CN117384991A

CN117384991A - Preparation method and application of high-bioactivity cyclic peptide

Info

Publication number: CN117384991A
Application number: CN202311027903.4A
Authority: CN
Inventors: 李小静; 黄虎; 常怀龙
Original assignee: Shanghai Zhongyi Daily Chemical Co ltd
Current assignee: Shanghai Zhongyi Daily Chemical Co ltd
Priority date: 2023-08-15
Filing date: 2023-08-15
Publication date: 2024-01-12

Abstract

The invention provides a preparation method and application of a high-bioactivity cyclic peptide. The preparation method has high yield, is easy to purify, can obtain a high-purity cyclic peptide product, and is suitable for large-scale industrial production. The invention provides the enzyme for preparing the cyclopeptide, the sequence is designed, the mutation is oriented, four mutant enzymes with outstanding effects are obtained after screening, and the best effect is found. The novel preparation method and the directionally designed mutant enzyme enable the prepared cyclic peptide to have high bioavailability, the effects of resisting photoaging and wrinkle, and the performances of resisting enzymolysis and high skin penetration, and the effects are more remarkable due to the performances. The preparation method is mainly applied to the aspects of toner, mask, essence, emulsion, cream and freeze-dried powder in the fields of cosmetics and beauty and skin care, and has wide application prospect.

Description

Preparation method and application of high-bioactivity cyclic peptide

Technical Field

The invention relates to the technical field of chemical synthesis and bioengineering, in particular to a preparation method and application of high-bioactivity cyclic peptide, and specifically relates to a preparation method based on collagen small molecule cyclic peptide and application of the collagen small molecule cyclic peptide in anti-aging effect in the fields of cosmetics, beauty and skin care.

Background

Cyclic peptides (or cyclic peptides), belonging to one of the classes of polypeptides, such as the simplest cyclic peptides, are peptide bonds formed by reacting together two end groups to block the peptide backbone; there are also cyclic peptides in which covalent bonds are created between their terminal amine and side chains or between terminal carboxyl groups and side chains or between two side chains, thereby rendering the peptide molecule partially cyclic. Cyclic peptides have many advantages over conventional peptides, such as they are less susceptible to exopeptidases and more stable than their linear counterparts; cyclic peptides, due to the curvature of their backbone and the small degrees of freedom, many of the bonds' rotations are blocked, with side chains that are more available for interaction with external targets, with increased strength of interaction with their targets, adjacent amino acids do not interfere with molecular interactions. They have a strong bioavailability compared to linear peptides and are widely used in the medical and biological fields. In recent years, scientists prove that the cyclopeptide has the characteristics of long in vivo half-life, relatively stable structure, strong permeability and the like, so that the external cyclopeptide-containing product can play a certain role in nursing, defending and slowing down aging, and the development of the cyclopeptide has a certain innovation and practicability in the field of beauty and skin care.

The synthesis of cyclic peptides is consistent with the current methods of polypeptide synthesis, e.g., polypeptide synthesis is largely divided into chemical synthesis and biological synthesis. Classical polypeptide chemical synthesis methods include Liquid Phase Polypeptide Synthesis (LPPS) and Solid Phase Polypeptide Synthesis (SPPS), such as the construction of amide functionalities by sequential addition of peptide chains to the synthesis intermediates, using solid or liquid phase media.In the preparation, amino acid functional groups which do not want to participate in the reaction are protected, then chemical coupling is sequentially carried out, and finally deprotection is carried out, the chemical synthesis method is suitable for the synthesis of short chains such as dipeptide, tripeptide and the like, but for the synthesis of longer polypeptide chains, the problems of more reaction steps, more byproducts and intermediates, low overall yield, racemate, high purification cost and the like can occur; at present, many strategies have been developed for the construction of cyclic peptides, such as the use of Cu-catalyzed alkynyl [3+2 ]]Cycloaddition, ru-catalyzed olefin metathesis, pd-catalyzed cysteine Cys SH and lysine Lys NH ₂ The arylation of (C), the formation of disulfide bonds without metal catalysis, the formation of oxadiazoles and the Petasis-borono-Mannich reaction. The disadvantages of these strategies are: the introduction of unnatural amino acids is required; transition metal catalysis is required; nonaqueous solvents and the like are required.

The biosynthesis method mainly uses protein expression or gene recombination of a biological system to express the polypeptide fusion protein in a host, and then obtains the target polypeptide through protein purification and polypeptide release. The method is not influenced by the length and sequence of the polypeptide, can simply and efficiently synthesize the polypeptide, has few byproducts, but the biosynthesis method needs the steps of strain crushing and protein purification, improves the production cost of the polypeptide, restricts the synthesis scale, has stronger orientation in the prior application, and is limited by the synthesis of the polypeptide of natural amino acid. Biotechnology, especially enzymatic construction of amide bond synthesis polypeptides, is a relatively economical and green synthetic strategy. Unlike chemical method principle, the regioselectivity and the stereoselectivity of the enzymatic polypeptide connection method are derived from the steric hindrance of the enzyme active center and the non-covalent effect between groups, so that the basic requirements of polypeptide splicing on regioselectivity and racemization inhibition are met, and the enzymatic polypeptide connection method plays an increasingly important role in the field of synthesis of polypeptides and proteins.

The natural polypeptide compounds synthesized by bacteria or fungi through self metabolism, such as penicillin, cyclosporine, echinocandins and the like, are important source springs for the creation of new medicines at home and abroad. Namely, the biosynthesis pathway is divided into two types, one type is condensed, modified and cyclized by ribosome-derived polypeptide, and the other type is highly modular The non-ribosomal polypeptide synthase (NRPS) with blocking characteristics assembles natural or non-natural amino acids one by one, and the mechanism has high efficiency and flexible specificity, thereby ensuring the diversity of the natural polypeptide product structure. (DOI: 10.12211/2096-8280.2020-064). As a matter of course, the asparagine/aspartic acid (Asx) peptide ligase-butenase 1 was found. The high efficiency enzyme is isolated from cyclopeptide-producing medicinal plant Clitoria ternatea. Butelase 1 has 71% sequence identity and the same catalytic triplets as legumain protease, but does not hydrolyze legumain protease substrates. In contrast, butenase 1 cyclizes various peptides of vegetable and animal origin in yields greater than 95%. The catalytic efficiency of the butenase 1is as high as 542000M ^-1 s ^-1 The fastest peptide ligases are known. Notably, butenase 1 also shows broad specificity for the N-terminal amino acid of the peptide substrate, providing a new tool for C-terminal specific intermolecular peptide ligation. ( Nguyen, giang K T; wang, shujin; qiu, yibo; hemu, xinya; lian, YIlon; tam, james P (2014). Butelase 1is an Asx-specific ligase enabling peptide macrocyclization and synthosis. Nature Chemical Biology,10 (9), 732-738. )

In addition, ATP-granzyme (ATP-dependent carboxylic acid-amine ligase) is a good candidate for the synthesis of short oligopeptides. ATP-grasp enzymes are widely distributed in nature and are capable of catalyzing the formation of amide bonds by activating carboxylic acids as acyl phosphate intermediates with the concomitant hydrolysis of ATP. In the ATP-grasp superfamily, L-amino acid ligases (Lals: EC 6.3.2.28) can accept two unprotected L-amino acids as their optimal substrates, catalyzing peptide bond biosynthesis in an ATP-dependent manner. This reaction is unidirectional; furthermore, no complex substrate protection or derivatization procedures are required.

The collagen in the skin is closely related to skin aging, wherein the polypeptide of the sequence Pro-x-Gly Pro is a homologous sequence fragment of the collagen, has low molecular weight and can effectively permeate into the stratum corneum and the dermis, so that the collagen is widely used in skin care products such as moisturizing, wrinkle preventing, repairing, breast enlarging and the like. However, the collagen small molecule is easily identified and hydrolyzed by the protease of the organism, and the bioavailability is greatly reduced, so that the stability and the bioavailability can be greatly improved through cyclization modification. Meanwhile, the space structure complexity is improved, the specific surface area is increased, more contact possibility with the target point is provided, and the effects of improving the effects of more diversity and multiple dimensions are achieved. The Chinese patent application of CN 111670027A discloses the use of cyclic peptide in beautifying and proves its application in beautifying and skin care. Aiming at the synthesis and preparation of cyclic peptides, the application number of China is 202210368579.1, and discloses a preparation method of cyclic hexapeptide, which adopts the traditional solid phase to synthesize a linear peptide long chain, then cyclizes the linear peptide long chain by using a chemical condensing agent to obtain the cyclic hexapeptide and the derivative thereof, and finally separates and purifies the cyclic hexapeptide to obtain the related cyclic hexapeptide and the derivative thereof. The Chinese patent application No. CN 115820578A discloses a preparation method of small molecular collagen tripeptide, which adopts amino acid ligase to sequentially connect L-glycine, L-proline and L-hydroxyproline so as to generate collagen tripeptide with high conversion rate, and finally separates and purifies the collagen tripeptide to obtain related tripeptides.

There is therefore still a need in the art for improved means for cyclizing peptides that overcome the drawbacks of the prior art and that are ideally simple, fast and versatile. It is an object of the present invention to provide a simple and feasible cyclization synthesis strategy for such specific sequences, which increases the synthesis yield of polypeptide molecules. Chemical methods are used in combination with enzymatic ligation methods to establish diverse cyclic peptide synthesis strategies.

Disclosure of Invention

In order to solve the problems, the invention aims to provide a preparation method and application of a cyclic peptide with high bioactivity. By innovating a high-efficiency and simpler chemical-enzyme synthesis method for synthesizing polypeptide, L-glycine, L-proline and L-glutamine are sequentially connected to generate collagen tripeptide with high conversion rate, and then a series of target products, namely cyclized polypeptide, can be rapidly generated through mild and simple amino acid ligase (biological enzyme) catalytic amide synthesis reaction. Compared with the common methods such as purification and extraction, enzyme cutting process, chemical synthesis and the like in the market, the large-scale production process of the method is stable, and meanwhile, the method is high in purity, few in byproducts and remarkably superior to the pure chemical synthesis method. The polypeptide synthesis method combines the advantages of atom economy and environmental friendliness, combines the organic and biological conversion of the compound, improves the synthesis efficiency, can more quickly, economically and efficiently synthesize the polypeptide and the derivative thereof on a large scale, minimizes the solvent consumption, protects the environment, has easily obtained raw materials, reduces the waste of raw materials, reduces the pollution of waste, is beneficial to environmental protection, and has obvious practical application value in organic synthesis and polypeptide chemistry. The series of cyclic peptides are mainly applied to the field of beauty and skin care, and characteristic researches are carried out on the cyclic peptides, so that the cyclic peptides have excellent stability, are not easy to degrade, have very strong skin permeability, promote collagen generation and other capacities, and have stronger application potential in the fields of beauty and skin care and medical and anti-aging.

The invention is based on the enzyme L-glutamate ligase (EC 6.3.2.60) peptide ligase/cyclase and mutants thereof. The mutant enzyme can connect/cyclize peptide with very high catalytic activity, recognizes L-glutamic acid at the C-terminal, does not need to be modified by other groups, has high cyclization synthesis efficiency, does not need subsequent complicated purification and the like. Notably, the enzyme is not only effective in the cyclization of the corresponding amino acids and short peptide fragments, which makes it highly versatile and useful in a variety of applications where cyclization of given L-glutamic acid, glutamine-containing peptides, macrocyclic oligopeptides or proteins is desired, enriching its use in medicine and the like. The cyclic peptide and the cyclic peptide mixture obtained by synthesis have excellent biological activity and can be applied to the fields of beauty, skin care and the like.

The function of the L-glutamate ligase (EC 6.3.2.60) peptide ligase/cyclase and mutants thereof mentioned in the present invention is not limited to the preparation of cyclic peptides and may be used for the preparation of other peptides.

The small molecule short peptide is suitable for organic synthesis, the organic synthesis yield of long chain peptide is lower, and the enzyme synthesis has strict requirements on enzyme and corresponding structure, such as specific enzyme, specific structure and enzymatic synthesis, namely enzyme specificity. Not all peptide bonds can be synthesized, and various factors and conditions affecting the yield of peptide bond synthesis may vary from reactant to reactant; the invention researches and obtains the preparation method of the high-bioactivity cyclic peptide through a large number of synthesis experiments.

The preparation route is shown in the formula (2), the steps before cyclization are all carried out through organic synthesis, and the amide cyclase of the cyclization reaction is one or more of mutants of L-glutamate ligase EC 6.3.2.60 and L-glutamate ligase EC 6.3.2.60; the nucleotide sequence of the mutant of the L-glutamate ligase EC 6.3.2.60 is any one of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4. The R group of the ring (Gly-Pro-Gln-Gly-Pro-Gln) in the formula (2) is (CH) ₂ ) ₂ CONH ₂ 。

The invention provides a cyclic peptide, wherein 3-6 amide bonds are contained in the ring of the cyclic peptide, and the cyclic peptide is respectively a sequence ring (Gly-Pro-Gln), a sequence ring (Gly-Pro-Gln-Gly-Pro) and a sequence ring (Gly-Pro-Gln-Gly-Pro-Gln). The corresponding cyclic peptide product is prepared by cyclizing the amide bond with high yield under the action of Adenosine Triphosphate (ATP) and corresponding ligase. The prepared cyclic structure has amide bond, and several rings represent several amide bonds on the cyclic structure, for example six rings represent six amide bonds on the cyclic structure.

The cyclic peptides of the invention and derivatives thereof or salts thereof may exist as stereoisomers or mixtures of stereoisomers; for example, the amino acids comprising them may have the configuration L-, D-, or be racemic independently of each other. Thus, it is possible to obtain isomeric mixtures as well as racemic mixtures or diastereomeric mixtures, or pure diastereomers or enantiomers, depending on the number of asymmetric carbons and what isomers or isomeric mixtures are present. The preferred structures of these peptides of the invention are pure isomers, i.e., enantiomers or diastereomers.

The preparation method provided by the invention can also be used for preparing cyclic peptide derivatives or salts thereof; the cyclic peptide derivatives include: a ring of formula (2) (Gly-Pro-Gln-Gly-Pro-Gln), wherein the R group is selected from H, (CH) ₂ ) _n CH ₃ 、(CH ₂ ) _m NH ₂ 、(CH ₂ ) _x COOA1、(CH ₂ ) _m Any one of CONA 2; wherein n, m, x are independently selected from 0 or natural numbers; a1 and A2 are independently selected from H ₂ 、OH、NH ₂ Any one or more of COOH, C1-18 alkyl, phenyl, heteroaryl.

The salt of the cyclic peptide derivative includes a metal salt of the cyclic peptide derivative, the metal including: lithium, sodium, potassium, calcium, magnesium, manganese, copper, zinc or aluminum.

The salt of the cyclic peptide derivative includes a salt of the cyclic peptide derivative with an organic base including: ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, arginine, lysine, histidine or piperazine.

The salt of the cyclic peptide derivative includes a salt of the cyclic peptide derivative with an inorganic acid or an organic acid including: acetic acid, citric acid, lactic acid, malonic acid, maleic acid, tartaric acid, fumaric acid, benzoic acid, aspartic acid, glutamic acid, succinic acid, oleic acid, trifluoroacetic acid, oxalic acid, pamoic acid or gluconic acid; the inorganic acid includes: hydrochloric acid, sulfuric acid, boric acid or carbonic acid.

The preparation method provided by the invention is not limited to Gln, gly, pro three amino acids, other natural amino acids and unnatural amino acids, and can be used for preparing the cyclic peptide, but the preparation yield, purity, biological activity and the like depend on the activity and selectivity of the ligase, so that the possibility that other cyclic peptides can be prepared with high yield, high purity and high biological activity after the ligase mutation is not excluded.

In one aspect, the invention provides a method for preparing a cyclic peptide, comprising the steps of organically synthesizing a short peptide sequence or a fragment thereof, and then performing enzymatic cyclization to prepare a corresponding cyclic peptide product; the enzymes include one or more of L-glutamate ligase EC 6.3.2.60, mutants of L-glutamate ligase EC 6.3.2.60; the nucleotide sequence of the mutant of the L-glutamate ligase EC 6.3.2.60 is any one of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4.

Furthermore, the nucleotide sequence of the mutant of the L-glutamate ligase EC 6.3.2.60 is shown as any one of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4, and the sequence is deleted, substituted, inserted or added with 1 to 10 amino acid residues.

Further, the nucleotide sequence of the mutant of the L-glutamate ligase EC 6.3.2.60 is shown as a sequence with 85% or more identity with the sequence shown in any one of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4.

The identity of the above sequences can be carried out by known means such as FASTA search, BLAST search, etc., and the sequences having identity belong to the mutants of the present invention.

Preferably, the nucleotide sequence of the mutant of the L-glutamate ligase EC 6.3.2.60 is the sequence shown in SEQ ID NO. 4.

Under the catalytic cyclization of mutant enzyme with the sequence of SEQ ID NO. 4, the yield of the cyclic peptide is highest, the purity of the purified cyclic peptide is highest, and the prepared cyclic peptide has the best effect on the effects of resisting photoaging and wrinkle and has the highest enzymolysis resistance and skin permeation resistance.

Further, the cyclic peptide contains Gln, which is located at the beginning or end of the short peptide sequence or a fragment thereof in the cyclization reaction.

The mutant enzyme obtained by the design and the directed mutation has high specificity of connecting Gln with other amino acids; the mutant is selected for pertinence, the mutant is subjected to directional mutation, and the existing mutant and the enzyme obtained by expression thereof can be obtained after screening, so that the target product can be efficiently synthesized. In the synthesis of target molecules, as in the case of amide bond ligases, the L-glutamate ligases catalyze the coupling of glutamate/glutamine to any amino acid to form peptide bonds, and thus cyclize.

Further, the cyclic peptide has 3 to 6 amide bonds in the ring.

Further, the cyclic peptide is prepared by amide bond synthesis and enzyme catalytic cyclization of Gln, gly, pro amino acids.

In another aspect, the present invention provides a cyclic peptide prepared by the above-described method for preparing a cyclic peptide.

The cyclic peptide prepared by the preparation method of the cyclic peptide has better effects of resisting photoaging and wrinkling, and higher enzymolysis resistance and skin permeation resistance which are not possessed by cyclic peptides prepared by other preparation methods.

The invention also carries out comparison tests on the effects of the cyclic peptides prepared by different methods, and discovers that the cyclic peptides prepared by the chemical-enzymatic synthesis method provided by the invention are excellent in promoting the expression of the Collagen I gene, resisting protease enzymolysis and transdermal permeation effects, and are superior to the cyclic peptides prepared by the conventional methods (total chemical synthesis, total enzymatic synthesis and chemical-natural enzymatic synthesis), so that the cyclic peptides prepared by the preparation method provided by the invention have higher biological activity.

The possible reasons for the above phenomena are: on the one hand, the product obtained by the chemical-enzymatic synthesis method has high yield and easy purification, and the purified cyclic peptide has high purity and high content and can obtain better effect; on the other hand, other beneficial factors, such as more stable conformation of the cyclic peptide, no impurity for antagonizing the cyclic peptide and the like, are introduced due to different production processes, and the beneficial factors lead the cyclic peptide prepared by the invention to have higher biological activity. The fragment synthesis-enzymatic cyclization method provided by the invention has production and manufacturing significance and can be more beneficial to application.

Further, the cyclic peptide comprises a specific amino acid and/or a specific sequence loop (Gln-Gly-Pro-x); at least one Gln, gly, pro; and/or at least two glutamine Gln, one Gly, one proline Pro; and/or at least two gins, one Gly, one Pro; and/or at least two Gln, gly, pro sequences; or an enantiomer thereof;

in another aspect, the invention provides an enzyme for preparing a cyclic peptide, said enzyme being directionally mutated by the L-glutamate ligase EC 6.3.2.60; the nucleotide sequence of the enzyme is any one of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4.

Preferably, the nucleotide sequence of the enzyme is a sequence shown as SEQ ID NO. 4.

In another aspect, the present invention provides the use of the above-described enzyme for the preparation of high purity cyclic peptides with high conversion, wherein the cyclic peptides are prepared by first organically synthesizing short peptide sequences or fragments thereof and then cyclizing the short peptide sequences or fragments thereof by the enzyme catalysis to obtain cyclic peptide products.

In another aspect, the invention provides a use of a cyclic peptide prepared by the preparation method for preparing a photoaging-resistant preparation, wherein the cyclic peptide prepared by the preparation method can promote the expression of a Collagen I gene and resist the reduction of the Collagen I Collagen under UV irradiation.

On the other hand, the invention provides an application of the cyclopeptide prepared by the preparation method in preparing an anti-wrinkle preparation, wherein the cyclopeptide prepared by the preparation method can promote the expression of a Collagen I gene, promote the increase of the Collagen I content and achieve the effect of resisting the generation of wrinkles.

Collagen is mainly produced by fibroblasts existing in the dermis layer of the skin and is an important element for supporting the skin, wherein Collagen I is the specific gravity of Collagen I accounting for about 80% of the dermis layer of the skin, so that the skin is full, the increase of the content of the Collagen I is promoted, and the effect of resisting the generation of wrinkles can be achieved to a certain extent. The reduction of the Collagen I can be obviously seen by the isolated skin irradiated by UV, and the cyclic peptide provided by the invention has the effects of resisting photoaging and resisting wrinkles by promoting the expression of the Collagen I gene and the increase of the Collagen I content.

On the other hand, the invention provides the application of the cyclic peptide prepared by the preparation method in preparation of a preparation which is not easy to degrade, and the cyclic peptide prepared by the preparation method is characterized by having protease enzymolysis resistance.

In another aspect, the present invention provides the use of a cyclic peptide prepared by the above preparation method for preparing a formulation for improving skin penetration, characterized in that the enzyme in the preparation method is capable of improving the penetration properties of the product cyclic peptide.

The beneficial effects of the invention include:

1. the series of collagen small molecule cyclic peptides and the derivatives thereof are obtained through a chemical synthesis-biological enzyme catalytic connection synthesis method, are convenient to synthesize, are safe and non-irritating to human bodies, and can be applied to the field of cosmetics.

2. It should be noted that the method adopts a mode of respectively synthesizing two sequences, and then carries out a specific enzyme catalytic cyclization, and the step can greatly improve the synthesis speed of the polypeptide; it is a further object of the present invention to increase the crude purity to provide a final polypeptide product with higher purity (> 95%).

3. In addition, in the solid-phase synthesis of the polypeptide, reaction sites are embedded due to the formation of certain secondary structures, so that the synthesis difficulty is increased, and the formation of the secondary structures can be prevented by the fragment enzyme condensation method, so that the synthesis difficulty is obviously reduced, and the method is also an important advantage which is not possessed by the traditional method.

4. The cyclic peptide and the derivative or the salt thereof can resist enzymolysis, have better stability and bioavailability, improve the activity of fibroblasts, promote the proliferation of the fibroblasts, promote the generation of collagen, repair skin barriers (photodamage repair and scratch repair), increase skin elasticity, improve skin firmness, prevent and even treat skin relaxation, treat, prevent or repair skin aging or photoaging, have good skin repair and tightening effects, and can be applied to products such as skin repair, tightening and wrinkle resistance.

Drawings

FIG. 1 peptide cyclization schematic

FIG. 2 promotion rate of various cyclopeptides samples on the Collagen I Gene

Detailed Description

The invention will be further elaborated in connection with the drawings and the specific embodiments described below, which are intended to illustrate the invention only and are not intended to limit the scope of the invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials, reagents and the like used, unless otherwise specified, are those commercially available.

In the present specification, a peptide cyclase is an enzyme having the effect of cyclizing a peptide by binding an amino group present at one portion (e.g., one amino acid residue) forming the peptide with a carboxyl group present at another portion (e.g., another amino acid residue) to produce a peptide bond. The peptide cyclases of the present invention cyclize peptides in a head-to-tail fashion, allowing the production of large cyclic peptides, as shown in FIG. 1.

Example 1: preparation of mutant enzymes

In some embodiments of the invention, ligase 1 (EC 6.3.2.60, 849NT seq) master is derived from archaebacteria Sulfolobus, characterizing caldarius acid. L-glutamate ligase (EC 6.3.2.60) and mutants 1 (SEQ ID NO: 1) and 2 (SEQ ID NO: 2) thereof; and their mutant 3 (SEQ ID NO: 3), mutant 4 (SEQ ID NO: 4) and the like, the cyclized amino acid ligase sequences are shown below:

l-glutamate ligase (EC 6.3.2.60) nucleotide sequence:

atgagagtagcacttgtcgttgacatagtaagacaagaggaaaaactaattgctaaagcactggaaaaatttcaattacaatatgatgtaattaatgtggcacaagagcccttaccttttaacaaagccttaggaagatatgatgtggcaatcataagacctataagtatgtatagggcactctacgcatcagcagttttggaatcagctggtgttcacaccataaactcaagtgatactattagtttatgtggagacaagattttaacatactcaaagctgtatagagagggcataccaatacctgactctataattgccatgtcatcagatgctgcattaaaagcctatgaacaaaaaggatttccactgatagataaaccaccaataggtagctggggaagactagtatctctcataagggacattttcgaaggtaaaaccataattgaacatagggagttgatgggcaactctgctcttaaagttcacatagttcaggagtacattaactacaaaagcagggacataaggtgtattgtgataggtagtgagcttctaggttgttacgctaggaatataccttctaacgaatggagagcaaatattgctttaggcggttatccatcgcagatagaggtagaccataaactaaaagagactgtattaaaggctacgagtattataggtggagagttcgtatccatagatgtaatggagcaccaatctaaaaattacgttataaacgagtttaatgacgttccagagttcaaaggatttatgttggctaccaatattgatgtagcggaagagctagtgagctatgtgaaaaataattacctcaggtaa

mutant 1 (SEQ ID NO: 1) nucleotide sequence: the mutant 1 is obtained by mutating K15R, T80N, K120E, I150M, E151G, H152Q, R153K, R200S, S210P, Q211P, H241Q, Q242P

Mutant 2 (SEQ ID NO: 2) nucleotide sequence: the mutant 2 is obtained by mutating K15R, T80N, K120E, I149K, I150M, E151G, H152Q, R200S, S210P, Q211P, H241Q, Q242P

Mutant 3 (SEQ ID NO: 3) nucleotide sequence: the mutant 3 is obtained by mutating K15R, T80N, K120E, E151G, H152Q, R153K, E154Q, R200S, A201E, N202S, H241Q, Q242P

Mutant 4 (SEQ ID NO: 4) nucleotide sequence: the mutant 4 is obtained by mutating K15R, T80N, K120E, I149M, I150M, E151G, H152Q, R153K, L155F, R200S, A201E, N202S, S210P, Q211P, H241Q, Q242P

The examples of the present invention relate to mutants of SEQ ID No. 1-4, and the desired enzyme is produced by constructing a specific expression vector after the corresponding gene is synthesized by a entrusted company and then fermenting the expression vector with E.coli. The raw materials and reagents used are commercially available, and the fermentation production of enzymes is related to:

the method specifically comprises the following steps:

(1) Mutant gene preparation: and carrying out directed mutation on the gene corresponding to the amidation enzyme ligase 1, carrying out sequence optimization as shown in SEQ ID NO. 1-4, and obtaining the corresponding mutant gene in a synthetic mode.

(2) Preparation of recombinant plasmid: the nucleic acid sequence of the 1-4 mutant gene was introduced into a pET 28a (pET-28 a (+) vector) linearized expression vector cleaved with NdeI/XhoIA (NdeI restriction enzyme/XhoI endonuclease) to form a recombinant plasmid having the mutant gene sequence.

(3) Cell culture and enzyme expression containing recombinant plasmid: plasmid with correct sequence is transferred into E.coli (BL 21) competent cells for plate culture and monoclonal small-volume liquid culture, and E.coli with correct protein expression is finally subjected to gradual amplification liquid culture. Examples of preferred cells for use in the method include, but are not limited to, cells of microorganisms such as E.coli (Escherichia coli) and Bacillus subtilis (Bacillus subtilis), and the like. And when the cells grow to the logarithmic phase, inoculating the cells into LB culture solution, and subsequently transferring the cells into a 5L culture fermentation tank for culture and final protein expression. Protein expression was induced at 25℃for 4-6 hours by addition of 0.5mM isopropyl beta D thiogalactopyranoside (IPTG) at cell OD-20.

(4) Protease expression screening: the cells were collected by high-speed centrifugation (4000 rpm,20 min) to obtain 25-50 g of wet cells with over-expressed enzyme. A small amount of cells are firstly mixed with a buffer solution (50 mM, pH 8.0) of tris (hydroxymethyl) aminomethane hydrochloride (Tris.HCl) on an ice basin uniformly, then the cells are broken by a freeze thawing method, and clear liquid is subjected to SDS PAGE gel electrophoresis (sodium dodecyl sulfate polyacrylamide gel electrophoresis) after cell walls are removed by high-speed centrifugation to determine protein expression.

(5) Enzyme extraction: specifically, the remaining cells were mixed with Tris HCl buffer (50 mM, pH 8.0) at a low temperature (mixing with 10g of wet cells: 200mL of buffer), followed by crushing the cell wall at a low temperature Gao Yapo, and obtaining an enzyme-containing supernatant for use after removing the cell wall by high-speed centrifugation (the enzyme activity obtained was 250 to 500U/mL, U is the amount of enzyme required for converting 1. Mu. Mol of substrate at room temperature for one minute). Wherein the LB medium is composed of: 1% peptone, 0.5% yeast powder, 1% NaCl,1% dipotassium hydrogen phosphate and 5% glycerol.

Example 2: preparation of cyclic peptides

The method comprises the following steps: solid phase synthesis (full chemical synthesis)

The full chemical synthesis comprises the following steps: (1) Under the coupling reagent, fmoc-Gly-OH is coupled with a resin solid phase carrier to obtain Fmoc-Gly-OH resin; (2) Coupling an amino acid with N-terminal Fmoc protection to the resin under the action of a condensing agent and an activating reagent; wherein the amino acid with N-terminal Fmoc protection is Fmoc-Pro-OH, fmoc-Gln (Trt) -OH, fmoc-Gly-OH, fmoc-Pro-OH and Fmoc-Gln (Trt) -OH in sequence to obtain a holo-peptide resin; (5) Removing the peptide chain from the peptide resin by using a cutting reagent, and precipitating the peptide chain to obtain a crude linear peptide product; (6) And (3) taking the linear peptide, and separating and purifying the linear peptide (7) by utilizing a condensing agent to obtain the related cyclohexapeptide and the derivative thereof.

The method comprises the following specific steps of: fmoc Gly OH (4.46 g,15 mmol) and HOBt (2.03 g,15 mmol) were taken in a 100mL beaker, cooled to 4 ℃, 25mL of DMF solution was added, DIC (2.3 mL,15 mmol) was allowed to stand for reaction for 20 minutes, and the solution in the 100mL beaker was added to a 125mL solid phase synthesis reactor, and the reaction was stirred for 1.5 hours and completed; the resin was washed three times with 65mL of DMF solution each time; after the washing is finished, 65mL of 20% pip/DMF solution is added, the mixture is stirred and reacts for 30min, suction filtration is carried out, the protective solution is removed, then the mixture is washed for 6 times by 65mL of DMF solution, and suction drying is carried out for standby;

step 2: fmoc Pro OH (5.06 g,15 mmol) and HOBt (2.03 g,15 mmol) were taken in a 100mL beaker, cooled to 4 ℃, 25mL of DMF solution was added, DIC (2.3 mL,15 mmol) was allowed to stand for reaction for 20 minutes, and the solution in the 100mL beaker was added to a 125mL solid phase synthesis reactor, and the reaction was stirred for 1.5 hours and completed; the resin was washed three times with 65mL of DMF solution each time; after the washing is completed, 65mL of 20% pip/DMF solution is added, the reaction is stirred for 30min, suction filtration is carried out, the protection solution is removed, then the reaction product is washed 6 times with 65mL of DMF solution, 2 times with 65mL of methanol, 2 times with 65mL of DCM solution and 2 times with 65mL of methanol;

step 3: fmoc Gln (Trt) OH and HOBt (2.03 g,15 mmol) are taken in a 100mL beaker, cooled to 4 ℃, 25mL of DMF solution is added, DIC (2.3 mL,15 mmol) is placed for reaction for 20 minutes, and the solution in the 100mL beaker is added into a 125mL solid phase synthesis reactor, and the reaction is stirred for 1.5 hours, and is completed; the resin was washed three times with 65mL of DMF solution each time; after the washing is finished, carrying out the next reaction; adding 65mL of 20% pip/DMF solution, stirring and reacting for 30min, filtering, removing the protective solution, washing 6 times with 65mL of DMF solution, and drying in a pumping way to be carried out in the next step;

Step 4: vacuum drying, adding 200mL of 1% TFA/DCM solution, stirring at 30 ℃ for reaction for 30 minutes, filtering, and removing resin to obtain filtrate; pumping the filtrate to obtain the full-protection polypeptide

H Gly Pro Gln(Trt)Gly Pro Gln(Trt)OH；

Step 5: dissolving the full-protection polypeptide with 1.4L of Dichloromethane (DCM), adding DIC (1.54 mL,10 mmol), HOBt (1.35 g,10 mmol), DIEA (1.74 mL,10 mmol), stirring and reacting for 14 hours at 30 ℃ to form Cyclo (Gly Pro Gln (Trt)) and concentrating to remove DCM, and carrying out the next step;

step 6: cutting Cyclo (Gly-Pro-Gln (Trt) -Gly-Pro-Gln (Trt)) with TFA/TIS/H2O=90/5/5 (70 mL) for 2.5 hours, adding the cutting solution into 700mL of tert-butyl methyl ether (4 ℃) solution, separating out white solid, and centrifuging to obtain white solid crude peptide; drying the white solid crude peptide under vacuum drying to obtain crude peptide powder Cyclo (Gly Pro Gln Gly Pro Gln); purifying by reversed phase C18 preparative chromatography, lyophilizing to obtain refined product Cyclo (Gly Pro Gln Gly Pro Gln) with yield of only 10-15%, and its chemical structure is formula (2). ¹ HNMR(400MHz,D ₂ O),δppm:8.65(s,4H),δ7.03(s,4H),δ4.40-4.44(m,4H),δ4.08-4.10(d,4H),δ3.41-3.51(m,4H),δ1.92-2.33(m,16H).C ₂₄ H ₃₆ N ₈ O ₈ ,[M+H] ⁺ ＝565.20.

The second method is as follows: natural enzyme synthesis

Tripeptide Gly-Pro-Gln was prepared using crude enzyme solutions of natural ligase (GPSynA 0) and natural ligase (GPHSynB 0), 12.4g L-glycine (165 mM), 17.3g L-proline (150 mM), 83.0g adenosine triphosphate monosodium salt (ATP, 157 mM) were added to 1L of 100mM, pH 8.0 tris (Tris. HCl) solution, and after the pH of the reaction system was adjusted to 8.0 by NaOH aqueous solution, the reaction was started by adding ligase GPSynA0 3000U, slightly stirring at 30℃and maintaining the pH of the reaction system between 7.0 and 9.0, and after 3 hours the formation of the target product was detected by HPLC, but the conversion of the raw material was comparatively low. Then regulating pH to 1.0 by using an HCl aqueous solution, carrying out enzyme denaturation precipitation in a reaction system, centrifuging and removing, regulating the pH of the reaction solution to 7.0, directly loading a D201 anion exchange resin to remove adenosine diphosphate and free phosphoric acid impurities, and finally desalting and concentrating and crystallizing a crude product by using a reverse osmosis membrane (ethanol: water, 2:1, v: v) to obtain about 11.7-13.9 g L-glycine-L-proline (Gly-Pro) dipeptide (yield 40% -45%). Since the product occupies a small amount, crystallization and purification are difficult. (2) In analogy to the preparation of step (1) above, 17.2. 17.2g L-glycine-L-proline (100 mM), 14.4g of trans-4-OH-L-proline (110 mM) and 55.5g of adenosine triphosphate monosodium salt (ATP, 105 mM) were added to 1L of 100mM Tris-aminomethane hydrochloride (Tris. HCl) solution at pH 7.5, and after adjusting the pH of the reaction system to 7.5 by NaOH aqueous solution, the reaction was started by adding the ligase GPHSynB0 3000U, slightly stirred at 30℃and maintaining the pH of the reaction system between 7.0 and 9.0, after 2 hours the formation of the target product was detected by HPLC. Then regulating pH to 1.0 by using an HCl aqueous solution, carrying out enzyme denaturation precipitation in a reaction system, centrifuging and removing, regulating the pH of the reaction solution to 7.0, directly loading a D201 anion exchange resin to remove adenosine diphosphate and free phosphoric acid impurities, and finally desalting a crude product by using a reverse osmosis membrane, concentrating and crystallizing (ethanol: water, 3:1, v: v) to obtain only 8.6-9.9 g tripeptide (only yield of 30% -35%). As described in the previous step, this step of crystallization purification is more difficult. (3) Similar to the preparation method in the above step (1), 17.2. 17.2g L-glycine-L-proline-L-glutamine (200 mM), 55.5g of adenosine triphosphate monosodium salt (ATP, 105 mM) was added to 1L of 100mM Tris-aminomethane hydrochloride (Tris. HCl) solution at pH 7.5, and after the pH of the reaction system was adjusted to 7.5 by NaOH aqueous solution, a ligase (EC 6.3.2.60) was added to initiate the reaction, and the reaction system was slightly stirred at 30℃and maintained at pH of 7.0 to 9.0, after 2 hours, the formation of the target product was detected by HPLC. Then regulating pH to 1.0 by using an HCl aqueous solution, carrying out enzyme denaturation precipitation in a reaction system, centrifuging and removing, then directly loading the reaction solution to 7.0, and then directly loading into D201 anion exchange resin to remove adenosine diphosphate and free phosphoric acid impurities, and finally, desalting and concentrating and crystallizing a crude product by using a reverse osmosis membrane (ethanol: water, 3:1, v: v) to only obtain 8.6-9.9 g of collagen cyclohexapeptide and collagen cyclohexatripeptide (yield is less than 10 percent), wherein the collagen cyclohexapeptide and the collagen cyclohexapeptide are difficult to purify.

And a third method: chemical synthesis+Natural enzyme Synthesis 1

The preparation method and method one of this example are basically the same, except that the amino acid ligase method is changed to the step 4, the preparation route is as shown in the formula (2), and the amidase cyclase is selected from amidation enzyme L-glutamate ligase (EC 6.3.2.60). Then in the cyclization process, amidation enzyme L-glutamic acid ligase (EC 6.3.2.60) is adopted to cyclize amino acid ligase liquid to prepare the collagen cyclic peptide. 17.2g L-glycine-L-proline-L-glutamine (200 mM), 55.5g adenosine triphosphate monosodium salt (ATP, 105 mM) was added to 1L100mM Tris-aminomethane hydrochloride (Tris-HCl) solution at pH 7.5, then after adjusting the pH of the reaction system to 7.5 by NaOH aqueous solution, ligase (EC 6.3.2.60) was added to start the reaction, and after 30℃stirring slightly and maintaining the pH of the reaction system between 7.0 and 9.0, the formation of the target product was detected by HPLC after 2 hours. Then regulating pH to 1.0 by using an HCl aqueous solution, carrying out enzyme denaturation precipitation in a reaction system, centrifuging and removing, regulating the pH of the reaction solution to 7.0, directly loading a D201 anion exchange resin to remove adenosine diphosphate and free phosphoric acid impurities, and finally desalting a crude product by using a reverse osmosis membrane, concentrating and crystallizing (ethanol: water, 3:1, v: v) to obtain the cyclohexapeptide and the cyclotripeptide, wherein the product is complex and difficult to purify (yield is 25-30%).

The method four: chemical synthesis+Natural enzyme Synthesis 2

The preparation method of this example is essentially the same as method three except that during cyclization, the amidase L-glutamate ligase (EC 6.3.2.B19) is used as the amidase, and the remainder is the same as method three, but with little cyclic peptide product.

Method five reform enzyme total synthesis

The preparation method of the embodiment is basically the same as that of the second embodiment, and the sequence SEQ ID NO. 1-4 is selected as the synthetase, and the corresponding yield is found in Gln-Pro, but the modified enzyme has high specificity, and can not be synthesized in the process of synthesizing tripeptide Gln-Pro-Gly.

The method six: chemical Synthesis+mutant enzyme (sequence 1-4) Synthesis

The preparation method of this example is basically the same as that of method III, and the preparation route is the same as that of formula (2), except that during the cyclization reaction, mutant L-glutamate ligase (EC 6.3.2.60) including mutant 1 (SEQ ID NO: 1), mutant 2 (SEQ ID NO: 2), mutant 3 (SEQ ID NO: 3) and mutant 4 (SEQ ID NO: 4) are used as the amide cyclase, and the above mutant enzymes are subjected to separate synthesis experiments, respectively. The purification process is simple, and the catalytic purity of the four mutant enzymes can reach more than 95%.

The R group on the ring (Gly-Pro-Gln-Gly-Pro-Gln) in formula (2) is (CH) ₂ ) ₂ CONH ₂ 。

The process can also be used for preparing cyclic peptide derivatives, adjusting the reactants, and the R group on the ring (Gly-Pro-Gln-Gly-Pro-Gln) in the final product formula (2) is selected from H, (CH) ₂ ) _n CH ₃ 、(CH ₂ ) _m NH ₂ 、(CH ₂ ) _x COOA1、(CH ₂ ) _m Any one of CONA 2; wherein n, m, x are independently selected from 0 or natural numbers; a1 and A2 are independently selected from H ₂ 、OH、NH ₂ Any one or more of COOH, C1-18 alkyl, phenyl, heteroaryl.

Table 1: yield comparison of different preparation methods

The six methods cover total chemical synthesis, total enzyme synthesis, chemical synthesis+natural enzyme synthesis, chemical synthesis+modified enzyme synthesis, modified enzyme total synthesis, and the comparisons among the methods are shown in table 1:

the total chemical synthesis is a common synthesis means, and the total chemical synthesis yield is relatively low, the product is difficult to purify thoroughly, the purification process is complex, the purity is low, and therefore the practical production is limited; the natural enzyme has strong selectivity to long peptide chain, and has difficult cyclization to cyclic peptide, more side reactions of holoenzyme synthesis and difficult purification; the cyclizing efficiency of EC 6.3.2.60 is low, and EC 6.3.2.B19 has little cyclizing catalytic activity by using natural enzymes; the modified enzyme has specificity and cannot catalyze other steps, so that the total synthesis of the modified enzyme cannot be performed; the modified enzyme has selectivity and specificity, so that the corresponding enzyme is utilized for cyclization after the target polypeptide containing the fragment is synthesized, the efficiency is high, few byproducts are produced, the purification is simple, and the method has great production and application values.

The corresponding several-membered cyclic peptides are directionally synthesized in the synthesis of cyclic peptides: in the feeding process, firstly, synthesizing corresponding tripeptides, and cyclizing and converting the tripeptides into cyclohexapeptides or a small amount of cyclic tripeptides; tripeptide + corresponding amino acid, then cyclic tetrapeptides are produced; tripeptide + dipeptide to produce cyclic pentapeptide; belongs to a fragment ligation cyclization method.

The catalytic effect of the enzymes sequences SEQ ID NO 1-4 is compared with the cyclisation activity, which can be measured by known methods. The amount of cyclic peptide produced per unit enzyme amount and unit time can be used as an index of cyclization activity, with a cyclization activity of 330 in SEQ ID NO:1, 350 in SEQ ID NO:2, 335 in SEQ ID NO:3 and 450 in mg product peptide/u enzyme/hour; the catalytic yield of the SEQ ID NO 1-3 is 80% -85%, the SEQ ID NO 4 is obviously better than the SEQ ID NO 1-3, the highest catalytic yield reaches 90%, the purity of the purified cyclic peptide prepared by the SEQ ID NO 1-3 is 95% -98%, the purity of the purified cyclic peptide prepared by other methods is higher than that of the purified cyclic peptide prepared by the other methods, the highest purity of the purified cyclic peptide prepared by the SEQ ID NO 4 reaches 99%, and the high catalytic efficiency, less side reaction and the best catalytic effect of the mutant enzyme of the SEQ ID NO 4 are proved.

Example 3: polypeptide application in vitro anti-wrinkle efficacy test

In the embodiment, based on UVA irradiation of fibroblasts, the anti-wrinkle effect of a sample to be tested is evaluated by detecting the expression condition of a Collage I gene after the sample acts.

The cells used in the test used in this example were fibroblasts and the main reagents, all commercially available. Conventional procedures in the working procedure of the present invention are well known to those skilled in the art, and specific experimental procedures are referred to David C.Ireland, michelle L.Colgrave, david J.Craik; a novel suite of cyclotides from Viola odorata: sequence variation and the implications for structure function and stability biochem J15 November 2006;400 (1) 1-12.Doi: https:// doi. Org/10.1042/BJ20060627.

The experimental process comprises the following steps: uniformly distributing the sample on the surface of the model, and placing the model on CO ₂ Incubator (37 ℃,5% CO) ₂ ) And incubated for 24h. After the incubation, the sample remained on the surface of the model was washed with sterile PBS solution, and the inner and outer residual liquids of the model were wiped off with sterile cotton swabs. The test protocol is shown in the table. Samples 1-3 correspond to: the products of methods 1-3. Samples 4-7 correspond to the products prepared by catalytic preparation of the modified enzymes of chemical synthesis + sequences 1-4, respectively.

The experimental results are shown in Table 2 and FIG. 2, and the cyclic peptide promotes the colragen I gene expression histogram;

as can be seen from table 2 and fig. 2, the samples differed in the promotion rate (%) of Collagen color i expression. As can be seen from FIG. 1, the cyclic peptides or compositions thereof obtained by different cyclization methods all have corresponding improvements in promoting the expression of the Collagen I gene, but are advantageous in promoting the fragment synthesis-enzymatic cyclization provided by the present invention significantly: the conventional preparation method of the cyclopeptide is full chemical synthesis, which is also a preparation method of the cyclopeptide sold in the market, and the promotion rate of the expression of the Collagen I gene is 153%; the promotion rate of the cyclopeptides obtained by holoenzyme synthesis and chemical+natural enzyme synthesis on the expression of the Collagen I gene is only about 100%; the promotion rate of the cyclopeptide synthesized by adopting chemical plus modified enzyme on the expression of the Collagen I gene is more than 200%, and the promotion rate of the cyclopeptide synthesized by the modified enzyme with the sequence of SEQ ID NO. 4 on the expression of the Collagen I gene is 220% the highest.

TABLE 2 Collagen I promotion Rate for each sample (%)

Group of	Collagen I promotion Rate (%)
		Sample 1	153
Sample 2	110
		Sample 3	105
Sample 4 (sequence 1)	200
		Sample 5 (sequence 2)	210
Sample 6 (sequence 3)	203
		Sample 7 (sequence 4)	220

In application, the cyclopeptide prepared by the invention has higher bioactivity, can resist the Collagen loss of the Collagen I caused by UV radiation more effectively, has the effect of resisting photo-aging, can be applied to daily chemical products such as sun protection, nursing and the like, and can obtain better effect in similar products; on the other hand, the cyclopeptide prepared by the invention promotes the increase of the content of Collagen I, can enable the skin to be full and full, can achieve the effect of resisting the generation of wrinkles, can be applied to daily chemical products with wrinkle resistance and aging resistance, and can obtain better effects in similar products.

Example 4: polypeptide in vitro enzymolysis resistance test

The in vitro enzymolysis resistance of the corresponding samples is evaluated by detecting the residual amount of the peptides before and after the action of the samples after the culture of different peptide samples and various proteases based on the in vitro combined enzyme culture.

The major reagents used in this example, such as enzymes and culture medium, were commercially available (type I, type III, type IV collagenases: adamas life; trifluoroacetic acid: an Naiji chemistry; acetonitrile: TEDIA, U.S.A.). Conventional procedures in the working procedure of the present invention are well known to those skilled in the art, and specific experimental procedures are referred to David C.Ireland, michelle L.Colgrave, david J.Craik; a novel suite of cyclotides from Viola odorata: sequence variation and the implications for structure function and stability biochem J15 November 2006;400 (1) 1-12.Doi: https:// doi. Org/10.1042/BJ20060627.

Specifically, collagenase I, III and IV from Clostridium histolyticum are selected as target protein/polypeptide hydrolase, and corresponding linear peptides are selected as control and the enzyme digestion concentration is respectively set to be 10u: mg (polypeptide) to 500u: mg (polypeptide), sample composition was the same as in example 3.

According to the experimental results, the corresponding positive controls (linear peptides) were all at 20U: the degradation of sample 1-3 is over 10% in 24 hours under 200u/mL enzyme activity concentration, sample 4-7 is not obviously degraded in 48 hours under 500u/mL enzyme activity concentration, and the degradation of protease can be fully inhibited by sample 4-7, and the cyclic peptide prepared by the method has stronger enzymolysis resistance, wherein the sample 7 has the best effect, namely the polypeptide prepared by the modified enzyme catalytic cyclization with the sequence of SEQ ID NO:4 has the best enzymolysis resistance.

In application, the cyclic peptide prepared by the preparation method has better protease enzymolysis resistance, and can be matched with the effects of resisting photoaging, resisting wrinkles and the like to realize longer-acting effect; on the other hand, the product can be matched with other existing products to improve the action time of the existing products.

Example 5: penetration ability of cyclic peptides

In the embodiment, based on the transdermal absorption effect of the free amino-containing polypeptide in vitro analyzed by the Franzcell diffusion cell, the pig skin is taken as a research model, the content of the target in the receiving liquid is detected by adopting a quantitative detection method to calculate the accumulated permeation quantity so as to obtain the diffusion percentage, the transdermal absorption effect quantification of the sample to be detected is carried out, and the in vitro transdermal absorption effect of the free amino-containing polypeptide is analyzed.

The test is based on a pigskin system, the concentration of samples in the receiving liquid at different time points is measured by a high performance liquid phase method, the skin permeation behaviors of samples 1-7 are evaluated, and the samples are grouped into a detailed example 3. Conventional procedures in the working procedure of the present invention are well known to those skilled in the art, and specific experimental procedures are referred to David C.Ireland, michelle L.Colgrave, david J.Craik; a novel suite of cyclotides from Viola odorata: sequence variation and the implications for structure function and stability biochem J15 November 2006;400 (1) 1-12.Doi: https:// doi. Org/10.1042/BJ20060627. The results are shown in Table 3.

TABLE 3 results of sample transdermal penetration test

Test sample	24h diffusion percentage (100%)
		Linear peptides	0.08％
Sample 1	3.6％
		Sample 2	2.1％
Sample 3	3.0％
		Sample 4	4.0％
Sample 5	4.1％
		Sample 6	4.4％
Sample 7	5.0％

The results show that: samples 1-3 (prepared by total chemical synthesis, total enzyme synthesis and chemical+natural enzyme synthesis respectively) all have a transdermal permeability of less than 4% in 24h, while the cyclic peptide prepared by the preparation method of the invention has a transdermal permeability of more than 4% in 24h, and the highest transdermal permeability in 24h prepared by the mutant enzyme with the sequence SEQ ID NO. 4 is 5.0%.

On the application level, the cyclic peptide prepared by the preparation method has better transdermal permeation efficacy, can be combined with the effects of resisting photoaging, resisting wrinkles and the like to generate better effects, and can be combined with other existing products to promote corresponding effects by promoting skin permeation.

While the foregoing embodiments have been described in detail in connection with the embodiments of the invention, it should be understood that the foregoing embodiments are merely illustrative of the invention and are not intended to limit the invention, and any modifications, additions, substitutions and the like made within the principles of the invention are intended to be included within the scope of the invention.

Sequence listing

SEQ ID NO:1

atgagagtagcacttgtcgttgacatagtaagacaagaggaaagactaattgctaaagcactggaaaaatttcaattacaatatgatgtaattaatgtggcacaagagcccttaccttttaacaaagccttaggaagatatgatgtggcaatcataagacctataagtatgtatagggcactctacgcatcagcagttttggaatcagctggtgttcacaccataaactcaagtgataatattagtttatgtggagacaagattttaacatactcaaagctgtatagagagggcataccaatacctgactctataattgccatgtcatcagatgctgcattaaaagcctatgaacaagaaggatttccactgatagataaaccaccaataggtagctggggaagactagtatctctcataagggacattttcgaaggtaaaaccataatgggacaaaaggagttgatgggcaactctgctcttaaagttcacatagttcaggagtacattaactacaaaagcagggacataaggtgtattgtgataggtagtgagcttctaggttgttacgctaggaatataccttctaacgaatggagcgcaaatattgctttaggcggttatccaccgccgatagaggtagaccataaactaaaagagactgtattaaaggctacgagtattataggtggagagttcgtatccatagatgtaatggagcaaccatctaaaaattacgttataaacgagtttaatgacgttccagagttcaaaggatttatgttggctaccaatattgatgtagcggaagagctagtgagctatgtgaaaaataattacctcaggtaa

SEQ ID NO:2

atgagagtagcacttgtcgttgacatagtaagacaagaggaaagactaattgctaaagcactggaaaaatttcaattacaatatgatgtaattaatgtggcacaagagcccttaccttttaacaaagccttaggaagatatgatgtggcaatcataagacctataagtatgtatagggcactctacgcatcagcagttttggaatcagctggtgttcacaccataaactcaagtgataatattagtttatgtggagacaagattttaacatactcaaagctgtatagagagggcataccaatacctgactctataattgccatgtcatcagatgctgcattaaaagcctatgaacaagaaggatttccactgatagataaaccaccaataggtagctggggaagactagtatctctcataagggacattttcgaaggtaaaaccagaatgggacaaaaggagttgatgggcaactctgctcttaaagttcacatagttcaggagtacattaactacaaaagcagggacataaggtgtattgtgataggtagtgagcttctaggttgttacgctaggaatataccttctaacgaatggagcgcaaatattgctttaggcggttatccaccgccgatagaggtagaccataaactaaaagagactgtattaaaggctacgagtattataggtggagagttcgtatccatagatgtaatggagcaaccatctaaaaattacgttataaacgagtttaatgacgttccagagttcaaaggatttatgttggctaccaatattgatgtagcggaagagctagtgagctatgtgaaaaataattacctcaggtaa

SEQ ID NO:3

atgagagtagcacttgtcgttgacatagtaagacaagaggaaagactaattgctaaagcactggaaaaatttcaattacaatatgatgtaattaatgtggcacaagagcccttaccttttaacaaagccttaggaagatatgatgtggcaatcataagacctataagtatgtatagggcactctacgcatcagcagttttggaatcagctggtgttcacaccataaactcaagtgataatattagtttatgtggagacaagattttaacatactcaaagctgtatagagagggcataccaatacctgactctataattgccatgtcatcagatgctgcattaaaagcctatgaacaagaaggatttccactgatagataaaccaccaataggtagctggggaagactagtatctctcataagggacattttcgaaggtaaaaccataattggacaaaagcagttgatgggcaactctgctcttaaagttcacatagttcaggagtacattaactacaaaagcagggacataaggtgtattgtgataggtagtgagcttctaggttgttacgctaggaatataccttctaacgaatggagcgaaagtattgctttaggcggttatccatcgccgatagaggtagaccataaactaaaagagactgtattaaaggctacgagtattataggtggagagttcgtatccatagatgtaatggagcaaccatctaaaaattacgttataaacgagtttaatgacgttccagagttcaaaggatttatgttggctaccaatattgatgtagcggaagagctagtgagctatgtgaaaaataattacctcaggtaa

SEQ ID NO:4

atgagagtagcacttgtcgttgacatagtaagacaagaggaaagactaattgctaaagcactggaaaaatttcaattacaatatgatgtaattaatgtggcacaagagcccttaccttttaacaaagccttaggaagatatgatgtggcaatcataagacctataagtatgtatagggcactctacgcatcagcagttttggaatcagctggtgttcacaccataaactcaagtgataatattagtttatgtggagacaagattttaacatactcaaagctgtatagagagggcataccaatacctgactctataattgccatgtcatcagatgctgcattaaaagcctatgaacaagaaggatttccactgatagataaaccaccaataggtagctggggaagactagtatctctcataagggacattttcgaaggtaaaaccagaatgggacaaaaggagttcatgggcaactctgctcttaaagttcacatagttcaggagtacattaactacaaaagcagggacataaggtgtattgtgataggtagtgagcttctaggttgttacgctaggaatataccttctaacgaatggagcgaaagtattgctttaggcggttatccaccgccgatagaggtagaccataaactaaaagagactgtattaaaggctacgagtattataggtggagagttcgtatccatagatgtaatggagcaaccatctaaaaattacgttataaacgagtttaatgacgttccagagttcaaaggatttatgttggctaccaatattgatgtagcggaagagctagtgagctatgtgaaaaataattacctcaggtaa

Claims

1. A preparation method of cyclic peptide is characterized in that firstly, a short peptide sequence or a fragment thereof is organically synthesized, and then, the corresponding cyclic peptide product is prepared through enzyme catalysis cyclization; the enzymes include one or more of L-glutamate ligase EC 6.3.2.60, mutants of L-glutamate ligase EC 6.3.2.60; the nucleotide sequence of the mutant of the L-glutamate ligase EC 6.3.2.60 is any one of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4.

2. The method for producing a cyclic peptide according to claim 1, wherein the mutant of L-glutamic acid ligase EC 6.3.2.60 has a nucleotide sequence represented by SEQ ID NO. 4.

3. The method of claim 1, wherein the cyclic peptide comprises Gln, which is located at the beginning or end of the short peptide sequence or fragment thereof during the cyclization reaction.

4. A method of producing a cyclic peptide as claimed in claim 3 wherein the cyclic peptide has 3 to 6 amide linkages within the ring.

5. The method of claim 4, wherein the cyclic peptide is prepared by amide bond synthesis and enzyme-catalyzed cyclization of Gln, gly, pro amino acids.

6. A cyclic peptide prepared according to the method of any one of claims 1 to 5.

7. An enzyme for the preparation of a cyclic peptide, characterized in that said enzyme is directionally mutated by the L-glutamate ligase EC 6.3.2.60; the nucleotide sequence of the enzyme is any one of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4.

8. The enzyme according to claim 7, wherein the nucleotide sequence of the enzyme is as shown in SEQ ID NO. 4.

9. Use of an enzyme according to any one of claims 7 to 8 for the preparation of high purity cyclic peptides with high conversion, wherein the cyclic peptides are prepared by first organically synthesizing short peptide sequences or fragments thereof and then cyclizing by the enzyme according to any one of claims 7 to 8 to obtain cyclic peptide products.

10. Use of an enzyme according to any one of claims 7-8 for the preparation of a non-degradable, high skin penetration cyclic peptide formulation for combating photoaging, wrinkle formation, said formulation being used in the cosmetic, skin care, medical fields, wherein the cyclic peptide prepared by said enzyme is capable of promoting the expression of the Collagen I gene, combating the decrease of Collagen I Collagen under UV irradiation, to combat photoaging; promote the increase of Collagen content of Collagen I, and achieve the effect of resisting wrinkle; the enzyme can improve the protease enzymolysis resistance of the cyclopeptide product; the enzyme is capable of enhancing the permeability of the cyclopeptide product.