CN104774891B - A kind of technique that enzyme process efficiently synthesizes benzyloxycarbonyl group Aspartame - Google Patents
A kind of technique that enzyme process efficiently synthesizes benzyloxycarbonyl group Aspartame Download PDFInfo
- Publication number
- CN104774891B CN104774891B CN201510021876.9A CN201510021876A CN104774891B CN 104774891 B CN104774891 B CN 104774891B CN 201510021876 A CN201510021876 A CN 201510021876A CN 104774891 B CN104774891 B CN 104774891B
- Authority
- CN
- China
- Prior art keywords
- benzyloxycarbonyl group
- aspartame
- organic solvent
- protease
- mutant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/582—Recycling of unreacted starting or intermediate materials
Abstract
The invention discloses a kind of technique of enzyme process high efficiency synthesis benzyloxycarbonyl group Aspartame, specially organic solvent tolerant protease WQ9-2 or its mutant are catalyzed benzyloxycarbonyl group aspartic acid and phenyalanine methyl ester or its hydrochloride enzymatic clarification benzyloxycarbonyl group Aspartame.The present invention use fromBacillus cereusThe problems such as organic solvent tolerant protease WQ9-2 or its mutant catalyze and synthesize the coupling reaction and separation technique of Aspartame precursor (Cbz-APM), can well solve substrate suppression, and the utilization rate of substrate and the later period of product separate.
Description
Technical field
The present invention relates to genetic engineerings and biocatalysis engineering research field, and in particular to a kind of enzyme process efficiently synthesizes benzyloxy
The technique of carbonyl Aspartame.
Background technique
Protease catalytically synthesizing small molecular compound has been to be concerned by more and more people in recent years, can carry out small peptide conjunction
At, glycoconjugates, hydrogel molecules self assembly, transesterification reaction and chiral alcohol Kinetic Resolution etc., in medicine intermediate, makeup
The fields such as product, daily necessities, biomaterial are with a wide range of applications.However the catalysis of most of organic solvent tolerant proteases is imitated
Rate is not very high, so, filter out the protease with high catalytic efficiency for protease in nonaqueous phase or aqueous catalysis
Development and application industrially has meaning outstanding.
Aspartame is a kind of methyl dipeptide compound as made of L-type aspartic acid and the condensation of L-type phenyalanine methyl ester,
It is a kind of artificial synthesized sweetener.The sweet taste of Aspartame is about 200 times of sucrose, is had in terms of the addition of sweetener
Very wide application range.Magnuson B A etc. (Critical Reviews in Toxicological 37 (8): 629-
727) pharmacological toxicity of Aspartame is had studied, research shows that Aspartame is to human body in current food addition range
It is very safe.
The Aspartame reported at present is mainly synthesized by two methods, and chemical method, enzyme are mixed with chemical method.In chemistry
There is very big drawback in the synthesis of method, need to protect the amino and β-carboxyl of aspartic acid, and it also requires to α-
Carboxyl is activated, few along with a small amount of β position by-product and as caused by chemical reaction condition during reaction
Measure racemization generate D type by-product, due to D type Aspartame have bitter taste, so the later period also need to by-product into
Row separation.The total recovery of product, whole process complex steps, sewage are influenced during carrying out amino acid protection and deprotection
Discharge is serious.
Aspartame is produced using the method for thermophilic protease or thermophilic protease in conjunction with chemical method, β can be utilized
The α type Aspartame of the unprotected benzyloxycarbonyl group aspartic acid high yield in position produced without β type by-product, and do not disappear
The D type product that rotation effect generates.Since protease has special catalytic site selectivity, β is entirely free of so can produce
The Aspartame of type by-product.However enzyme process this technology also has the shortcomings that very big, Japan Patent JP60118190 is using thermophilic
During hot albumen enzymatic synthesis Aspartame, reaction system efficiently synthesizes Aspartame precursor using two-phase method, will react
The product phase transfer of generation is to organic phase.This reaction process is difficult to hold in the distribution of substrate and product in two-phase, and
The rear separation for being transferred to the product in organic phase is complicated.In the process of synthesis Aspartame precursor (benzyloxycarbonyl group Aspartame)
In, substrate is obvious to the inhibition of enzyme, and the concentration of substrate is relatively low, and combined coefficient is lower.Hiroyasu Ogino etc.
(“Enhancement of the aspartame precursor synthetic activity of an organic
Solvent-stable protease ", Protein Engineering, Design&Selection
Vol.23no.3pp.147-152,2010) the organic solvent tolerant protease PST-01 developed is catalyzing and synthesizing Aspartame precursor
When benzyloxycarbonyl group aspartic acid (Cbz-Asp) optium concentration be 30mM, the optium concentration of phenyalanine methyl ester (PheOMe) is
The yield of 500mM, benzyloxycarbonyl group Aspartame (Cbz-APM) reach 83%, the benzyloxycarbonyl group asparagus fern in this technological reaction system
The concentration of propylhomoserin is low, and the molar ratio of substrate is uneconomical, and has used 50 percent DMSO in the reaction system, produces
Object be dissolved in substrate in solution cause it is many and diverse it is rear separate, the preparation cost of the technique is high.
United States Patent (USP) US2012/0295294 synthesizes Aspartame using organic solvent tolerant protease PT121, which exists
Non-protected aspartic acid is used during synthesizing Aspartame, the molar ratio of two substrates is 1:20, but its yield is only
30.8%, a large amount of wastes of substrate are formd, product separating difficulty in organic phase is big, and economic value is low.
In view of the deficiency of prior art, the present invention is specifically proposed.
Summary of the invention
The first object of the present invention is to provide a kind of technique of enzyme process high efficiency synthesis benzyloxycarbonyl group Aspartame, use
What voluntarily screening was developed catalyzes and synthesizes from the organic solvent tolerant protease WQ9-2 of Bacillus cereus or its mutant
The coupling reaction and separation technique of benzyloxycarbonyl group Aspartame (Cbz-APM) can well solve substrate suppression, the benefit of substrate
The problems such as being separated with the later period of rate and product, combined coefficient are high.
To achieve the above object, the present invention adopts the following technical scheme:
A kind of technique of enzyme process high efficiency synthesis benzyloxycarbonyl group Aspartame, specifically with organic solvent tolerant protease WQ9-2
Or its mutant is catalyzed benzyloxycarbonyl group aspartic acid and phenyalanine methyl ester or its hydrochloride enzymatic clarification benzyloxycarbonyl group A Siba
Sweet tea.
Wherein, the mutant of the organic solvent tolerant protease WQ9-2 is that amino acid sequence has 95% or more homology
Mutant, mutation occur include one or more amino acid residue be replaced or decrease or increase.Such as WQ9-2-4F and
WQ9-2-7K, WQ9-2-13D and WQ9-2-20C, WQ9-2-27H and WQ9-2-33G etc..
Technique of the present invention, pH value is 4-8, preferable ph 6 in the reaction system of the enzymatic clarification.
Wherein, the reaction molar ratio of the benzyloxycarbonyl group aspartic acid and phenyalanine methyl ester or its hydrochloride is 1:10-
1:1, preferably 1:3~1:6；The dosage of the organic solvent tolerant protease WQ9-2 and its mutant is 200-5000U/mL, preferably
1000-2000U/mL。
Wherein, more preferably feed intake for the first time two substrates (benzyloxycarbonyl group aspartic acid: phenyalanine methyl ester) molar ratio be 1:
5, subsequent molar ratio is 1:1, and it is the same anti-of 1:5 that the recycling of excess substrate, which can reach molar ratio for the first time,
Efficiency is answered, repeatedly can reach actual substrate ratio after circulation is 1:1, avoids excessive phenylalanine methyl ester hydrochloride (phenylpropyl alcohol
Propylhomoserin methyl esters) loss.
Technique of the present invention, benzyloxycarbonyl group aspartic acid (Cbz-Asp) concentration are advisable for 30-200mM, reaction efficiency
Higher concentration is 100mM, and phenylalanine methyl ester hydrochloride (PheOMe.HCl) or phenyalanine methyl ester (PheOMe) concentration are
150-600mM, the higher concentration of more economical and reaction efficiency are 500mM.
Technique of the present invention, the enzymatic clarification carry out in organic solvent and/or water phase, the organic solvent choosing
From one of ethyl alcohol, DMSO, methanol, DMF, ethyl acetate or glycerol, preferably DMSO, ethyl alcohol or methanol；Work as enzymatic clarification
When carrying out in organic solvent and the mixed liquor of water phase, volumetric concentration (v/v) of the organic solvent in mixed liquor is 0%-30%；
It is preferred that 0%-10%.
Technique of the present invention, the reaction temperature of the enzymatic clarification are 20-45 DEG C, preferably 30 DEG C.
The Ca of 0-10mM is added in the reaction system of enzymatic clarification for technique of the present invention2+, the preferably Ca of 5mM2+。
Technique of the present invention, product are directly precipitated from reaction system；It is preferred that using the method point filtered after being precipitated
From product, and raw material superfluous in reaction solution will be dissolved in and be used to circulate in mother liquor the raw material for adding molar concentration rate again as 1:1,
The synthesis of batch benzyloxycarbonyl group Aspartame can be realized.
Technique of the present invention, the benzyloxycarbonyl group Aspartame after synthesis use the aqueous dissolution of pH9~10, then
It is washed with the aqueous solution of pH5.5~5.0 of dilute hydrochloric acid regulation system, or use pH5.5~5.0, generation is further purified
Product is dried in vacuo the benzyloxycarbonyl group Aspartame for being 99% or more up to purity.
The beneficial effects of the present invention are use from Bacillus cereus WQ9-2 (CCTCC NO:2010010)
Organic solvent tolerant protease WQ9-2 or its 95% homology mutant efficient catalytic benzyloxycarbonyl group protection aspartic acid and benzene
Methyl lactamine synthesizes the Aspartame (Cbz-APM) of Aspartame precursor benzyloxycarbonyl group protection.And its each condition is carried out
Optimization, and filtered out the condition for being more suited to produce using Production by Enzymes benzyloxycarbonyl group Aspartame.
Detailed description of the invention
Fig. 1 is organic solvent tolerant protease recombinant protein electrophoretogram；
Fig. 2 is Aspartame synthetic reaction route schematic diagram；
Fig. 3 is that organic solvent tolerant protease WQ9-2 recombinant or its mutant catalyze and synthesize product Aspartame precursor benzyl
The HPLC map of oxygen carbonyl Aspartame；
Fig. 4 is the mass spectrogram of benzyloxycarbonyl group Aspartame (Cbz-APM) standard items, by the limited public affairs of Shanghai gill biochemical reagents
Department provides, purity 99.8%；
Fig. 5 is the mass spectrogram of benzyloxycarbonyl group Aspartame (Cbz-APM) experimental product of the present invention.
Specific embodiment
Below in conjunction with specific embodiment, invention is further described in detail:
The present invention synthesizes Aspartame using the method that chemistry and biofacies combine, using chemistry well-known in field
Method synthesizes benzyloxycarbonyl group aspartic acid and phenyalanine methyl ester or its hydrochloride from aspartic acid and phenylalanine, urges in enzyme
Using benzyloxycarbonyl group aspartic acid and phenyalanine methyl ester or its hydrochloride in organic solvent or non-organic molten during change
The Aspartame (Cbz-APM) of enzyme law catalysis synthesis benzyloxycarbonyl group protection in agent, due to realizing coupling reaction and separation, reaction effect
Rate is high, and superfluous raw material, which exists in solution, can be recycled, and it is single that high-purity product is precipitated product from system, no coupling product.
