIG. 1 is a comparison of aphid resistance for square-top fodder beans (A) and North Feng No. 9 (B);
FIG. 2 is a graph of gene fine localization results;
FIG. 3 is a diagram showing genotyping of M1147 molecular markers in a population, wherein lane numbers correspond to Table 4, and the following is the same;
FIG. 4 is a genotyping of M1151 molecular markers in a population.
Detailed Description
The invention provides a soybean aphid-resistant gene, which is positioned between 30,700,000 and 30,900,000bp of a physical position on chromosome 13 of a soybean genome.
The aphid-resistant gene is preferably obtained by utilizing a progeny population hybridized with aphid-resistant soybean germplasm square-top feeding beans and aphid-sensitive soybean variety North Feng No. 9 through a map cloning method. In the present invention, the allele of the aphid-resistant variety square-top grain at this locus significantly increases the resistance of the soybean to aphids.
The invention also provides a molecular marker closely linked with the aphid resistance gene, wherein the molecular marker comprises a combination of one or more of SNPM20, SNPM80, M1147 and M1151;
the SNPM20 is positioned at 30,702,907 position of chromosome 13 of soybean, the base of aphid-resistant soybean is T, and the base of aphid-sensitive soybean is G;
the SNPM80 is positioned at 30,855,712 position of chromosome 13 of soybean, the base of aphid-resistant soybean is T, and the base of aphid-sensitive soybean is G;
the amplified fragment of M1147 in aphid-resistant soybean is 228bp, and the amplified fragment in aphid-sensitive soybean is 211bp;
the amplification fragment of M1151 in aphid-resistant soybean is 286bp, and the amplification fragment in aphid-sensitive soybean is 239bp.
The molecular markers SNPM20 and SNPM80 are linked with the aphid resistance gene, and the reliability of screening materials containing target genes by using the two markers is high. Therefore, the resistance of the material to be detected to aphids can be predicted by utilizing any one or more molecular markers of the invention.
The invention also provides a primer pair for identifying the molecular marker, wherein the primer pair designed for the SNPM20 comprises SNPM20-F and SNPM20-R, the nucleotide sequence of the SNPM20-F is shown as SEQ ID NO.1, and the nucleotide sequence of the SNPM20-R is shown as SEQ ID NO. 2;
the primer pair designed for the SNPM80 comprises SNPM80-F and SNPM80-R, wherein the nucleotide sequence of the SNPM80-F is shown as SEQ ID NO.3, and the nucleotide sequence of the SNPM80-R is shown as SEQ ID NO. 4;
the primer pair designed for the M1147 comprises M1147-F and M1147-R, wherein the nucleotide sequence of the M1147-F is shown as SEQ ID NO.5, and the nucleotide sequence of the M1147-R is shown as SEQ ID NO. 6;
the primer pair designed for the M1151 comprises M1151-F and M1151-R, wherein the nucleotide sequence of the M1151-F is shown as SEQ ID NO.7, and the nucleotide sequence of the M1151-R is shown as SEQ ID NO. 8.
The primer pairs designed according to the present invention based on different molecular markers are listed in Table 1.
TABLE 1 primer pairs designed for molecular markers
Sequence(s) Primer(s) SEQ ID NO
SNPM20-F GATTCCCCCTGCTGATGACA 1
SNPM20-R GCCTCATCAACTCAACCCTTACT 2
SNPM80-F TCAACACTTCAGCCTACTTTCCT 3
SNPM80-R CATTTCTGGCTTCTCACCTGAT 4
M1147-F TCGGTTTCATTAACAATTCATTT 5
M1147-R TCGAGTTTGAAATTGATCAGGA 6
M1151-F GCCTTATAAACCTGATAGGCTG 7
M1151-R TTACCCGGGATAGAAAAGCC 8
The invention also provides application of the aphid resistance gene or the molecular marker or the primer pair in soybean molecular marker assisted breeding.
The aphid resistance gene or the molecular marker or the primer pair can be used for determining the aphid resistance of soybean varieties (strains), and the existence of the aphid resistance gene can be judged when any one of the following conditions is met, so that the aphid resistance gene can be applied to the molecular marker-assisted breeding of aphid-resistant soybeans, and the breeding period is shortened: t is amplified from the 30,702,907 th chromosome of soybean 13 by using the marker SNPM20, T is amplified from the 30,855,712 th chromosome of soybean 13 by using the marker SNPM80, or a 228bp DNA fragment is amplified from the marker M1147, and a 286bp DNA fragment is amplified from the marker M1151, which all mark the existence of new aphid-resistant gene loci in soybean varieties.
The invention also provides a detection method of the soybean aphid-resistant molecular marker, which comprises the following steps: mixing soybean genome DNA as template with the primer pair to prepare PCR reaction system for PCR amplification.
The extraction method of the soybean genomic DNA is not particularly limited, and CTAB method is preferably used in the examples. The invention utilizes the genomic DNA and the primer pair to prepare a PCR reaction system, wherein the PCR reaction system is calculated by 20 mu L and preferably comprises the following steps: 1. Mu.L of template, 2. Mu.L of each of the upstream and downstream primers, 2 х M5 HiPer plus Taq HiFi PCR Mix. Mu.L and the balance ddH 2 O. The concentration of the upstream and downstream primers in the invention is preferably 2 mmol.L -1 . The invention uses the PCR reaction system to carry out PCR amplification, and the PCR amplification program preferably comprises: pre-denaturation at 95℃for 3min; denaturation at 95℃for 25s, annealing at 58℃for 25s, extension at 72℃for 10s,34 cycles; extending at 72℃for 5min.
The invention can sequence the PCR products after the PCR reaction to determine the polymorphism of the appointed site, and can also determine the polymorphism of the molecular marker site through polyacrylamide gel electrophoresis or amplification electrophoresis to determine the aphid resistance of soybean varieties (strains).
The invention also provides a method for screening aphid-resistant soybeans, which comprises the following steps: mixing soybean genome DNA as a template with the primer pair to prepare a PCR reaction system, and carrying out PCR amplification;
detecting PCR products, wherein the variety or strain with any one of the following characteristics is aphid-resistant soybean:
(1) Amplifying T at 30,702,907 position of soybean chromosome 13 by using a molecular marker SNPM 20;
(2) Amplifying T at 30,855,712 position of soybean chromosome 13 by using a molecular marker SNPM 80;
(3) The molecular marker M1147 amplifies a DNA fragment of 228 bp;
(4) The molecular marker M1151 amplifies a 286bp DNA fragment.
The PCR reaction system and the PCR amplification procedure of the present invention are preferably the same as those described above, and will not be described in detail herein.
The soybean aphid-resistant gene, the molecular markers and the application thereof provided by the invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the invention.
Example 1
Population construction and phenotypic identification
1. Raw materials: square-top-grain beans (from national institute of crop germplasm, accession number ZDD 00236), were rated for aphid resistance according to the resistance grading criteria of Table 2, and resistance was independent of the number of soybean aphids.
TABLE 2 identification of soybean aphid resistance grading criteria
2、Constructing a population by utilizing square-normal fodder beans, and positioning aphid resistance genes by a map-based cloning method: hybridization of Fangzhengshi beans and North Feng No. 9 of highly susceptible aphid variety (figure 1) and then selfing to construct genetic segregating population of resistant aphid, the resistance identification result shows that F 1 Plants all show aphid resistance, F 2 The aphid-resistant plants and aphid-susceptible plants in the generation population meet 3: the segregation ratio of 1, indicates that the aphid resistance of square-top beans is controlled by a dominant single gene.
Example 2
Determination of resistance Gene location and linkage molecular markers
By utilizing a BSA (cluster separation analysis) method, DNA of aphid-resistant and aphid-sensitive plants is mixed to construct a mixed pool, and primers which have polymorphism among parents and accord with an extreme mixed pool rule are screened from 580 pairs of SSR primers covering the whole genome of soybean in a SoyBase database, and 3 markers such as Satt114, sct_033, satt_335 and the like are found to be resistance linkage markers. Authentication of F by using these 3 linkage markers and encrypting the other markers 2 Plants of the generation and F 2 F formed after multiple generations of selfing of plants 5 The genotype of the generation plant is initially located in combination with the phenotype, and the initial location interval is between markers M1133 and M1184, which is 1.01Mb in total. To further narrow the interval, encryption flag authentication F 5:6 The genotype of the generation plants was combined with the phenotype data and the crossover individuals were screened to reduce the interval to between markers SNPM20 to SNPM80, for a total of 152.8kb (FIG. 2). The interval is not coincident with any interval of aphid-resistant genes published in soybean at present, and is a new aphid-resistant gene.
In order to better utilize aphid-resistant sites carried by square-top-grain soybeans, SNP markers SNPM20 and SNPM80 and SSR markers M1147 and M1151 which are closely linked with a positioning interval are used as linked markers of the aphid-resistant sites and are used for molecular marker auxiliary selection of aphid resistance of offspring groups and other soybean materials.
Specific primers containing both SNPM20 and SNPM80 SNPs were designed using software Primer 5.0 using Williams 82 in the Phytozome database as reference genome (Table 1). At the 30,702,907 base of the reference genome, the genotype of the base is T or G, and when the nucleotide of the SNP locus is T, the identified material is consistent with the genotype of the square-top-grain soybeans and is a material for resisting soybean aphids or a candidate material for resisting soybean aphids; when the nucleotide at the SNP locus is G, the identified material is consistent with the genotype of North Feng No. 9 and is a material for sensing soybean aphid or a candidate material for sensing soybean aphid. At the 30,855,712 base of the reference genome, the genotype of the base is T or G, and when the nucleotide of the SNP locus is T, the identified material is consistent with the genotype of the square-top-grain soybeans and is a material for resisting soybean aphids or a candidate material for resisting soybean aphids; when the nucleotide at the SNP locus is G, the identified material is consistent with the genotype of North Feng No. 9 and is a material for sensing soybean aphid or a candidate material for sensing soybean aphid.
Two molecular markers M1147 and M1151 in the positioning interval, when the size of the band amplified by the M1147 is 228bp, the identified material is consistent with the genotype of the square-stoved beans, and is a material for resisting soybean aphids or a candidate material for resisting soybean aphids; when the size of the band amplified by the M1147 is 211bp, the identified material is consistent with the genotype of North Feng No. 9, and is a material for sensing soybean aphids or a candidate material for sensing soybean aphids. When the size of the band amplified by the M1151 is 286bp, the identified material is consistent with the genotype of the square-fodder beans, and is a material for resisting soybean aphids or a candidate material for resisting soybean aphids; when the size of the band amplified by the M1151 is 239bp, the identified material is consistent with the genotype of North Feng No. 9, and is a material for sensing soybean aphids or a candidate material for sensing soybean aphids.
TABLE 3 marker locus information
Example 3
Verification of molecular markers in offspring populations
Genomic DNA of Fangzhengshi beans, beifeng No. 9 and colony offspring leaves was extracted by using a CTAB method and PCR amplification was performed. The system was 20. Mu.l, including 1. Mu.l of genomic DNA at a concentration of 2 mmol.L -1 2. Mu.l each of the upstream and downstream primers of (2), ddH 2 O4. Mu.l, 2 х M5 HiPerplus Taq HiFi PCR Mix (with blue dye) 10. Mu.l (Beijing Polymer Biotechnology Co., ltd., product No. MF 002-plus-01). The PCR procedure was 95℃denaturation for 3min,95℃denaturation for 25s,58℃annealing for 25s,72℃extension for 10s,34 cycles; extending at 72deg.C for 5min, and preserving at 4deg.C. The above PCR reaction was performed on a PCR amplification thermal cycler from ABI (Applied Biosystems, USA).
The amplified sequences of the SNPM20 and SNPM80 markers were detected by 1% agarose gel electrophoresis, and after obtaining a band consistent with the target band size, the PCR products were sequenced by Beijing Bomaide Gene technologies Co.
The amplified bands of markers M1147 and M1151 were detected by 6% deformed polyacrylamide gel electrophoresis. And (3) dyeing by adopting a silver nitrate dyeing method after electrophoresis, and reading the genotype after dyeing is finished.
PCR amplification was performed on the DNA of 34 lines of square-top beans and North Feng No. 9 and its derivative offspring, the genotypes were analyzed after sequencing the PCR products of SNPM20 and SNPM80, and the genotypes of the PCR products amplified by M1147 and M1151 were detected by denaturing polyacrylamide gel electrophoresis, FIG. 3 is a marker M1147 amplification electrophoretogram, FIG. 4 is a marker M1151 amplification electrophoretogram, and the genotype statistics are listed in Table 4. The result shows that the genotypes of 4 markers in 11 strains are consistent with the genotypes of the square-grain beans, the genotype of the SNPM20 is TT, the genotype of the SNPM80 is TT, the PCR product amplified by M1147 is 228bp, and the PCR product amplified by M1151 is 286bp; the genotypes of 4 markers in the 11 strains are consistent with the genotypes of North Feng No. 9, the genotypes of SNPM20 are GG, the genotypes of SNPM80 are GG, the PCR products amplified by M1147 are 211bp, and the PCR products amplified by M1151 are 239bp; the genotype of 4 markers in the 12 strains is heterozygous genotype, the genotype of SNPM20 is GT, the genotype of SNPM80 is GT, the PCR product amplified by M1147 is two bands, one 228bp and one 211bp, and the PCR product amplified by M1151 is two bands, one 286bp and one 239bp.
Further aphid resistant phenotypes were performed for these lines, the phenotypes of each line are recorded in Table 4, where the material name/numbering rule is L-line number-individual number, e.g.L-827-2 represents the 2 nd individual of line 827. The results show that the plant phenotypes consistent with the square-top fodder bean genotypes are aphid resistance, the plant phenotypes consistent with the North Feng No. 9 genotypes are aphid resistance, and the plant phenotypes with heterozygous genotypes are aphid resistance. It is illustrated that the SNPs and SSRs can be used to identify aphid resistance of a square-top grain population and its derived offspring.
TABLE 4 verification of molecular markers
The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims (7)

1. A molecular marker M1147 closely linked to a soybean aphid resistance gene, wherein the aphid resistance gene is located between physical positions 30,700,000 ～ 30,900,000 on chromosome 13 of the soybean genome;
the amplified fragment of M1147 in aphid-resistant soybean is 228bp, and the amplified fragment in aphid-sensitive soybean is 211bp.
2. A primer pair for identifying the molecular marker of claim 1, which is characterized by comprising M1147-F and M1147-R, wherein the nucleotide sequence of the M1147-F is shown as SEQ ID NO.5, and the nucleotide sequence of the M1147-R is shown as SEQ ID NO. 6.
3. Use of the molecular marker M1147 of claim 1 or the primer pair of claim 2 in soybean molecular marker assisted breeding.
4. The soybean aphid-resistant molecular marker detection method is characterized by comprising the following steps of: mixing soybean genome DNA as template with the primer pair of claim 2 to prepare PCR reaction system for PCR amplification.
5. The method according to claim 4, wherein the PCR amplification procedure comprises: pre-denaturation at 95℃for 3min; denaturation at 95℃for 25s, annealing at 58℃for 25s, extension at 72℃for 10s,34 cycles; extending at 72℃for 5min.
6. The method for detecting a molecular marker according to claim 4 or 5, wherein the PCR reaction system comprises, in 20. Mu.L: 1. Mu.L of template, 2. Mu.L of each of the upstream and downstream primers, 2 х M5 HiPerplus Taq HiFi PCR Mix. Mu.L and the balance ddH 2 O。
7. A method for screening aphid-resistant soybeans, comprising the steps of: mixing soybean genome DNA as a template with the primer pair of claim 2 to prepare a PCR reaction system, and carrying out PCR amplification;
and detecting the PCR product, wherein the variety (strain) of the DNA fragment of 228bp amplified by the molecular marker M1147 is aphid-resistant soybean.
CN202311216131.9A 2022-01-05 2022-01-05 Molecular marker M1147 closely linked with soybean aphid resistance gene and application Pending CN117385077A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311216131.9A CN117385077A (en) 2022-01-05 2022-01-05 Molecular marker M1147 closely linked with soybean aphid resistance gene and application

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202311216131.9A CN117385077A (en) 2022-01-05 2022-01-05 Molecular marker M1147 closely linked with soybean aphid resistance gene and application
CN202210003867.7A CN114438094B (en) 2022-01-05 2022-01-05 Soybean aphid-resistant gene, molecular marker and application thereof

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN202210003867.7A Division CN114438094B (en) 2022-01-05 2022-01-05 Soybean aphid-resistant gene, molecular marker and application thereof

Publications (1)

Publication Number Publication Date
CN117385077A true CN117385077A (en) 2024-01-12

Family

ID=81366011

Family Applications (4)

Application Number Title Priority Date Filing Date
CN202311212606.7A Pending CN117004761A (en) 2022-01-05 2022-01-05 Molecular marker SNPM80 closely linked with soybean aphid resistance gene and application
CN202311216131.9A Pending CN117385077A (en) 2022-01-05 2022-01-05 Molecular marker M1147 closely linked with soybean aphid resistance gene and application
CN202311216215.2A Pending CN117265158A (en) 2022-01-05 2022-01-05 Molecular marker M1151 closely linked with soybean aphid resistance gene and application thereof
CN202210003867.7A Active CN114438094B (en) 2022-01-05 2022-01-05 Soybean aphid-resistant gene, molecular marker and application thereof

Family Applications Before (1)

Application Number Title Priority Date Filing Date
CN202311212606.7A Pending CN117004761A (en) 2022-01-05 2022-01-05 Molecular marker SNPM80 closely linked with soybean aphid resistance gene and application

Family Applications After (2)

Application Number Title Priority Date Filing Date
CN202311216215.2A Pending CN117265158A (en) 2022-01-05 2022-01-05 Molecular marker M1151 closely linked with soybean aphid resistance gene and application thereof
CN202210003867.7A Active CN114438094B (en) 2022-01-05 2022-01-05 Soybean aphid-resistant gene, molecular marker and application thereof

Country Status (1)

Country Link
CN (4) CN117004761A (en)

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2589574C (en) * 2004-06-21 2018-12-18 United States Of America As Represented By The Secretary Of Agriculture Soybean genes for resistance to aphis glycines
WO2006125065A2 (en) * 2005-05-18 2006-11-23 The Board Of Trustees Operating Michigan State University Resistance to soybean aphid in early maturing soybean germplasm
US8227662B2 (en) * 2005-05-18 2012-07-24 Board Of Trustees Of Michigan State University Markers for aphid resistant germplasm in soybean plants
US20130198912A1 (en) * 2010-02-05 2013-08-01 The Board Of Trustees Of The University Of Illinois Dna sequence that confers aphid resistance in soybean
US10253329B2 (en) * 2013-01-04 2019-04-09 Board Of Trustees Of Michigan State University Sources of aphid resistance in soybean plants

Also Published As

Publication number Publication date
CN117265158A (en) 2023-12-22
CN114438094B (en) 2023-10-27
CN114438094A (en) 2022-05-06
CN117004761A (en) 2023-11-07

Similar Documents

Publication Publication Date Title
Kitomi et al. QTLs underlying natural variation of root growth angle among rice cultivars with the same functional allele of DEEPER ROOTING 1
CN107338310B (en) Marker for detecting wheat scab-resistant gene PFT and using method thereof
CN109913577B (en) Molecular marker closely linked with wheat stripe rust resistance gene Yr1152 and application thereof
EP2355651B1 (en) Genetic loci associated with northern leaf blight resistance in maize
CN111893209B (en) Indel site detection marker related to thousand grain weight of wheat and application thereof
CN106555001A (en) A kind of molecular labeling of rice blast resistant gene and its application
CN104152450A (en) InDel molecular marker co-separated with cucumber powdery mildew resistance main effect gene
CN112195268B (en) Molecular marker, primer, application and variety breeding method closely linked with origin green peach aphid resistance character of cultivar
CN107988414B (en) dCAPS marker for auxiliary detection of soybean hundred-grain weight and application thereof
Imerovski et al. Identification and validation of breeder-friendly DNA markers for Pl arg gene in sunflower
CN109486829B (en) Rice semi-dwarf gene sd1 allele and identification method thereof
Řepková et al. New CAPS marker for selection of a barley powdery mildew resistance gene in the Mla locus
CN114480709B (en) Molecular marker for detecting wheat leaf rust resistance gene Lr47, detection method and application thereof
CN114438094B (en) Soybean aphid-resistant gene, molecular marker and application thereof
CN115976266A (en) InDel functional molecular marker BW07-InDel closely linked with cotton boll size of upland cotton and application thereof
CN112266976B (en) CAPS molecular marker, primers, detection method, detection kit and application based on tomato gray leaf spot resistance gene Sm
CN111041122B (en) Indel molecular marker of wheat leaf rust resistance gene Lr13 and application thereof
Prabhu et al. Marker assisted selection for biotic stress resistance in wheat and rice
CN111004857A (en) Molecular marker primer of major QTL (quantitative trait locus) site of soybean branch number and application of molecular marker primer
CN109338001B (en) Molecular marker for identifying rice semi-dwarf gene sd1 allele and dwarf gene identification method
CN109468400B (en) Rice blast resistance gene Pi36 codominant molecular marker and application thereof
CN113215296B (en) Rice awn length genegna1Molecular marker of (3), and identification method and application thereof
CN116024368B (en) Molecular marker closely linked with soybean plant high-efficiency gene locus and application thereof
CN116640878B (en) Molecular marker of wheat floret number QTL per spike developed based on novel mode of multi-single-combined-standard-evidence and application thereof
CN111826461B (en) Development and application of molecular marker of sorghum miscanthus

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination