CN117384860A

CN117384860A - Monoclonal antibody for tuberculin titer calibration and application thereof

Info

Publication number: CN117384860A
Application number: CN202310188666.3A
Authority: CN
Inventors: 陈瑞爱; 鑫婷; 丁家波; 张广智; 沈青春; 熊挺; 刘郁夫; 梁琳; 杨洁
Original assignee: Zhaoqing Branch Center Of Guangdong Provincial Laboratory Of Lingnan Modern Agricultural Science And Technology; Institute of Animal Science of CAAS
Current assignee: Zhaoqing Branch Center Of Guangdong Provincial Laboratory Of Lingnan Modern Agricultural Science And Technology; Institute of Animal Science of CAAS
Priority date: 2023-02-28
Filing date: 2023-02-28
Publication date: 2024-01-12
Anticipated expiration: 2043-02-28
Also published as: CN117384860B

Abstract

The invention relates to the technical field of medicine and animal disease detection, in particular to a monoclonal antibody for calibrating tuberculin titer, which has strong binding specificity with IFN-gamma, provides a good basis for IFN-gamma determination by adopting the monoclonal antibody, and further provides a good basis for tuberculin titer calibration. Correspondingly, the invention also discloses a hybridoma cell strain GIFN-5G2 secreting the monoclonal antibody. The invention also discloses a medicine and a kit comprising the monoclonal antibody.

Description

Monoclonal antibody for tuberculin titer calibration and application thereof

Technical Field

The invention relates to the technical field of medicine and animal disease detection, in particular to a monoclonal antibody for calibrating tuberculin titer and application thereof.

Background

Bovine tuberculosis (Bovine Tuberculosis) is a human and veterinary co-occurrence of chronic infectious disease caused mainly by infection of mycobacterium tuberculosis complex (Mycobacterium tuberculosis comples, MTBC) members, mycobacterium bovis (m.bovis). Tuberculosis (Avian Tuberculosis) is caused mainly by infections with mycobacterium avium type 1, 2, 3, 6 (Mycobacterium avium) and mycobacterium geneva (Mycobacterium genavens). The mycobacterium avium is mainly used for infecting poultry, ornamental birds, wild birds such as owls, baldness and the like, pigs, pet dogs and other animals, and can also be used for infecting people, especially children with low immunity, old people and HIV infected people, so that tuberculosis nodules of multiple tissues and organs are caused. Bovine tuberculosis and poultry tuberculosis not only endanger the healthy development of the breeding industry, but also cause serious public health safety problems, threaten the health and life safety of people, and effectively prevent and control the tuberculosis directly relate to human health.

Bovine tuberculin skin test (Tuberculin Skin Test, TST) was the first method used to diagnose bovine tuberculosis, and gamma interferon release test (Interferon gamma release assay, IGRA) may be used as an alternative to tuberculin skin test TST, recommended by WOAH for use in the assisted diagnosis of bovine tuberculosis. Tuberculosis in poultry is mainly detected by a tuberculin skin test. Whether TST or IFN-gamma release assays, bovine tuberculin (PPD-B) and avian tuberculin (PPD-A) are required as detection/stimulation antigens, and thus accurately quantified tuberculin preparations are a prerequisite for accurate diagnosis of bovine tuberculosis and avian tuberculosis.

PPD-B and PPD-A are used as diagnosis antigens for bovine tuberculosis and fowl tuberculosis, and the diagnosis accuracy and the titer value are closely related. The purified mycotin is affected by various factors during the preparation process, and the traditional tuberculin titer determination method is to perform skin test by using guinea pigs sensitized by the mycotin, and calculate the mycotin titer according to the swelling area. The potency calibration result is related to factors such as guinea pig strains, individual differences, sensitization conditions, swelling measurement errors and the like, so that large fluctuation exists between the content of the mycoprotein and potency measurement, and the repeatability is poor. In practice, to overcome these difficulties, multiple protein and titer determinations are required to calculate the average. The process is time-consuming, labor-consuming, long in period and high in cost. Based on the background, a new tuberculin titer determination method is urgently needed to be created, and the accuracy and the rapidness of the determination of the titers of the PPD-B and the PPD-A are realized.

Disclosure of Invention

The invention aims to solve the technical problem of providing a monoclonal antibody aiming at guinea pig IFN-gamma and application thereof.

The invention aims to solve the technical problem of providing a monoclonal antibody for calibrating tuberculin titer and application thereof.

In order to solve the above problems, as a first aspect of the present invention, the present invention provides a hybridoma cell line GIFN-5G2 deposited with the general microbiological center of the chinese microbiological culture collection center under the accession number CGMCC No.45343 at 1 month 5 of 2023, which is assigned the microbiological institute of the national academy of sciences of china No. 3 in the region of north chen west road 1 in the region of north of the guangzhi, city. Specifically, the inventor of the invention, through intensive research, utilizes guinea pig IFN-gamma as an immune source to construct a hybridoma cell strain, and the monoclonal antibody secreted by the cell strain has strong binding specificity with the IFN-gamma, thereby providing a good basis for measuring the IFN-gamma by adopting the monoclonal antibody. Thereby providing a good basis for tuberculin potency calibration.

As a second aspect of the present invention, there is provided a monoclonal antibody secreted by the hybridoma cell line GIFN-5G2 described above.

As a third aspect of the invention, the present invention provides the use of a monoclonal antibody as described above in the preparation of a pharmaceutical composition.

As a fourth aspect of the present invention, the present invention provides a pharmaceutical composition comprising the monoclonal antibody described above.

As a fifth aspect of the present invention, the present invention provides the use of the above monoclonal antibody in the preparation of a kit for detecting guinea pig IFN- γ.

As a sixth aspect of the invention, the present invention provides the use of a monoclonal antibody as described above in the preparation of a kit for tuberculin titer calibration.

As an improvement of the technical scheme, the tuberculin is bovine tuberculin and/or avian tuberculin.

As an improvement of the technical scheme, ELISA method is adopted for detection.

As a sixth aspect of the present invention, there is provided a kit for detecting guinea pig IFN-gamma comprising the monoclonal antibody as described above.

As a seventh aspect of the invention, the invention provides a kit for tuberculin potency calibration comprising the monoclonal antibody described above.

The implementation of the invention has the following beneficial effects:

the invention constructs a hybridoma cell strain GIFN-5G2 by taking guinea pig IFN-gamma as an immune source, has strong binding specificity of a monoclonal antibody secreted by the cell strain and IFN-gamma, and can be used for high-precision quantitative detection of the guinea pig IFN-gamma. Further, it has been studied that, after the tuberculin is stimulated as a stimulating antigen to sensitize guinea pigs, there is a positive correlation between IFN-gamma concentration in blood and the titer of tuberculin. This also demonstrates that the monoclonal antibodies of the invention can be used to target tuberculin titers.

Drawings

FIG. 1 is a diagram of SDS-PAGE detection of purified recombinant guinea pig IFN-gamma protein. Lane M: protein molecular weight standard; lane 1: purified guinea pig IFN-gamma.

FIG. 2 is a protein map of SDS-PAGE to detect purified anti-guinea pig IFN-gamma monoclonal antibodies. Lane M: protein molecular weight standard; lane 1: purified 1A2; lane 2: purified 3B5; lane 3: purified 3B7; lane 4: purified 5G2; lane 5: purified 4F7.

FIG. 3 is a graph showing the detection sensitivity of recombinant guinea pig IFN-gamma using 5G2 mab as capture mab. Recombinant guinea pig IFN-gamma (ng/mL) is on the abscissa and OD450 values are on the ordinate.

FIG. 4 is a graph of guinea pig IFN-gamma standard. Recombinant guinea pig IFN-gamma (ng/mL) is on the ordinate and OD450 values are on the abscissa.

FIG. 5 shows IFN-. Gamma.concentration in peripheral blood after BSA, PBS, conA stimulation of guinea pig peripheral blood lymphocytes, respectively, using 5G2 as a coating antibody and 1A2-HRP as a detection antibody.

FIG. 6 shows IFN-. Gamma.concentration in peripheral blood after BSA, PBS, conA, PPD-B stimulation of mycobacterial sensitized and non-sensitized guinea pigs, respectively, using 5G2 as the coating antibody and 1A2-HRP as the detection antibody.

FIG. 7 shows IFN-. Gamma.concentration in peripheral blood after stimulation of mycobacterial sensitized guinea pigs and non-sensitized guinea pigs with PPD-B at various concentrations using 5G2 as a coating antibody and 1A2-HRP as a detection antibody.

Detailed Description

The present invention will be described in further detail below in order to make the objects, technical solutions and advantages of the present invention more apparent.

EXAMPLE 1 expression and purification of recombinant guinea pig IFN-gamma

1. Construction and identification of recombinant plasmids

The base sequence of guinea pig IFN-gamma in GenBank (AY 151287) is analyzed on line by using Signal IP5.0, the Signal peptide sequence of 1-25 amino acids is removed, and an IFN-gamma gene fragment (426 bp) is artificially synthesized, and the sequence is (SEQ ID NO: 1):

agatttacaaatgaaatacgcattctaaagaactactttaatgcagataactcagatgtaggagacaatgggacgctctttgtaggcattttgaagaattgccaagaggagagtgaaagaaaaatatttcagagccaaatcgtctccttctacttcaaactctttgaaaaacattttacagacaatcagactgtccaaaatagcatgaacaccatcaaggaacaaattattactaagttcttcaaagacaacagcagcaacaaggtgcaggctttcaaaaacctgattcaaatttcggtcaatgacgagcatgtccagcgccaagcgatcattgaactcaaaaaagtgatagatgacctgtcaccgaaccagaggaaacgaagaaggactcagatgctgtttcagagccggagagcatccaaataa

and (3) taking the synthesized sequence as a template, and performing PCR amplification by using IFN-F/R primer amplification guinea pig IFN-gamma gene fragments as templates. Specifically, the PCR reaction system is as follows:

the PCR reaction procedure was: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 15s, annealing at 55℃for 15s, elongation at 72℃for 30s,30 cycles; extending at 72 ℃ for 5min, and preserving at 4 ℃. Mixing the PCR product with 10×loading buffer, performing agarose gel electrophoresis under 115v for 30min, observing the band under ultraviolet gel imager, cutting the adhesive tape, and recovering the target band with a gel recovery kit (Tiangen organism).

TABLE 1 guinea pig IFN-gamma Gene sequence primers

Note that: lower case letters are cleavage sites, italics are Kozack sequences.

The pFastBacTM-HTA plasmid (purchased from Thermofisher, saved by Beijing livestock veterinary research, national academy of agricultural sciences) and the recovered PCR product were double digested with BamH I and Xba I. The enzyme digestion system is as follows:

1) Cleavage reaction I:

fully and uniformly mixing, and then placing the mixture on a metal thermostat, and incubating for 2 hours at 37 ℃; and (3) after the reaction is finished, recovering an enzyme digestion product by using a gel recovery kit (Tiangen organism).

2) Enzyme cutting reaction II:

fully and uniformly mixing, and then placing the mixture on a metal thermostat, and incubating for 2 hours at 37 ℃; and (3) after the reaction is finished, recovering an enzyme digestion product by using a gel recovery kit (Tiangen organism) according to the operation instructions.

The concentration of the cleavage products of the vector and the target gene fragment was determined by Nanodrop, ligation was performed at a molar ratio of 4-6:1, and the ligation products were electrotransformed into DH 5. Alpha. E.coli competent cells. 5 colonies were randomly selected from LB plates and PCR identified using IFN-F/R as primers, positive colonies were inoculated into LB medium containing Amp+ and cultured overnight at 37℃with 200R/min shaking, and recombinant plasmid PFastBac-IFN-gamma was extracted with plasmid extraction kit. 1 mu L of recombinant plasmid pFastBac-IFN-gamma (purchased from Biyun Tian Biotechnology Co., ltd., beijing livestock veterinary research institute, academy of agricultural sciences, china) was gently added to 1 mu L of DH10Bac competent cells, and the mixture was ice-bathed for 30 minutes; heat shock at 42 ℃ for 90 seconds, and rapidly placing on ice for standing for 5 minutes; adding 800 mu L of LB liquid medium, and culturing for 4 hours at 37 ℃ and 160 r/min; uniformly coating 100 mu L of bacterial liquid on an LB plate containing 1%o kanamycin, tetracycline and gentamicin and X-gal and IPTG; culturing for 48 hours at 37 ℃ in a incubator, picking out white colonies, and culturing on the same LB plate by streaking; culturing at 37deg.C for about 48 hr, picking white colony, inoculating into LB liquid medium containing 1%o kanamycin, tetracycline and gentamicin, and culturing at 37deg.C for 16 hr/min.

The recombinant transposon Bacmid-IFN-gamma is extracted by using a Bacmid small extraction kit (Biyun) of a baculovirus shuttle vector, and 50 mu L of 1 XTE buffer is added to dissolve the transposon, and the mixture is preserved at 2-8 ℃ for standby. PCR identification is carried out by taking the extracted Bacmid-IFN-gamma as a template and utilizing the IFN-gamma and the upstream and downstream primers of M13, positive plasmids are sent to Shanghai worker for sequencing, the positive plasmids are compared with guinea pig IFN-gamma sequences (AY 151287) published by GenBank, and sf21 insect cells are transfected by plasmids with correct sequencing.

2. Transfection

Sf21 insect cells in logarithmic growth phase (purchased from Thermofisher corporation, saved by the institute of livestock and veterinary, beijing, national academy of agricultural sciences) were counted at a cell count of 2X 10 ⁶ The density of the cells/well is spread in six-hole plates, 2mL of SF 900 II SFM culture medium is added into each hole, the mixture is placed in an insect cell incubator at 28 ℃ for 2 hours, and transfection is carried out after the cells are attached to the walls.

Solution I: 2 mug Bacmid-IFN-gamma is added into 100 mug SF 900 II SFM culture medium to be mixed evenly, and Bacmid is set up as a control;

solution II: mu.L Lipofectamin ^TM 2000 transfection reagent is added into 100 mu L SF 900 II SFM culture medium, and the time is not more than 30 minutes after uniform mixing;

uniformly mixing the solution I and the solution II, and incubating for 30 minutes at room temperature; discarding the culture medium in the six-well plate, washing the cells with 2mL of SF 900 II SFM culture medium, and adding 1mL of SF 900 II culture medium into each well; adding 800 mu L of SF 900 II SFM culture medium into the liposome mixture, and gently mixing; dropwise addition to cultured sf21 cells; after culturing for 5 hours at 28 ℃, the transfection mixture is discarded, and 2mL of SF 900 II SFM culture medium is added into each hole; culturing at 28 deg.C for 48-72 hr, collecting recombinant baculovirus from supernatant, which is F1 generation virus.

The suspension cultured sf21 insect cell state is adjusted to logarithmic growth phase, and the cell density is diluted to 2×10 ⁶ individual/mL; inoculating F1 virus (V= (MOI×total cells)/virus titer) according to MOI value=5, culturing at 28 ℃ for 48 hours at 120 r/min; centrifuging at 4deg.C for 15min at 4000r/min, and collecting supernatant as F2 virus; the same method is used for inoculating F2 toxin and collecting F3 substitution toxin.

3. Protein expression

Regulating the state of sf21 insect cells cultured in suspension to logarithmic phaseExpression for recombinant baculovirus; dilution of cell Density to 2X 10 ⁶ Inoculating P3 virus generation according to MOI value=5, setting negative control, placing in a shaker at 28deg.C, 120r/min, and culturing for 48-72 hr; centrifuging at 4deg.C for 10min at 5000r/min, collecting cell precipitate, adding cell lysate, performing ultrasonic disruption for 5min at 4deg.C for 30min, centrifuging at 12000r/min for 10min, collecting supernatant, and filtering with 0.45 μm filter to purify protein.

4. Protein purification

The prepared cell lysate supernatant was purified on an AKTA protein purifier using a HisTrap FF (5 mL) affinity column. Desalting the obtained target protein with Hiprep 26/10 Desung column, replacing the target protein with PBS (pH 7.4) buffer system, filtering with 0.22 μm filter, sterilizing, determining by BCA protein quantification method, purifying IFN-gamma concentration to 0.8mg/mL, SDS-PAGE shows that recombinant IFN-gamma protein purity can reach above 90% (figure 1), and freezing the protein in refrigerator at-80deg.C.

5. Activity determination

The antiviral activity of recombinant guinea pig IFN-gamma was determined using a microcytosis inhibition method. MDBK cells were plated at 2X 10 cells per well ⁴ The individual cells were plated in 96-well cell culture plates at 37℃with 5% CO ₂ Incubating for 4-6h under culture condition, adding recombinant IFN-gamma diluted with assay culture solution (DMEM containing 7% FBS) and empty carrier expression protein as negative control, blank control, repeating in parallel three times, 37 deg.C, 5% CO after cell adhesion ₂ After 18-24h incubation, the supernatant was discarded, washed three times with PBS, and incubated with 100TCID ₅₀ MDBK cells were infected with the virus-counteracting amount of VSV of (3% FBS-containing DMEM) and 100. Mu.L per well was simultaneously set with a positive control (VSV alone) and a protein control (recombinant IFN-. Gamma.) alone, and after 1h, the cells were replaced with complete medium (10% FBS-containing DMEM), 37℃and 5% CO ₂ The number of half lesions was observed under the conditions for 24h, with one Interferon Unit (IU) being the highest dilution at which 50% of the lesions appeared. The activity (IU/mg) of recombinant interferon was calculated according to the Reed-mulnch method, and the result showed that the recombinant expressed guinea pig IFN-gamma activity could reach 4X 10 ^7.25 IU/mg。

EXAMPLE 2 preparation of mouse anti-guinea pig IFN-gamma monoclonal antibodies

1. Anti-guinea pig IFN-gamma antibody titer detection method

The purified recombinant protein IFN-gamma is taken as a coating antigen, diluted to 1 mug/mL by carbonate buffer (pH9.6), coated at 4 ℃ overnight in each well, 200 mug of PBS sealing liquid containing 5% skim milk is added to each well after PBST is washed 3 times, sealed at 4 ℃ overnight, and gently patted dry on absorbent paper after PBST is washed 5 times, and stored in a refrigerator at-20 ℃ for standby. Taking out the ELISA plate from the refrigerator at the temperature of minus 20 ℃ to return to the room temperature, adding 100 mu L of hybridoma cell culture supernatant into each hole, adding positive control (fused mouse serum is diluted 1:2000), negative control (negative mouse serum is diluted 1:2000), incubating for 1h in a constant temperature oven at the temperature of 37 ℃, discarding culture supernatant, and washing by PBST for 5 times; HRP-goat anti-mouse IgG secondary antibody (SIGMA) was added at an optimal dilution of 1:6000, 100. Mu.L per well, allowed to act at 37℃for 1h, washed 5 times with PBST; 100 mu L of single-component TMB color developing solution (KPL) is added into each hole, the color development is carried out for 15min at 37 ℃, 50 mu L of 2M sulfuric acid solution is added into each hole to stop the reaction, and an OD450nm value is measured by an enzyme-labeling instrument. Determination criteria: the system is established when the OD450nm value of positive serum is about 1.0 and the OD450nm value of negative serum is about less than or equal to 0.1, and the positive is judged when the P/N value is more than 2.1 during detection.

2. Monoclonal antibody preparation

The purified recombinant IFN-gamma is emulsified with equal volume of Freund's complete adjuvant at a dose of 30 mug/dose, injected subcutaneously into 6-week-old female BALB/c mice via the abdomen in multiple points, and then emulsified and immunized 4 times with the same dose of antigen and equal volume of Freund's incomplete adjuvant every 3 weeks, and immunized 1 time via abdominal cavity 3 days before cell fusion.

Taking eyeballs of the BALB/c mice after the immunity enhancement, bleeding and killing, collecting serum as a positive control during hybridoma cell screening, immediately soaking the BALB/c mice in 75% medical alcohol, standing for 10min, transferring the mice to an ultra clean bench, and placing the bottom of the mice in a sterile culture dish; aseptically opening the abdominal skin of the mice to fully expose the abdominal wall; the left abdominal wall of the mouse is opened by replacing another set of sterilized scissors and tweezers, and the spleen is fully exposed; the spleens of the mice were isolated and placed in DMEM medium plates pre-filled with 10% fbs; one end of the spleen is clamped by sterilized forceps, a 5mL sterile syringe is used for sucking the culture medium in the plate to be penetrated from the other end of the spleen, and the washing is repeated until the spleen is washed to be pale; the isolated splenocytes were poured into 50mL sterile centrifuge tubes, thoroughly mixed and a small amount was counted.

The isolated spleen cells were combined with myeloma cells SP2/0 in the logarithmic growth phase at a ratio of 3:1-5:1 ratio, using PEG4000 as fusion agent, adding the fused cells into 96-well cell culture plates with feeder cells laid in advance, culturing the hybridoma cells in a selection medium containing HAT for 3-4 days, and then half-supplementing the liquid (the cell plates are not moved as much as possible for 3 days before fusion). Culturing was continued by changing to HT-containing medium by 7-9 days. When the cell clone grows to 1/4-1/3 of the area of the bottom of the well, the cell supernatant is collected. The antibody level against IFN-gamma in the cell supernatant was detected by an indirect ELISA method, and cell lines with high P/N levels were selected.

3. Monoclonal antibody cell strain subcloning and strain fixing

Subcloning the screened positive hybridoma cell strain by adopting a limiting dilution method, collecting cell supernatant when the cell clone grows to 1/4-1/3 of the bottom area of the hole, detecting the antibody level aiming at IFN-gamma in the cell supernatant by an indirect ELISA method, and screening the cell strain with high P/N. The cell stably secreting the antibody is fixed by 3 times of subcloning to obtain 5 monoclonal cell strains, 1A2, 3B5, 3B7, 4F7 and 5G2 are respectively measured by an indirect ELISA method, the titers of hybridoma cell culture supernatant, ascites and the purified monoclonal antibody are respectively measured, the maximum titer of the antibody in the cell supernatant reaches over 3200, and the titer of the antibody in the ascites reaches 10 ⁶ The potency of the monoclonal antibody after purification can reach 10 ⁵ 。

TABLE 2 determination of antibody titers in hybridoma cell culture supernatants

Monoclonal antibody subclasses were detected using monoclonal antibody subclass identification kit (Sigma), 1A2, 3B5 and 3B7 being of IgG1 type, 4F7, 5G2 being of IgG2a type.

The 5 monoclonal antibodies were tested against 2 different epitopes using the addition index assay (see table 3).

The hybridoma cell strain GIFN-5G2 for producing the high-titer monoclonal antibody 5G2 is preserved in the China general microbiological culture Collection center (China general microbiological culture Collection center) for 1 month and 5 days in 2023, and has the address of CGMCC No.45343, which is classified and named as guinea pig IFN-gamma monoclonal antibody hybridoma cell strain.

TABLE 3 recognition of cloned antibodies epitope AI analysis results

Note that: according to the formula ai= (a ₍₁₊₂₎ -A ₁ )/A ₂ The overlap ratio after superposition of two monoclonal antibodies was calculated by x 100%. Wherein A is ₁ Represents OD of monoclonal antibody of strain 1 _450nm A value; a is that ₂ Represents OD of monoclonal antibody of strain 2 _450nm A value; a is that ₍₁₊₂₎ Represents OD after superposition of 2 monoclonal antibodies _450nm Values. If the AI value after superposition of the two antibodies is greater than 30%, the two monoclonal antibodies are judged to recognize different sites.

EXAMPLE 3ELISA method for detection of guinea pig IFN-gamma

1. Preparation of 5G2 monoclonal antibody coated ELISA plate

Diluting guinea pig IFN-gamma monoclonal antibody 5G2 with 0.1M carbonate buffer (pH 9.6) to 1 μg/mL, adding an ELISA plate, coating at 2-8deg.C for 16 hours, removing coating liquid the next day, beating, washing the plate 3 times with PBST washing liquid, and washing the plate 250 μl/hole; discarding the washing solution, adding blocking solution (PBS containing 5% skimmed milk, pH 7.2-7.4), sealing at 2-8deg.C overnight, removing blocking solution the next day, beating, washing the plate 3 times with PBST washing solution, and 200 μl/hole; discarding the washing solution, beating to dry, and freezing at-20deg.C for use.

2. Preparation of HRP-labeled mouse anti-guinea pig IFN-gamma monoclonal antibody

The 1A2 monoclonal antibody was buffered in 50mM carbonate buffer (0.015M Na ₂ CO ₃ ，0.035MNaHCO ₃ Dialysis at pH 9.6) with 2 exchanges of fluid, determination of the concentration of the monoclonal antibody by BCA protein assay, and adjustment of the 1A2 protein concentration to 2mg/mL with carbonate buffer. 2mgHRP dry powder was weighed and dissolved in 100. Mu.L of ultrapure water. Weigh NaIO ₄ 21mg, dissolved in 1mL of ultrapure water, and 100. Mu.L of NaIO was aspirated ₄ The solution was slowly mixed with 100. Mu.L of HRP solution and allowed to stand at 4℃for 30min, at which point the solution was green. 2 mu L of ethylene glycol is sucked, oxidized HRP solution is slowly added, and the solution is kept stand for 30min at room temperature in dark place, and at the moment, the solution is brown. The oxidized HRP solution is directly added into the dialyzed 1A2 monoclonal antibody solution and reacted for 2 hours at room temperature. 0.4mg NaBH was weighed ₄ Dissolving in 20 μl of ultrapure water, adding all the solution into the reaction solution, standing at 4deg.C for 2 hr, and shaking every 30 min. 1A2-HRP was transferred to a 30kDa dialysis bag and dialyzed in PBS buffer for 24h, 3 changes. The 1A2-HRP was collected from the dialysis bag and sterilized by filtration through a 0.2 μm sterile filter and stored in a dark place at-80℃for a long period of time. Diluting the marked monoclonal antibody with PBS, determining the optimal dilution by a sandwich ELISA method, adding an enzyme-labeled antibody stabilizer to prepare 100 times of enzyme-labeled antibody storage solution, carrying out sterile subpackaging, and preserving at 2-8 ℃ in a dark place.

3. ELISA method detection sensitivity determination

Recombinant expressed guinea pig IFN-gamma with the concentration of 10ng/mL is diluted into 7 gradients (10, 5, 2.5, 1.25, 0.625, 0.3125 and 0.15625 ng/mL) by continuous multiple ratio of sample dilution (PBS with 1% BSA and pH value of 7.2-7.4) and prepared 15min before detection. mu.L of sample dilution (PBS with 1% BSA, pH 7.2-7.4) and 50. Mu.L of sample were added to each well, gently mixed, and reacted at room temperature (22-26 ℃) for 60 minutes. The reaction solution was discarded, 300. Mu.L of PBST washing solution was added to each well, washed 5 times, and finally gently patted dry 1 time. 100 XHRP-anti-guinea pig IFN-gamma monoclonal antibodies were diluted 100-fold with enzyme-labeled antibody dilutions (PBST of 1% BSA, pH 7.2-7.4), 100. Mu.L/well, respectively, and reacted at room temperature (22-26 ℃) for 60 minutes in the absence of light. Taking out the reaction plate, discarding the reaction solution, adding 300 μl of 1×washing solution into each well, washing for 5 times, and gently beating for 1 time at lastAnd (5) drying. OD when empty-white control _450nm When the P/N is less than or equal to 0.15, the result is effective, and when the P/N is more than or equal to 2.1, the result is judged to be positive. The results show that when 5G2 monoclonal antibody is used as coating monoclonal antibody and 1A2-HRP is used as detection antibody, the detection sensitivity of the detection antibody to guinea pig IFN-gamma can reach 1.25ng/mL, and the content of IFN-gamma and OD value are in good linear relation within the range of 1.25 and 10ng/mL (Table 4 and FIG. 3), so that 5G2 can be used as capture antibody for quantitative detection of guinea pig IFN-gamma.

TABLE 4 sensitivity of detection of guinea pig IFN-gamma with 5G2 as capture antibody

4. ELISA method for detecting natural guinea pig IFN-gamma

3 Hartley guinea pigs weighing about 350g are selected, 10mL of the blood is collected from the heart, placed in a heparin anticoagulation tube, and transported back to a laboratory for detection within 20 hours at normal temperature. Aseptically packaging anticoagulated blood into 48-well cell culture plate at 0.5 mL/well, adding gradient diluted ConA, BSA and PBS, respectively, mixing with 50 μl of each well, and placing into 5% CO at 37deg.C ₂ Incubating for 16-24h in an incubator, and centrifugally collecting the supernatant to be detected. mu.L of sample dilution (PBS containing 1% BSA) was added to each well of the monoclonal antibody-coated plate, recombinant guinea pig IFN-gamma (10, 5, 2.5, 1.25, 0.625, 0.3125, 0.15625, 0 ng/mL) was added in serial multiple dilutions to the first and second columns, each sample was repeated, 50. Mu.L of plasma sample was added to the third column, gently mixed, and the plates were sealed and reacted at room temperature (22-26 ℃) for 60 minutes. The reaction solution was discarded, 300. Mu.L of PBST washing solution was added to each well, washed 5 times, and finally gently patted dry 1 time. 100 XHRP-anti-guinea pig IFN-gamma monoclonal antibodies were diluted 100-fold with enzyme-labeled antibody dilutions (PBST of 1% BSA, pH 7.2-7.4), 100. Mu.L/well, respectively, and reacted at room temperature (22-26 ℃) for 60 minutes in the absence of light. The reaction plate was removed, the reaction solution was discarded, 300. Mu.L of 1 Xwashing solution was added to each well, washed 5 times, and finally gently patted dry 1 time. OD when empty-white control _450nm ＜0.15When the result is valid. Recombinant guinea pig IFN-gamma protein concentration as ordinate, OD ₄₅₀ The average mean value of (2) is taken as the abscissa, a standard curve is drawn, when R is ² When the value is not less than 0.99, IFN-. Gamma.can be quantified by using the obtained formula (FIG. 4). Comparison of peripheral blood IFN-gamma concentrations in guinea pigs after BSA (10. Mu.g/mL), PBS and ConA (5. Mu.g/mL) stimulation using Graphpad9.1 software revealed that the mean values of peripheral blood IFN-gamma in BSA and PBS-stimulated guinea pigs were 0.1511.+ -. 0.0134ng/mL and 0.1257.+ -. 0.0366ng/mL, respectively, and that the mean value of peripheral blood IFN-gamma in ConA-stimulated guinea pigs was 13.49.+ -. 0.4068ng/mL, and that IFN-gamma generated after ConA stimulation was significantly higher than that in BSA and PBS (FIG. 5). Therefore, when the 5G2 monoclonal antibody is used as the coating monoclonal antibody and the 1A2-HRP is used as the detection antibody, the natural IFN-gamma of guinea pigs can be effectively detected.

Example 4 calibration of tuberculin titers

1. Guinea pig sensitization

12 Hartley guinea pigs weighing about 400g were selected, 10 of which were deep intramuscular injected with 0.5mg of tubercle bacillus allergen (bovine) on the inner thigh, 2 of which served as blank controls, respectively, without treatment. After 5 weeks, a small piece of fur (about 3 cm) was pulled from the buttocks of each guinea pig ² Avoid the side of injecting allergen), diluting the international reference of PPD-B to 100IU/mL on day 2, injecting 0.1mL into the dehairing place, and observing 24 hours after injection, wherein the red and swollen area of skin at the injection place is not less than 1cm ² Indicating that the guinea pig has good sensitization condition and can be marked with a titer. 8 of 10 guinea pigs were well sensitized.

2. Stimulation of whole blood

6 guinea pigs with good sensitization and 2 blank control are selected, whole blood is collected aseptically and placed in heparin anticoagulation tubes, and the whole blood is transported to a laboratory for detection within 20 hours at normal temperature. Aseptically packaging anticoagulated blood into 48-well cell culture plate at 0.5 mL/well, adding international reference PPD-B (final concentration of 300, 150, 100, 50, 25, 10, 5, 2.5, 1 IU/mL), BSA (final concentration of 10 μg/mL), conA (final concentration of 5 μg/mL) and PBS, respectively, gently mixing, and standing at 37deg.C with 5% CO ₂ Incubate in incubator for 16-24h and collect supernatant by centrifugation.

3. ELISA detection

Each variety IFN-gamma level was assayed with reference to example 3 and 10. Mu.g/mL recombinant guinea pig IFN-gamma was used as positive control and PBS as negative control, with the result being effective when the positive control OD was 1.0 or more and the negative control OD was < 0.15. The results showed that BSA and PBS were not able to stimulate IFN-gamma production by guinea pig peripheral blood lymphocytes, that both ConA and PPD-B were able to stimulate IFN-gamma production by sensitized guinea pig peripheral blood lymphocytes, and that PPD-B was not able to stimulate IFN-gamma production by non-sensitized guinea pigs (FIG. 6). According to the standard curve, the IFN-gamma level after the effect of PPD-B was calculated, and a positive correlation was found between the amount of PPD-B and the concentration of IFN-gamma, which could be used to calibrate the PPD-B titer (FIG. 7).

The monoclonal antibody 5G2 adopted by the invention can specifically capture guinea pig IFN-gamma, can be used for quantitatively detecting natural guinea pig IFN-gamma, has good affinity, specificity and sensitivity, and can be used for calibrating PPD titer for the first time, thereby improving tuberculin titer calibration efficiency, effectively reducing detection cost, reducing errors of artificially measuring skin swelling area and enabling detection results to be more reliable.

While the foregoing is directed to the preferred embodiments of the present invention, it will be appreciated by those skilled in the art that changes and modifications may be made without departing from the principles of the invention, such changes and modifications are also intended to be within the scope of the invention.

Claims

1. A hybridoma cell strain GIFN-5G2 is preserved in China general microbiological culture Collection center (CGMCC) with the preservation number of CGMCC No.45343 at the 1 st month 5 of 2023, and the address of the China general microbiological culture collection center is China national academy of sciences of China, including Beijing, chaoyang, no. 1, xielu, and No. 3.

2. A monoclonal antibody, which is secreted by the hybridoma cell line GIFN-5G2 according to claim 1.

3. Use of the monoclonal antibody of claim 2 in the preparation of a pharmaceutical composition.

4. A pharmaceutical composition comprising the monoclonal antibody of claim 2.

5. Use of the monoclonal antibody of claim 2 in the preparation of a kit for detecting guinea pig IFN- γ.

6. Use of a monoclonal antibody according to claim 2 for the preparation of a kit for tuberculin titer calibration.

7. The use according to claim 6, wherein the tuberculin is bovine tuberculin and/or avian tuberculin.

8. The use according to claim 5 or 6, wherein the detection is by ELISA.

9. A kit for detecting guinea pig IFN- γ comprising the monoclonal antibody of claim 2.

10. A kit for tuberculin titer calibration, comprising the monoclonal antibody of claim 2.