Organic solvent tolerant protease WQ9-2 of the present invention is from Bacillus cereus, and this is resistance to organic molten
Agent protease WQ9-2 has been proposed in the prior authorization patent (Authorization Notice No.: CN102021125B) of same inventor, utilizes
Clonal expression technology, recombinantly expresses it.
The present invention can utilize Bacillus cereus produced organic solvent tolerant protease WQ9-2 or protease WQ9-2
The clonal expression product of mutant gene, protease WQ9-2 have nucleotide sequence shown in SEQ ID NO:1, amino acid
Sequence is shown in SEQ ID NO:2.1701 nucleotide of organic solvent tolerant protease WQ9-2 full length gene, encode 567 amino
Acid, wherein mature peptide is 317 amino acid.The thermophilic protein of the gene and the source Bacillus thermoproteolyticus
Enzyme gene (Accession number720316A) homology is 69.6%, wherein mature peptide partial amino-acid series homology
It is 72%.Authorization Notice No. is shown in above-mentioned sequence table: the Chinese patent of CN102021125B, and details are not described herein by the present invention.
Moreover, it relates to the application of organic solvent tolerant protease WQ9-2 mutant be arrived, using round pcr to resistance to
The partial amino-acid of organic solvent protease WQ9-2 is mutated, and the protease mutant with catalytic activity, mutation side are obtained
Method includes replacement, deletion and the addition of one or more amino acid residue.According to the common knowledge of those skilled in the art it is found that tool
There is the amino acid sequence indicated with SEQ ID NO:2 that there is the amino acid sequence and its mutant of 95% or more homology, it should
It is considered as and the protease of the organic solvent tolerant protease WQ9-2 that the present invention the protects function of the same race being equal.
Protease WQ9-2 after above-mentioned mutation has been carried out zymology Quality Research by the present invention, is found with original unmutated
Protease WQ9-2 zymologic property it is almost the same.Detect its energy for catalyzing and synthesizing benzyloxycarbonyl group Aspartame (Cbz-APM)
Power, the organic solvent tolerant protease WQ9-2 after discovery mutation is when catalyzing and synthesizing benzyloxycarbonyl group Aspartame, in identical condition
Under, it still can achieve synthesis capability similar in same unmutated albumen enzyme WQ9-2.
Use the produced organic solvent-resistant albumen of bacillus cereus Bacillus cereus WQ9-2 of the present invention
Enzyme WQ9-2 and mutant, hay bacillus or Escherichia coli and yeast recombinant expression enzyme energy efficient catalytic synthesis benzyloxycarbonyl group Ah
This Ba Tian reduces the cost of biocatalyst during producing Aspartame, realizes point of substrate and reaction system
From, and the circulation for passing through mother liquor realizes the complete utilization of substrate, provides efficient enzyme for enzyme process industrialized production Aspartame
Source, to realize that green production Aspartame provides critical technology and catalyst.
Organic solvent tolerant protease WQ9-2 or its mutant described in use of the present invention are in hay bacillus or yeast and greatly
Recombination expression product in enterobacteria, efficient catalytic synthesis benzyloxycarbonyl group Aspartame (Cbz-APM) in water phase or nonaqueous phase.
The present invention provides organic solvent tolerant protease WQ9-2 or its mutant, and benzyloxy carbonyl is catalyzed in water phase or nonaqueous phase
Base aspartic acid (Cbz-Asp) and phenyalanine methyl ester (PheOMe) or its hydrochloride (PheOMe.HCl) synthesis benzyloxycarbonyl group Ah
The application of this Ba Tian (Cbz-APM), specific as follows:
(1) pH value is 4-8, preferable ph 6 in the reaction system of enzymatic clarification.Inventor sends out during practical study
Existing, the range of system pH directly influences the solubility of substrate and product in the reaction system, and reasonable pH value is conducive to mention
The solubility of high substrate and the solubility for reducing product, so as to the technique for preferably realizing coupling reaction and separation.
(2) the reaction molar ratio of benzyloxycarbonyl group aspartic acid and phenyalanine methyl ester or its hydrochloride is 1:10-1:1, excellent
Select 1:3~1:6.
Specifically, in reaction system two substrates more excellent concentration: benzyloxycarbonyl group aspartic acid (Cbz-Asp) concentration is
30-200mM, the higher concentration of reaction efficiency are 100mM, phenylalanine methyl ester hydrochloride (PheOMe.HCl) or phenylalanine first
Ester (PheOMe) concentration is 150-600mM, and the higher concentration of more economical and reaction efficiency is 500mM.And during the reaction
Excessive substrate can be utilized with direct circulation.In addition, the molar ratio for two substrates that feed intake for the first time is 1:5, subsequent molar ratio is
1:1, recycling for excess substrate can reach the same reaction efficiency that molar ratio for the first time is 1:5, so can reach
It is 1:1, the loss without excessive phenylalanine methyl ester hydrochloride (phenyalanine methyl ester) to actual substrate ratio.
(3) dosage of the organic solvent tolerant protease WQ9-2 or its mutant is 200-5000U/mL, preferably 1000-
2000U/mL。
(4) enzymatic clarification carries out in organic solvent and/or water phase, and the organic solvent is selected from ethyl alcohol, DMSO, first
One of alcohol, DMF, ethyl acetate or glycerol, preferably DMSO, ethyl alcohol or methanol；When enzymatic clarification is in organic solvent and water
When carrying out in the mixed liquor of phase, volumetric concentration (v/v) of the organic solvent in mixed liquor is 0%-30%；It is preferred that 0%-10%.
Using above-mentioned organic solvent, the dissolution of substrate can be promoted, the dosage of solvent is selected as those skilled in the art and is grasped, this hair
It is bright that this is not particularly limited.
(5) the enzymatic clarification reaction temperature be 20-45 DEG C, preferably 30 DEG C,.Protease WQ9-2 has at 25-40 DEG C
Preferable thermal stability is catalyzed complete enzyme activity almost without loss, and has good catalysis activity.Conducive to protease WQ9-
2 reuse.
In addition, the Ca of 5mM is added in the present invention preferably in the reaction system of enzymatic clarification2+Afterwards, it can be improved protease
The stability of WQ9-2 or its mutant in the reaction system, to realize protease WQ9-2 in reaction system or its mutant
It is repeatedly reusable.
In the chemical synthesis process of conventional Aspartame, Aspartame precursor benzyloxycarbonyl group Aspartame is due to substrate and production
Object is dissolved in dicyandiamide solution, and usually requires to realize separation using column chromatography there are racemization and the side reaction of β carboxyls,
Separation costs are high.And technique of the present invention is used, the step 1 enzymatic clarification Aspartame precursor benzyloxycarbonyl group A Siba
When sweet tea, no coupling product is precipitated in product from reaction system；Product is directly obtained using the method filtered after precipitation, without complexity
Later separation, and raw material superfluous in reaction solution can be used for cycling and reutilization.
Product recrystallization purifying technique, the benzyloxycarbonyl group Aspartame after synthesis use the aqueous dissolution of pH9-10, so
The pH5.5-5.0 of dilute hydrochloric acid regulation system is used afterwards, or is washed using the aqueous solution of pH5.5-5.0, and generation is further purified
Product is dried in vacuo to obtain the final product, and yield reaches 95% or more.The product of generation can be further purified in the step, so that product
Purity reaches 99.8%, and purer substrate is provided for next step hydrogenating reduction.
The present invention uses two concentration of substrate molar ratios to add technology, entire production process green ring for the raw material of 1:1
It protects, the economic technology of no wastage of material.
The present invention can further slough benzyloxycarbonyl group Aspartame benzyloxycarbonyl protecting group group, obtain pure final goal
It closes object Aspartame (APM).The present invention preferably as: Aspartame precursor benzyloxycarbonyl group Aspartame is added to containing palladium carbon
Methanol and tert-butyl alcohol volume ratio are in the solution of 1:1, and are passed through hydrogen in the reaction system.After stirring 6h at normal temperature, stop
Only react.Finally vacuum filtration obtains the pure solid Aspartame of white.
The present invention provides organic solvent tolerant protease WQ9-2 or its mutant efficient catalytic to synthesize Aspartame, superfluous
Feedstock circulation utilizes, the benzyloxycarbonyl group Aspartame synthetic method of the coupling reaction and separation of no wastage of material, and product is without complexity
Purifying, obtained product is L-type Aspartame.
Generality explanation:
1, design of primers and preparation: primer used in the present invention is synthetically prepared by Shanghai Invitrogen company.
2, bacillus subtilis expression bacterium WB600, digestion biomaterial etc. used in experiment, be purchased from
Novagen company.
Embodiment 1
Present embodiment discloses the building of the expression vector of organic solvent tolerant protease WQ9-2 and its in bacillus subtilis
Express the expression in bacterium WB600
Using Bacillus cereus organic solvent tolerant protease WQ9-2 gene as the protease maturation peptide sequence of template and
The restriction enzyme site feature of pMA05, design primer are as follows:
F:GGGGTCGACTCTAAAAATGTTCTCTC (underscore part is SalI restriction enzyme site)
R:GGGGGGATCCTTAGTTTATACCAACAG (underscore part is BamHI restriction enzyme site)
Solid medium LB culture medium: 1% (W/V) peptone, 0.5% (W/V) yeast extract, 1%NaCl, 1.8%-
2% agar powder
Seed culture medium LB culture medium: 1% (W/V) peptone, 0.5% (W/V) yeast extract, the training of 1%NaCl producing enzyme
Support base TB culture medium: 1.2% (W/V) peptone, 2.4% (W/V) yeast extract, 0.4% (V/V) glycerol, phosphate-buffered
Liquid (17mM KH2PO4, 72mM K2HPO4)
PMA05 gene is expanded with F and R, uses restriction enzyme SalI and BamHI double digestion after purified, while with phase
With digestion with restriction enzyme carrier PMA05, digestion products are subjected to agarose gel electrophoresis, recycle genetic fragment and carrier,
And hay bacillus competence is imported after connecting genetic fragment with carrier.
The recombinant plasmid PMA-WQ9-2 of building is converted into bacillus subtilis by heat shock and expresses bacterium WB600 impression
State cell obtains recombinant bacterium WB600/PMA-WQ9-2.PMA05 plasmid is equally transformed into WB600 competent cell simultaneously, is ordered
Entitled WB600/PMA, control strain when for protease WQ9-2 expression.By recombinant bacterium WB600/PMA-WQ9-2 and WB600/
PMA is seeded to containing 50 μ g/mL-1In kanamycins fresh LB, 37 DEG C, after 180rpm overnight incubation, make as seed liquor
With.Then it is seeded to according to 2% volume ratio containing 50 μ g/mL-1In the TB culture medium of kanamycins, 37 DEG C, 180rpm culture
It is about 20000U/mL that 72h, which reaches maximum enzyme activity,.Supernatant is taken to carry out SDS-PAGE, electrophoretogram such as Fig. 1 after centrifugation.Recombinant bacterium is laid eggs
The apparent molecular weight of white enzyme WQ9-2 is consistent with wild mushroom production protease WQ9-2, and protease WQ9-2 can be in bacillus subtilis
Solubility expression is realized in WB600.
Embodiment 2
The acquisition of this description of test organic solvent tolerant protease WQ9-2 mutant enzyme is reacted by PCR in protease WQ9-
The correspondence recombinant bacterium that 41 effective catastrophe points construct the mutant (7) of 3~41 residue complex mutations is introduced in 2 genes.
By having selected WQ9-2 compared with the structure of thermophilic protease, and in conjunction with bioinformatics and screening active ingredients means
24,27,35,38,49,51,53,65,66,69,74,78,79,96,97,101,103,176,177,210,219,223,
231,237,238,244,245,254,255,256,257,287,288,289,290 35 points, and use rite-directed mutagenesis
The amino acid in this 35 sites is carried out saturation site-directed mutagenesis, the fractional mutant example of acquisition such as table 1 by technology.
1. fractional saturation directed mutants of table
| L24I | S27T | T35S | A38G | T49S | L51I | G53A |
| A65G | A66V | A69G | A74V | A78G | G79A | D96A |
| A97G | L101I | S103T | L176I | V177L | T210S | S219T |
| T223A | V231A | I237L | I238L | L244I | L245V | V254L |
| T255S | V256I | T257S | A287G | G288A | L289I | V290L |
The single-point mutants of acquisition are subjected to random combine, the part combinatorial mutagenesis protease of acquisition is as follows: WQ9-2-3C
(T49S, L51I, G53A), WQ9-2-4F (A287G, G288A, L289I, V290L), WQ9-2-7K (L24I, S27T, T49S,
L51V, G53A, V254L, T255S), WQ9-2-13D (L24I, S27T, T49S, L51V, G53A, L101I, S103T, V254L,
T255S, A287G, G288A, L289I, V290L), WQ9-2-20C (L24I, S27T, T35S, A38G, T49S, L51V, A65G,
A66V, L101I, V254L, T255S, V256I, T257S, A287G, G288A, L289I, V290L), WQ9-2-27H (L24I,
S27T, A38G, T49S, L51V, G53A, A65G, A69G, A74V, A78G, G79A, A97G, L101I, S103T, L176I,
V177L, V254L, T255S, V256I, T257S, A287G, L289I, V290L), WQ9-2-33G (L24I, S27T, T35S,
T49S, L51V, G53A, A65G, A66V, A74V, D96A, A97G, L101I, L176I, V177L, T210S, S219T, V231A,
I237L,I238L,L245V,V254L,V256I,T257S,A287G,L289I,V290L)。
PCR reaction system is as follows:
PCR program setting:
95 DEG C of initial denaturation 1min；
98 DEG C, 10s；68 DEG C, 7.5min 30 circulations.
Glue recovery product (kit specification is shown in operating process) is disappeared at 37 DEG C with DpnI enzyme (Fermentas company)
Change glue recovery product 3h, original template of degrading.The recombinant plasmid pMA-WQ9-2 of building is converted into withered grass gemma by heat shock
Bacillus expresses bacterium WB600 competent cell, obtains recombinant bacterium.Transformed clone is forwarded on milk powder agar plate, at 37 DEG C
For 24 hours, the bacterium that can generate hydrolysis circle is positive recombinant for culture.It is tested through sequencing (being completed by Shanghai Invitrogen company)
Card mutation result.Obtain corresponding multi-point joint mutant.
3 protease WQ9-2 of embodiment catalyzes and synthesizes the optimization of the content of Aspartame precursors reaction system organic solvent
Organic solvent tolerant protease WQ9-2 has shown very high vigor in DMSO, but the concentration of different DMSO for
Synthesis Aspartame when enzyme synthesis of dynamic and the solubility of product and substrate have a great impact, so choose it is suitable
DMSO concentration is vital.Under conditions of selecting pH=6 in the present embodiment, concentration of substrate benzyloxycarbonyl group aspartic acid
(Cbz-Asp) concentration is 100mM, and phenylalanine methyl ester hydrochloride (PheOMe.HCl) concentration is 500mM, has chosen volumetric concentration
(DMSO/H2It O) is 0%, 10%, 20%, 30%, the concentration of 40% DMSO is reacted 12 under the conditions of 37 DEG C and is catalyzed to for 24 hours
Synthesize the Aspartame (Cbz-APM) of benzyloxycarbonyl group protection.The volume of specific Aspartame precursor synthetic yield and DMSO are dense
Degree relationship are as follows:
Influence of the table 2.DMSO to Cbz-APM yield
It it can be seen that the increase yield with DMSO concentration constantly reduces, but is 0-30% range in DMSO concentration
Interior, product can be precipitated from reaction system, wherein the directly application effect using water as solvent is best to be added without DMSO.
Therefore high yield also may be implemented by the usage amount for advanced optimizing enzyme in such as increase reaction system of condition.
4 protease WQ9-2 of embodiment catalyzes and synthesizes the optimization of two kinds of concentration of substrate in Aspartame precursors reaction system
Since excessive substrate is inhibited for enzyme, so benzyloxycarbonyl group aspartic acid (Cbz-L-Asp) is dense
Degree has a very big impact the yield of Aspartame precursor benzyloxycarbonyl group Aspartame.The present embodiment is designed in pH=6,
DMSO volumetric concentration is 0%, and substrate phenylalanine methyl ester hydrochloride (PheOMe.HCl) concentration is 500mM, benzyloxycarbonyl group asparagus fern
Propylhomoserin (Cbz-Asp) concentration is respectively 50mM, 100mM, 150mM, and 200mM, 250mM react 12h to for 24 hours under the conditions of 37 DEG C
Catalyze and synthesize the Aspartame (Cbz-APM) of benzyloxycarbonyl group protection.Specific Aspartame synthetic yield and benzyloxycarbonyl group asparagus fern
Propylhomoserin concentration relationship are as follows:
Influence of the table 3.Cbz-Asp concentration for Cbz-APM yield (%)
It can be seen that as the yield of the increase product of benzyloxycarbonyl group aspartic acid concentration is lower and lower.It is primarily due to benzyl
Oxygen carbonyl aspartic acid, with the increase of benzyloxycarbonyl group aspartic acid concentration, occupies benzene for entirely reacting with inhibition
The probability of the active pocket of methyl lactamine is bigger.
The concentration of phenyalanine methyl ester hydrochloric acid (PheOMe.HCl) is similarly for Aspartame precursor benzyloxycarbonyl group A Siba
The yield of sweet tea has a very big impact.The present embodiment design is in pH=6, and DMSO volumetric concentration is 0%, substrate benzyloxycarbonyl group asparagus fern
Propylhomoserin (Cbz-Asp) concentration is (100mM), and the concentration of phenyalanine methyl ester hydrochloric acid (PheOMe.HCl) is respectively 150mM,
200mM, 300mM, 400mM, 500mM, 600mM react 12h under the conditions of 37 DEG C and catalyze and synthesize benzyloxycarbonyl group protection to for 24 hours
Aspartame (Cbz-APM).Specific Aspartame synthetic yield and phenylalanine methyl ester hydrochloride concentration relationship are as follows:
Influence of the table 4.PheOMe.HCl concentration for Cbz-APM yield (%)
It can be seen that the yield of benzyloxycarbonyl group Aspartame is continuous again with the increase of phenylalanine methyl ester hydrochloride concentration
Increase.When using enzyme amount position 2000U/mL, the phenylalanine methyl ester hydrochloride of 500mM can reach maximum output.
The optimization of pH value is using egg in reaction system when 5 protease WQ9-2 of embodiment catalyzes and synthesizes Aspartame precursor
When white enzyme WQ9-2, protease WQ9-2 recombinant and its mutant carry out catalyzing and synthesizing Aspartame precursor, since the pH of enzyme is special
The opposite sex influences, and the size of pH value has a great impact for the yield of product.The present embodiment has chosen pH=4,5,6,7,8 respectively
Concentration of substrate as study condition, using the reaction system of 10mL, in entire reaction system are as follows: 100mMCbz-Asp,
500mMPheOMe.HCl, and the enzyme powder of 2000U/mL is added.The shaking table reaction 12h of 37 DEG C of 180rpm is to for 24 hours in aqueous solution.
Influence of the table 5.pH to Cbz-APM yield (%)
It can be seen that the yield of benzyloxycarbonyl group Aspartame increases with the increase of pH value when the pH of reaction system is less than 6
Add, when pH value is greater than 6, then yield is begun to decline.But it is suffered from table to find out that yield is above when pH is in the range of 4-8
50%, so the optimal optional position pH 6.
When protease WQ9-2 catalyzes and synthesizes Cbz-APM, using different reaction temperatures, the required reaction time is not
Equally.Reaction time required for increase in catalytic reaction process with reaction temperature significantly reduces.The reaction is in room temperature (25
DEG C) under can carry out, but in view of reaction efficiency and enzyme optimal reactive temperature, so preferably 37 DEG C of the present invention as reaction
Temperature.
6 protease WQ9-2 of embodiment and its mutant aqueous catalysis synthesize Cbz-APM
The present embodiment uses the concentration of substrate in reaction system are as follows: 100mM benzyloxycarbonyl group aspartic acid (Cbz-Asp),
500mM phenylalanine methyl ester hydrochloride (PheOMe.HCl), and the protease WQ9-2 of 2000U/mL is added.In the water-soluble of pH=6
The shaking table of 37 DEG C of 180rpm reacts 12h-24h in liquid, is precipitated white solid benzyloxycarbonyl group Aspartame (Cbz-APM).
6. aqueous phase system Cbz-APM yield of table
Cbz-APM is catalyzed and synthesized in 7 protease WQ9-2 mutant methanol aqueous solution of embodiment
The molar concentration rate of two substrates is 1:3 in reaction system employed in the present embodiment, using in reaction system
Concentration of substrate are as follows: 100mM benzyloxycarbonyl group aspartic acid (Cbz-Asp), 300mM phenylalanine methyl ester hydrochloride
(PheOMe.HCl), and the protease WQ9-2-3C of 3000U/mL is added.45 DEG C in the 10% of pH=7 methanol aqueous solution
The shaking table of 180rpm reacts 12h, is precipitated white solid benzyloxycarbonyl group Aspartame (Cbz-APM).
7. methanol-water phase system Cbz-APM yield of table
Z-APM is catalyzed and synthesized in 8 protease WQ9-2 mutant ethanol water of embodiment
The ethanol water that reaction system is 10%, substrate are benzyloxycarbonyl group aspartic acid and phenyalanine methyl ester hydrochloric acid
Salt, the molar ratio of the two are 1:4, and the concentration of benzyloxycarbonyl group aspartic acid is 100mM, phenylalanine methyl ester hydrochloride in system
Concentration be 400mM, pH value of reaction system 7, organic solvent tolerant protease WQ9-2 mutant be WQ9-2-4F and WQ9-2-
7K, the dosage of two kinds of mutant are 3000U/mL, and the temperature of reaction is 30 DEG C.
8. alcohol-water phase system Cbz-APM yield of table
ZAPM is catalyzed and synthesized in 9 protease WQ9-2 mutant ethyl acetate aqueous solution of embodiment
The molar concentration rate of two substrates is 2:5 in reaction system employed in the present embodiment, using in reaction system
Concentration of substrate are as follows: 200mM benzyloxycarbonyl group aspartic acid (Cbz-Asp), 500mM phenylalanine methyl ester hydrochloride
(PheOMe.HCl), and be added 3000U/mL protease WQ9-2 mutant WQ9-2-13D and WQ9-2-20C.In pH=6
10% ethyl acetate aqueous solution in the shaking table of 35 DEG C of 180rpm react 12h, white solid benzyloxycarbonyl group Aspartame is precipitated
(Cbz-APM)。
9. ethyl acetate of table-aqueous phase system Cbz-APM yield
Z-APM is catalyzed and synthesized in 10 protease WQ9-2 mutant glycerine water solution of embodiment
The glycerine water solution that reaction system is 10%, substrate are benzyloxycarbonyl group aspartic acid and phenyalanine methyl ester hydrochloric acid
Salt, the molar ratio of the two are 1:3, and the concentration of benzyloxycarbonyl group aspartic acid is 100mM, phenylalanine methyl ester hydrochloride in system
Concentration be 300mM, pH value of reaction system 5, organic solvent tolerant protease WQ9-2 mutant be WQ9-2-27H and WQ9-2-
33G, the dosage of two kinds of mutant are 1000U/mL, and the temperature of reaction is 25 DEG C.
10. glycerol of table-aqueous phase system Cbz-APM yield
The purifying of embodiment 11Cbz-APM and reaction solution recycle
It reacts 12h or filters (for reacting 12h) later for 24 hours, obtain the white solid benzyloxycarbonyl group A Si of precipitating
Ba Tian (Cbz-APM), the intermediate product generated with the buffer solution dissolution reaction of pH=10, then adjusts pH to 5 with dilute hydrochloric acid
Perhaps 5 after filtering hereinafter, abandon after filtrate (or being washed using the aqueous solution of pH=5 or 5 or less pH value) drying i.e.
Can get pure benzyloxycarbonyl group Aspartame, (its HPLC map part Fig. 3, mass spectrogram are shown in Fig. 5,4 benzyloxycarbonyl group A Si of comparison diagram
The mass spectrogram of Ba Tian (Cbz-APM) control is it is found that the present embodiment has obtained the Aspartame precursor benzyloxy carbonyl of 99% or more purity
Base Aspartame) wherein, according to the reduction amount of the aspartic acid of substrate benzyloxycarbonyl group it is found that benzyloxycarbonyl group Aspartame yield is
99% or more, the yield of recrystallization is 95% or more.
Filtrate (containing unreacted PheOMe) is poured into recycling vessel, benzyloxycarbonyl group asparagus fern ammonia is continuously added into filtrate
Sour (Z-Asp) and phenylalanine methyl ester hydrochloride (PheOMe.HCl) or phenyalanine methyl ester (PheOMe) make reaction system
The final concentration of 100mM and 500mM of middle Z-Asp and PheOMe.HCl or PheOMe is eventually adding protease WQ9-2 and carries out down
One wheel reaction.
The present embodiment also in enzymatic clarification reaction system with 5mM CaCl2The mode of solution joined 5mM thereto
Ca2+。
Influence of 11. cycle-index of table to yield
| Cycle-index | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 |
| Cbz-APM yield (%) | 95.5 | 95.3 | 95.6 | 94.3 | 95.2 | 92.1 | 90.7 | 90.8 |
12 chemical method of embodiment prepares APM
This example demonstrates benzyloxycarbonyl group Aspartames to roll into a ball get A Siba through catalytic hydrogenation removal benzyloxycarbonyl protecting group
Sweet tea.
Aspartame precursor benzyloxycarbonyl group Aspartame is added to the methanol containing palladium carbon and tert-butyl alcohol volume ratio is 1:1
Solution in, and be passed through hydrogen in the reaction system.After stirring 6h at normal temperature, stop reaction.Finally vacuum filtration obtains
The pure solid Aspartame of white.Yield is 95% or more, yield is 90% or more.
The method achieve the nil waste of substrate, the concentration of substrate of common enzyme process is low, and product is difficult to be precipitated in system, changes
There is a small amount of isomers to generate in method, carry out multistep separation, a complex steps are seriously polluted, and the present invention has bigger
Industrialization advantage.
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, fall within the scope of the claimed invention without departing from theon the basis of the spirit of the present invention.
Claims (7)
1. a kind of technique of enzyme process high efficiency synthesis benzyloxycarbonyl group Aspartame, it is characterised in that: organic solvent tolerant protease
WQ9-2 or its mutant catalysis benzyloxycarbonyl group aspartic acid and phenyalanine methyl ester or its hydrochloride enzymatic clarification benzyloxycarbonyl group Ah
This Ba Tian；The nucleotide sequence of the organic solvent tolerant protease WQ9-2 is as shown in SEQ ID NO.1, and amino acid sequence is such as
Shown in SEQ ID NO.2；
PH value is 6 in the reaction system of the enzymatic clarification；
The reaction system molar ratio of the benzyloxycarbonyl group aspartic acid and phenyalanine methyl ester or its hydrochloride is 1:3~1:6；Institute
The dosage for stating organic solvent tolerant protease WQ9-2 or its mutant is 1000-2000U/mL；
The enzymatic clarification carries out in organic solvent and/or water phase, and the organic solvent is in DMSO, ethyl alcohol or methanol
One kind；When enzymatic clarification carries out in organic solvent and the mixed liquor of water phase, volume of the organic solvent in mixed liquor is dense
It spends (v/v) and is not more than 10%；
The mutant is mutant WQ9-2-3C, WQ9-2-4F, WQ9-2-7K, WQ9-2-13D, WQ9-2-20C；Its amino acid
Sequence is respectively as shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7.
2. technique according to claim 1, it is characterised in that: the Ca of 0-10mM is added in the reaction system of enzymatic clarification2+。
3. technique according to claim 1, it is characterised in that: the Ca of 5mM is added in the reaction system of enzymatic clarification2+。
4. technique according to claim 1, it is characterised in that: the reaction temperature of the enzymatic clarification is 20-45 DEG C.
5. technique according to claim 1, it is characterised in that: the reaction temperature of the enzymatic clarification is 30 DEG C.
6. technique according to claim 1, it is characterised in that: product is directly precipitated from reaction system；It is used after precipitation
The method separation product of suction filtration, and it is used for cycling and reutilization by raw material superfluous in reaction solution is dissolved in, it adds and rubs again in mother liquor
The synthesis of batch benzyloxycarbonyl group Aspartame can be realized than the raw material for 1:1 in that concentration.
7. technique according to claim 1, it is characterised in that: the benzyloxycarbonyl group Aspartame after synthesis uses pH9~10
Aqueous dissolution, then use dilute hydrochloric acid regulation system pH=5.5~5.0, or using pH=5.5~5.0 aqueous solution
Washing, is further purified the product of generation, is dried in vacuo the benzyloxycarbonyl group Aspartame for being 99% or more up to purity.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510021876.9A CN104774891B (en) | 2015-01-15 | 2015-01-15 | A kind of technique that enzyme process efficiently synthesizes benzyloxycarbonyl group Aspartame |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510021876.9A CN104774891B (en) | 2015-01-15 | 2015-01-15 | A kind of technique that enzyme process efficiently synthesizes benzyloxycarbonyl group Aspartame |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104774891A CN104774891A (en) | 2015-07-15 |
| CN104774891B true CN104774891B (en) | 2018-12-25 |
Family
ID=53616660
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510021876.9A Active CN104774891B (en) | 2015-01-15 | 2015-01-15 | A kind of technique that enzyme process efficiently synthesizes benzyloxycarbonyl group Aspartame |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104774891B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110591077B (en) * | 2019-10-17 | 2022-01-07 | 江南大学 | Method for preparing tyrosine oligopeptide and grafted monomethoxy polyethylene glycol through enzyme catalysis |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1113266A (en) * | 1994-01-20 | 1995-12-13 | 荷兰加甜剂公司 | Enzymatic coupling of L-phenylalanine methyl ester and N-benzyloxycarbonyl-aspartic acid |
| CN1742089A (en) * | 2003-01-24 | 2006-03-01 | 味之素株式会社 | Method for producing alpha-L-aspartyl-L-phenylalanine-beta-ester and method for producing alpha-L-aspartyl-L-phenylalanine-alpha-methyl ester |
| CN1900302A (en) * | 2006-07-17 | 2007-01-24 | 广西大学 | Process for biologically synthesizing aspartame |
| CN102021125A (en) * | 2010-01-29 | 2011-04-20 | 南京工业大学 | Organic solvent resistant protease producing strain, gene of organic solvent resistant protease produced thereby and application of organic solvent resistant protease |
-
2015
- 2015-01-15 CN CN201510021876.9A patent/CN104774891B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1113266A (en) * | 1994-01-20 | 1995-12-13 | 荷兰加甜剂公司 | Enzymatic coupling of L-phenylalanine methyl ester and N-benzyloxycarbonyl-aspartic acid |
| CN1742089A (en) * | 2003-01-24 | 2006-03-01 | 味之素株式会社 | Method for producing alpha-L-aspartyl-L-phenylalanine-beta-ester and method for producing alpha-L-aspartyl-L-phenylalanine-alpha-methyl ester |
| CN1900302A (en) * | 2006-07-17 | 2007-01-24 | 广西大学 | Process for biologically synthesizing aspartame |
| CN102021125A (en) * | 2010-01-29 | 2011-04-20 | 南京工业大学 | Organic solvent resistant protease producing strain, gene of organic solvent resistant protease produced thereby and application of organic solvent resistant protease |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104774891A (en) | 2015-07-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1723281B (en) | Mutated d-aminotransferase and method for producing optically active glutamic acid derivatives using the same | |
| CN108823179A (en) | A kind of transaminase from actinomyces, mutant, recombinant bacterium and application | |
| CN108070548A (en) | One plant height produces the bacillus amyloliquefaciens engineering bacteria and fermentation process of 1-DNJ | |
| CN114015670B (en) | Histone alcohol phosphate aminotransferase mutant 138, engineering bacteria and application | |
| CN110157653A (en) | A kind of recombination bacillus coli of high yield cyclic adenosine monophosphate and its application in synthesis cyclic adenosine monophosphate | |
| CN112094856A (en) | Transaminase mutant and application thereof in sitagliptin synthesis | |
| CN106754447A (en) | Recombinant Saccharomyces cerevisiae and its application in glutamine dipeptide is synthesized | |
| CN107227283B (en) | Corynebacterium glutamicum and construction method and application thereof | |
| CN104774891B (en) | A kind of technique that enzyme process efficiently synthesizes benzyloxycarbonyl group Aspartame | |
| CN112852789B (en) | Nitrilase mutant and application thereof | |
| CN105779522B (en) | A kind of microbial enzyme conversion method produces the method for L 4 hydroxyisoleucine | |
| CN114957414B (en) | RosR mutant, recombinant microorganism thereof and application thereof | |
| CN101636497B (en) | Improved halohydrin epoxidase | |
| CN107460152A (en) | Produce recombinant bacterium, construction method and the purposes of rhodioside and the like | |
| CN112011494B (en) | Recombinant escherichia coli and application thereof in synthesis of aspartame through whole-cell transformation | |
| CN110862940B (en) | Corynebacterium glutamicum engineering bacterium and application thereof in preparation of L-tryptophan | |
| CN109402099B (en) | Lysine cyclodeaminase and application thereof | |
| TW202202621A (en) | Novel promoter and method of producing glutathione using the same | |
| CN100475957C (en) | Novel gluconate dehydratase | |
| CN104593463A (en) | Process for effectively synthesizing carbobenzoxy aspartame by utilizing organic-solvent tolerant protease PT121 or mutants of organic-solvent tolerant protease PT121 | |
| CN112011495A (en) | Recombinant escherichia coli for expressing thermolysin mutant and application thereof | |
| TWI786573B (en) | Glutamate-cysteine ligase variant and method of producing glutathione using the same | |
| CN117683754A (en) | Nitrilase mutant and application thereof in pesticide synthesis | |
| CN116479032A (en) | Biological preparation method of longevity enzyme | |
| CN107201355A (en) | A kind of highly-solid selectively phenylalanine deaminase mutant and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |