CN102220285B - Monoclonal antibody of outer membrane protein of chlamydia abortus and application thereof - Google Patents
Monoclonal antibody of outer membrane protein of chlamydia abortus and application thereof Download PDFInfo
- Publication number
- CN102220285B CN102220285B CN 201110098276 CN201110098276A CN102220285B CN 102220285 B CN102220285 B CN 102220285B CN 201110098276 CN201110098276 CN 201110098276 CN 201110098276 A CN201110098276 A CN 201110098276A CN 102220285 B CN102220285 B CN 102220285B
- Authority
- CN
- China
- Prior art keywords
- monoclonal antibody
- pomp18d
- abortus
- chlamydozoan
- miscarriage
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to monoclonal antibody of N-terminal protein of chlamydia abortus POMP18D as well as a preparation method and application thereof. The monoclonal antibody is secreted by a hybridoma cell strain 1F10D4 with the collection number of CGMCC No.4658. The invention also provides application of the monoclonal antibody in direct fluorescence immune or indirect fluorescence immune detection of chlamydia abortus. The monoclonal antibody of N-terminal protein of chlamydia abortus POMP18D has strong specificity and fluorescent characteristic, and is suitable for being used as a fluorescence antibody to establish a direct fluorescence detection method or indirect immune fluorescence detection method.
Description
Technical field
The invention belongs to field of biological detection, relate to a kind of miscarriage preferendum chlamydozoan monoclonal antibody and preparation method thereof and application, relate in particular to a kind of miscarriage preferendum chlamydozoan POMP18D N end protein monoclonal antibody and preparation method thereof and application.
Background technology
Miscarriage preferendum chlamydozoan (Chlamydia abortus; C.abortus) be the entozoic prokaryotic organism of obligate eukaryotic cell that large numbers of and Gram-negative bacteria have substantial connection; It can cause various animal and humans' infection, and the livestock industry production of many countries is caused enormous economic loss and influences public health.Miscarriage preferendum chlamydozoan is the more common pathogenic agent that causes the dam miscarriage; In recent years, the investigation of people such as Qiu Changqing pig chlamydiosis that the large-scale pig farm of present domestic each province is carried out showed that the pig choamydiae infection was totally in rising trend; Infection rate like Sichuan in 1987 is 11.45%; 1989 be to rise to 80% in 15.52%, 2003 year, already cause serious economy loss for intensive pig production.
Aspect the chlamydozoan diagnosis, use antigenic major outer membrane albumen (MOMP) and the LPS (LPS) of remaining at most at present.Comprise the antigenic polymerase chain reaction of detection (PCR) technology of setting up according to ompA gene conservative property; According to detecting the direct immunofluorescence antibody test technology that the LPS specificity is set up; Like the chlamydozoan fluorescence detection reagent kit of Britain OXOID company, and amplify enzyme-linked immunosorbent assay (PCE-ELISA) method.Detecting the test kit of antibody, like the indirect fluorescent test kit (Israel Savyon Diagnostics) that encapsulates with LPS, is enzyme-linked immunosorbent assay kit (French IDVET) antibody assay kit etc. of envelope antigen with MOMP.But the round pcr interval between diagnosis is long, narrow application range, is unfavorable for clinical expansion, though and import antibody assay kit confidence level is higher, cost is also high, also be unfavorable for clinical popularizing.
Summary of the invention
The purpose of this invention is to provide a kind of miscarriage preferendum MOMP-E monoclonal antibody and preparation method thereof and application.
Miscarriage preferendum MOMP-E monoclonal antibody provided by the invention is produced by hybridoma cell strain 1F10D4; Its immunogen is to be immunogen with first section recombinant protein POMP18D-1 of POMP18D N end for miscarriage preferendum chlamydozoan (C.abortus) outer membrane protein; Immunity Balb/c mouse, the hybridoma cell strain that filters out then.Hybridoma cell strain 1F10D4 provided by the invention; In 2011 03 month No. 10 at China Committee for Culture Collection of Microorganisms common micro-organisms center (address: No. 3, A, DaTun Road, Chaoyang District, BeiJing City; Institute of Microorganism, Academia Sinica; Postcode 100101) preservation, preserving number are CGMCC No.4658.
The present invention also provides miscarriage preferendum chlamydozoan MONOCLONAL ANTIBODIES SPECIFIC FOR method; It is as the antigen immune mouse with miscarriage preferendum MOMP-E POMP18D N end protein; Mouse boosting cell after the immunity and myeloma cell are merged the hybridoma that obtains secretion miscarriage preferendum chlamydozoan POMP18D N end protein monoclonal antibody, and preferendum chlamydozoan POMP18D N end protein monoclonal antibody obtains miscarrying.
Wherein, described miscarriage preferendum MOMP-E POMP18D N end protein is the freezing powder of draining, and when immunity is with an amount of PBS solution dilution.
Miscarriage preferendum MOMP-E POMP18D N end protein, called after POMP18D-1, for:
1) protein of the composition of the aminoacid sequence shown in the SEQ ID No.2;
2) aminoacid sequence of SEQ ID No.2 is through adding sequence label deutero-protein.
In order to make 1) POMP18D-1 protein be convenient to purifying, can connect label as shown in table 1 at proteinic N-terminal or the C-terminal that the aminoacid sequence shown in the SEQ ID No.2 is formed.
Table 1. sequence label
| Label | Residue | Sequence |
| Poly-Arg | 5-6 (being generally 5) | RRRRR |
| Poly-His | 2-10 (being generally 6) | HHHHHH |
| FLAG | 8 | DYKDDDDK |
| Strep-tag?II | 8 | WSHPQFEK |
| c-myc | 10 | EQKLISEEDL |
Above-mentioned 2) but in POMP18D-1 protein synthetic, also can synthesize its encoding sox earlier, carry out biology again and express and to obtain.Encode above-mentioned 2) in the proteinic gene of POMP18D-1 can be through the encoding sequence that its 5 ' end and/or 3 ' end connects the label shown in the table 1 of the dna sequence dna shown in the SEQ ID No.1 be obtained.
Miscarriage preferendum MOMP-E POMP18D N end protein monoclonal anti physical efficiency of the present invention detects to C.abortus POMP18D-1 albumen, has very strong specificity, can be used for detecting miscarriage preferendum chlamydozoan.
Miscarriage preferendum chlamydozoan POMP18D N end protein monoclonal antibody of the present invention also has good fluorescent characteristic, suits to set up direct fluorescence or the chlamydial method of indirect immunofluorescence detection miscarriage preferendum as fluorescence antibody.
The chlamydial method of direct fluoroscopic examination miscarriage preferendum of the present invention; Be with fluorescein-labeled above-mentioned miscarriage preferendum chlamydozoan POMP18D N end protein monoclonal antibody directly with histocyte in corresponding antigens combines, the detection specific fluorescence detects the preferendum chlamydozoan of miscarrying under fluorescent microscope.Concrete steps comprise: (1) preparation pathological material of disease section: take doubtful C.abortus pathological material of disease, as get tissues such as air bag, lungs, spleen, liver, uterine mucosa, uterine cervix, larynx mucus and cut in right amount, after grinding under 4 ℃ of conditions; Qingfengmeisu qiong room temperature treatment 30min, 1,000r/min; Centrifugal 10min; Abandon deposition, infect the McCoy cell (placing deckglass in advance in the 24 porocyte plates) that has grown to individual layer, infect 24～48h with supernatant; Take out the deckglass that infects, with the methyl alcohol or the fixing 10～20min of absolute ethyl alcohol of precooling; Perhaps above-mentioned tissue is cooked the frozen section of 0.1～0.3mm thickness, paster is crossed on the slide in cold alcohol immersion; The suspicious respiratory tract or the vaginal swab that perhaps will collect are smeared sheet, are positioned in the cold acetone to fix, and taking-up is dried, and-20 ℃ of preservations are subsequent use; (2) foundation of direct immunofluorescence diagnostic method: take out the slide for preparing, drip PBS earlier and soak into 10min, drip the fluorescent mark C.abortus monoclonal antibody of 0.15～15 μ g/ml of about 25 μ L then; Pack in the wet box, hatch 30min for 37 ℃, take out with PBS washing 3 times; Each 5min, after washing finishes, lucifuge seasoning 5～10min; With volume(tric)fraction 50% glycerine mounting, fluorescence microscope.Simultaneously with the positive contrast of the positive slide of choamydiae infection, with the negative contrast of not infecting of slide.
Indirect fluorescent of the present invention detects the chlamydial method of miscarriage preferendum; Be to be one anti-with above-mentioned miscarriage preferendum chlamydozoan POMP18D N end protein monoclonal antibody; With fluorescently-labeled rabbit anti-mouse igg is two anti-, carries out the indirect IF staining method and detects miscarriage preferendum chlamydozoan.Specifically comprise the steps: the section of (1) preparation pathological material of disease: method and step are with aforementioned; (2) foundation of indirect immunofluorescence diagnostic method: take out the slide for preparing, drip the C.abortus POMP18D-1 protein monoclonal antibody of 2～20 μ g/ml of 25 μ L, pack in the wet box, hatch 1h for 37 ℃; Taking-up is washed 3 times with PBST, each 5min, and the anti-mouse fluorescence two of rabbit that drips the 15 μ g/ml of 25 μ L then resists; Pack in the wet box, hatch 1h for 37 ℃, take out with PBST washing 3 times; Each 5min is with volume(tric)fraction 50% glycerine mounting, fluorescence microscope.Simultaneously with the positive contrast of mouse positive serum, with the negative contrast of not infecting of McCoy cell.
In order to make the aforesaid method operation simpler, the present invention also provides direct fluorescent reagent box and indirect immunofluorescence test kit.
Direct fluorescent reagent box of the present invention contains fluorescein-labeled said miscarriage preferendum MOMP-E POMP18D N end protein monoclonal antibody.
Direct fluorescent reagent box of the present invention also can contain positive control serum, negative control sera, phosphoric acid salt and/or mounting medium.
Indirect fluorescent test kit of the present invention contains above-mentioned miscarriage preferendum MOMP-E POMP18D N end protein monoclonal antibody.
Indirect fluorescent test kit of the present invention also can contain fluorescently-labeled rabbit anti-mouse igg, positive control serum, negative control sera, phosphoric acid salt, polysorbas20 and/or mounting medium.
The prokaryotic expression pig that the present invention obtains with purifying is miscarried preferendum chlamydozoan POMP18D-1 recombinant protein as the antigen immune mouse; Through the indirect ELISA method screening positive clone, obtained the hybridoma of secretion to the monoclonal antibody of miscarriage preferendum chlamydozoan POMP18D-1 recombinant protein.From hybridoma chromosome number, biological characteristics after continuous passage is cultivated and be frozen; And the type of monoclonal antibody, subclass and aspect such as tire; Monoclonal antibody biological characteristics to being obtained has carried out system's evaluation; The result shows that the ability of the hybridoma secretory antibody that is obtained is strong and stable, the monoclonal antibody height of tiring.Directly fluorescence and indirect fluorescent test experience result show that the monoclonal antibody that is obtained all can detect to C.abortusPOMP18D-1 albumen; Have very strong specificity and fluorescent characteristic, suit to set up direct fluorescence detection method or indirect immunofluorescence detection method as fluorescence antibody.
Description of drawings
Shown in Figure 1 is the chromosome map of 1F10D4 hybridoma.
The indirect immunofluorescence assay result who is the 1F10D4 monoclonal antibody to miscarriage choamydiae infection swine disease material shown in Figure 2.Wherein, the negative contrast of A, B is the sample detection result.
Embodiment
Following examples are used to explain the present invention, but are not used for limiting scope of the present invention.The preparation method of embodiment 1 miscarriage preferendum chlamydozoan POMP18D protein monoclonal antibody
Pig miscarriage preferendum chlamydozoan CP16 bacterial strain is available from China Veterinery Drug Inspection Office culture presevation chamber, and BALB/c mouse is available from Beijing's Experimental Animal Center.
HAT substratum, HT substratum, foetal calf serum, DMEM high glucose medium, RPMI1640 substratum, horseradish peroxidase (HRP) and HRP mark rabbit anti-mouse igg, resorcinolphthalein (FITC) mark rabbit anti-mouse igg are all available from Sigma company.
Miscarriage preferendum chlamydozoan POMP18D proteic preparation (specifically can be referring to junjing Yang et al.Bull Vet Inst Pulawy, 2009,53 (4), 621-625):
Pig is had a liking for miscarriage chlamydozoan CP16 bacterial strain lyophilized powder dilute, be inoculated in the SPF chicken embryo of 6 ages in days, every piece of egg inoculation 0.2mL with 1 milliliter of sterile saline.Collect the yolk cyst membrane of 5 days dead chicken embryos, the chick embryo yolk sac film of results is added PBS (pH7.4) in ice bath, grind to form 20% suspension; Take out 100 μ L, 4 ℃, the centrifugal 10min of 3000rpm; Abandon deposition and keep supernatant, supernatant is chlamydozoan bacterium liquid, with supernatant in 4 ℃; The centrifugal 20min of 14000rpm; Abandon supernatant and stay deposition, extract the test kit step by DNA of bacteria afterwards and carry out genome extraction (the Qiagen genome extracts test kit, Germany).Have a liking for the POMP18D gene order of miscarriage chlamydozoan S26/3 bacterial strain with reference to the sheep of NCBI login, design associated clip primer, the primer sequence is following: F:TCTTGGGAAAATCTAGATACC (SEQ IDNo.8); R:GGGCAGTGTAACCACCTCAT (SEQ ID No.9).Genome with said extracted is a template, amplification purpose fragment.Reclaim the purpose fragment, after PBS-T II cloning vector is connected, do further screening, doubtful positive colony is checked order, sequence shown in SEQ ID No.1, the albumen shown in the SEQ ID No.2 of encoding.With containing SalI and NotI restriction enzyme site primer carries out the pcr amplification second time, the gene fragment of 509～1842bp of the POMP18D gene shown in the aforementioned SEQ ID No.1 that increases.Primer sequence does
F：GTCGACGG?TCTTGGGAAAATCTAGATACC(SEQ?ID?No.10)，
R：GCGGCCGCAGGGCAGTGTAACCACCTCAT(SEQ?ID?No.11)。
The PCR product is cut through SalI and NotI enzyme, is connected acquisition recombinant expression vector pET-POMP18D-1 with pET-32a (+) expression vector that same enzyme is cut.Recombinant expression vector changes BL21 (DE3) over to, induces express recombinant protein POMP18D-1 down at IPTG.
The result shows, is 37 ℃ at inducing temperature, when inductor IPTG final concentration is 1.0mmol/L; The target protein great expression; And expression amount is maximum when inducing 5 hours, and the target protein size is for 65.3kD (containing carrier pET-32a (+) label protein), and is suitable with theoretical value.Afterwards with target protein through Ni-NTA purification column (Invitrogen) purifying under the sex change condition, then through the dialysis renaturation, again through measuring concentration behind the ultrafiltration and concentration, according to the protein concentration calculation formula:
Protein concentration (mg/mL)=1.45OD
280-0.74OD
260
After obtaining protein concentration, packing.And carry out freezing draining, and process lyophilized powder ,-80 ℃ of preservations are subsequent use.
Animal immune:
POMP18D-1 albumen after concentrating with renaturation is as antigen immune Balb/c mouse in 6 age in week; Immunity is 6 times altogether; Each 1～2 week at interval, carry out immunity after being emulsified into water-in-oil with antigen and equivalent Freund's complete adjuvant for the first time, immunizing dose is 200 μ g/; Totally 2, immunization route is the subcutaneous injection of belly multiple spot.Carry out second time immunity after two weeks, carry out immunity for the third time at interval a week, all use the equivalent Freund's incomplete adjuvant twice, immunizing dose be 100 μ g/ only, immunization route is the subcutaneous injection of belly multiple spot.Carry out four in one week of every interval and exempt from and five exempt from, use the antigen liquid immunity instead, dosage be 100 μ g/ only, immunization route is an abdominal injection.Five exempt from one week of back, and mouse tail is taken a blood sample in a small amount, detect antibody titer, select to tire the high order of magnitude 10
7Above mouse is cooked booster immunization in first three sky of fusion, uses the antigen liquid abdominal injection, and dosage is 100 μ g/.
Cytogamy:
Merged recovery SP2/0 myeloma cell preceding 3 days.Under aseptic condition, get the spleen after the above-mentioned immunity of mouse, the preparation splenocyte, and draw 1 * 10 respectively
8Individual splenocyte and 2 * 10
7Individual myeloma cell's suspension under fusogen PEG4000 effect, merges.Fused cell is selected to cultivate suspension with HAT be covered with in the 96 porocyte plates of feeder cell even also the adding, every hole 100 μ L place 5%CO
2Cultivate in the incubator.Every day observed and recorded cell growing state; Note replenishing volume(tric)fraction 1%HAT substratum.
Hybridoma screening and subclone:
After cell clone after waiting to merge grows into and covers cell hole bottom 1/4～1/3, there is the culture supernatant of clonal growth to detect to all with setting up good indirect ELISA method.To detecting to strong positive hole employing limiting dilution assay carries out subclone, negative hole detects once after 3 days again, then abandons it as if still negative.Cultivate through 4 times screenings and cloning, obtaining 6 strains can the stably excreting C.abortus POMP18D-1 protein monoclonal antibody and the high hybridoma of tiring.
The preparation of odd contradictive hydroperitoneum:
With the hybridoma that screens, be inoculated in and use ages inductor silica gel H (or sterilising liq paraffin, 0.5mL/ is only) to handle 10 days healthy Balb/c mouse peritoneal in 10 weeks in advance, 0.5mL/ only (contains 5 * 10
5～1 * 10
6Individual hybridoma), through 14 days, visible mouse web portion obviously increased, and gathered ascites this moment and with the ascites 3000r/min that collects, centrifugal 10min removes grease and post precipitation and is odd contradictive hydroperitoneum, and is subsequent use in-80 ℃ of preservations.
The evaluation of monoclonal antibody:
Adopt Sigma company mouse monoclonal antibody parting kit, use agar diffusion test mensuration and show that 6 hybridoma excretory monoclonal antibodies of acquisition have 5 to be the IgG1 type, have one to be the IgG3 type.
Use indirect ELISA method and detect tiring of Hybridoma Cell Culture supernatant.The result shows C.abortus POMP18D-1 protein monoclonal antibody 1F10D4 (IgG1 type), and (1:4096K) antibody titer is the highest; The hybridoma cell strain of this antibody of secretion is preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center (abbreviation CGMCC on March 10th, 2011; Address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City; Institute of Microorganism, Academia Sinica, postcode 100101), preserving number is CGMCC No.4658.
Utilize the NST-757 cracking process.Getting goes down to posterity cultivates the cell of 24h, adds 0.1mL 1% NST-757, puts 37 ℃ of water-bath 4h, collecting cell; 2000r/min, centrifugal 10min abandons supernatant, adds 0.075mol/L KCl 10mL in the deposition; Even with the suction pipe pressure-vaccum, put 37 ℃ of water-bath 15～20min, make cellular swelling.Centrifugal abandon supernatant after, cell precipitation is with the fixing 20min of the mixed solution 10mL of 3 parts of methyl alcohol, 1 part in Glacial acetic acid min. 99.5, with 2000r/min, centrifugal 10min gets the cell precipitation smear after abandoning supernatant, after the seasoning with Giemsa dyeing, oily spectroscopy.100～108 of hybridoma 1F10D4 karyomit(e)s (Fig. 1).As can be seen from Figure 1, chromosome number is 104, shows that the cultured cells that goes down to posterity does not morph.
Mouse ascites to finally collecting carries out western blot test, and two resist the anti-mouse IgG of rabbit for the HRP mark that dilutes at 1: 1000 with antibody diluent (5% skim-milk, TBST preparation).Simultaneously, sample segment carries out SDS-PAGE.The result shows in SDS-PAGE, the very thick purpose band about a 65KDa is arranged, with the albumen sizableness behind the expression and purification; In western blot test, after the DAB colour developing, the brown purpose band about a 65KDa is arranged on the PVDF transfer film, with the used albumen sizableness of preparation monoclonal antibody, and have immunogenicity.
Adopt the ELISA method to measure the mouse ascites of the C.abortus POMP18D-1 protein monoclonal antibody 1F10D4 that collects and the cross reactivity of expression vector pET-32a (+) target protein.The result shows, gained C.abortus POMP18D-N protein monoclonal antibody and carrier proteins no cross reaction property.
Carry out fluorescent mark respectively with the C.abortus POMP18D-1 protein monoclonal antibody 1F10D4 ascites purifying for preparing, and according to the known method antagonist, prepare fluorescence antibody.Grow to the McCoy cell of individual layer on C.abortus CP16 strain infection 96 orifice plates, behind 24～48h, supernatant discarded; With absolute ethyl alcohol fixing after, PBS washing 3 times adds the corresponding fluorescence antibody of 25 μ L, 1.5 μ g/ml in 96 orifice plates; 37 ℃ of reaction 30min in wet box; PBS washing 3 times, fluorescent microscope is observed down, with PBS as negative control.The person is judged to the positive to have the green fluorescence, and no fluorescence person is judged to feminine gender.Observe and find; The positive hole McCoy cell of CP16 strain infection and the McCoy cell in the monoclonal antibody hole all present tangible green fluorescence; And the McCoy cell does not have tangible green fluorescence in the negative hole, shows that C.abortus POMP18D-1 protein monoclonal antibody 1F10D4 has good fluorescent characteristic.
Grow to the McCoy cell of individual layer on C.abortus CP16 strain infection 96 orifice plates, behind the 48h, supernatant discarded, with absolute ethyl alcohol fixing after; PBS washing 3 times adds in 96 orifice plates 37 ℃ of reaction 1h, PBS washing 3 times with the monoclonal antibody 1F10D4 of the 4 μ g/ml that prepare 25 μ L; The rabbit anti-mouse igg that adds the FITC mark of 25 μ L, 15 μ g/ml, 37 ℃ of reaction 30min, PBS washing 3 times; Fluorescent microscope is observed down, and as negative control, the mouse positive serum is as positive control with PBS.The person is judged to the positive to have the green fluorescence, and no fluorescence person is judged to feminine gender.Observe and find; The positive hole McCoy cell of CP16 strain infection and the McCoy cell in the monoclonal antibody hole all present tangible green fluorescence; And the McCoy cell does not have tangible green fluorescence in the negative hole, shows that C.abortus POMP18D-1 protein monoclonal antibody 1F10D4 has good fluorescent characteristic.
The foundation of embodiment 2C.abortus POMP18D-1 protein monoclonal antibody direct immunofluorescence detection method
Tissue samples is handled: get doubtful miscarriage chlamydozoan pathological material of disease, get proper amount of fresh lungs, spleen, uterine mucosa, vaginal mucosa, make the frozen section of 0.1～0.3mm, cold acetone is fixing after 10 minutes, the lucifuge examine.
Cell sample is handled: after grinding under 4 ℃ of conditions of pathological material of disease tissue, and 200UI/mL qingfengmeisu qiong room temperature treatment 30min, 1; 000r/min, centrifugal 10min abandons deposition; Infect the McCoy cell (placing deckglass in advance in the 24 porocyte plates) that has grown to individual layer with supernatant, infect 48h, take out deckglass; With the fixing 10min of the methyl alcohol of precooling or absolute ethyl alcohol, taking-up is dried, and-20 ℃ of preservations are subsequent use;
Take out the above-mentioned slide for preparing, drip PBS earlier and soak into 10min, drip 1.5 μ g/mL C.abortus POMP18D-1 protein monoclonal antibody 1F10D4 of about 25 μ L fluorescein isothiocyanate (FITC) marks then; Pack in the wet box; Hatch 30min for 37 ℃, take out with PBS washing 3 times each 5min; Simultaneously with the positive contrast of the positive slide of choamydiae infection, with the negative contrast of not infecting of slide.After washing finished, lucifuge seasoning 5～10min was with 50% glycerine mounting, fluorescence microscope.Utilize C.abortus POMP18D-1 protein monoclonal antibody 1F10D4 to experimentize; Detect sample clinically, and the commercial kit detected result that direct immunofluorescence diagnostic result and chlamydiaceae specificity LPS (LPS) encapsulate is done the coincidence rate comparison.
Utilize fluorescently-labeled C.abortus POMP18D-1 protein monoclonal antibody that 50 collected duplicate samples are detected, miscarriage preferendum chlamydozoan is distributed with the light-emitting particles of ellipse, bright green, systematicness in cytoplasm under fluorescent microscope.The commercial kit that encapsulates with chlamydiaceae specificity LPS (LPS) detects (IMAGEN
TMCHLAMYDIA, Oxoid Ltd, Britain) result relatively sees table 2.
The direct fluorescent method diagnosis of table 2C.abortus POMP18D-1 protein monoclonal antibody is compared with the immunofluorescence technique detected result that LPS encapsulates
| Pathological material of disease | POMP18D-1 | LPS | Coincidence rate |
| Positive | 49 | 50 | 98％ |
| Negative | 1 | 0 | 100％ |
The foundation of embodiment 3C.abortus POMP18D-1 protein monoclonal antibody indirect immunofluorescence detection method
Take doubtful C.abortus pathological material of disease, cut an amount of lungs, spleen, uterine mucosa, vaginal mucosa, after grinding under 4 ℃ of conditions, 200UI/mL qingfengmeisu qiong room temperature treatment 30min; 1.000r/min centrifugal 10min abandons deposition; Infect the McCoy cell (placing deckglass in advance in the 24 porocyte plates) that has grown to individual layer with supernatant, infect 48h, take out deckglass; With the fixing 10min of the methyl alcohol of precooling or absolute ethyl alcohol, taking-up is dried, and-20 ℃ of preservations are subsequent use.
The slide that taking-up prepares drips the C.abortus POMP18D-1 protein monoclonal antibody 1F10D4 of 25 μ L, 10 μ g/ml, packs in the wet box, hatches 1h for 37 ℃; Taking-up is with PBST washing 3 times, and each 5min drips the FITC mark rabbit anti-mouse igg of 25 μ L, 15 μ g/ml then; Pack in the wet box, hatch 1h for 37 ℃, take out with PBST washing 3 times; Each 5min is with volume(tric)fraction 50% glycerine mounting, fluorescence microscope.With the positive contrast of C.abortus mouse positive serum, with the negative contrast of not infecting of McCoy cell.If positive then can be observed the light-emitting particles of ellipse, bright green, systematicness, feminine gender does not then have (Fig. 2).
Utilize C.abortus POMP18D-1 protein monoclonal antibody 1F10D4 anti-as one; 30 parts of miscarriage chlamydozoan pathological material of diseases of clinical censorship have been detected, with PCR detected result (Zhang FM, et al; Zoonose and Public Health; 2009, positive coincidence rate 56:71-76) is 92%, with PCR as a result negative match-rate be 100% (table 3).
The comparison of indirect fluorescent method diagnosis of table 3C.abortus POMP18D-1 protein monoclonal antibody and PCR diagnostic result
| Pathological material of disease | PCR | The indirect fluorescent method | Coincidence rate |
| Positive | 25 | 23 | 92％ |
| Negative | 5 | 6 | 100％ |
In sum, C.abortus POMP18D-1 protein monoclonal antibody can be used for quick diagnosis miscarriage preferendum chlamydiosis.
The above only is a preferred implementation of the present invention; Should be pointed out that for those skilled in the art, under the prerequisite that does not break away from know-why of the present invention; Can also make some improvement and retouching, these improvement and retouching also should be regarded as protection scope of the present invention.
Claims (6)
1. miscarriage preferendum chlamydozoan POMP18D N end protein monoclonal antibody hybridoma cell strain 1F10D4, its deposit number is: CGMCC No.4658.
2. the miscarriage preferendum MOMP-E monoclonal antibody that produces by the described hybridoma cell strain of claim 1.
3. the application of the described miscarriage preferendum of claim 2 MOMP-E monoclonal antibody in preparation miscarriage preferendum chlamydozoan detection reagent.
4. the direct immunofluorescence test kit that contains the described monoclonal antibody of fluorescein-labeled claim 2.
5. the indirect immunofluorescence test kit that contains the described monoclonal antibody of claim 2.
6. indirect fluorescent test kit according to claim 5 is characterized in that, also contains fluorescein-labeled rabbit anti-mouse igg, positive control serum, negative control sera, phosphoric acid salt, polysorbas20 and mounting medium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110098276 CN102220285B (en) | 2011-04-19 | 2011-04-19 | Monoclonal antibody of outer membrane protein of chlamydia abortus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110098276 CN102220285B (en) | 2011-04-19 | 2011-04-19 | Monoclonal antibody of outer membrane protein of chlamydia abortus and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102220285A CN102220285A (en) | 2011-10-19 |
| CN102220285B true CN102220285B (en) | 2012-12-12 |
Family
ID=44776993
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110098276 Active CN102220285B (en) | 2011-04-19 | 2011-04-19 | Monoclonal antibody of outer membrane protein of chlamydia abortus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102220285B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104130326A (en) * | 2014-08-01 | 2014-11-05 | 中国农业科学院兰州兽医研究所 | Monoclonal antibody of Chlamydophila abortus macrophage infectivity potentiator and hybridoma cell thereof |
| CN108486066B (en) * | 2018-02-27 | 2021-07-27 | 中国农业大学 | Hybridoma cell strain and monoclonal antibody secreted by hybridoma cell strain and resisting chlamydia abortus |
| CN110129278B (en) * | 2019-05-31 | 2023-03-31 | 湖北省农业科学院畜牧兽医研究所 | Hybridoma cell strain CMOMP-5D7, monoclonal antibody secreted by same and application of monoclonal antibody |
| CN112358545B (en) * | 2020-11-10 | 2022-03-01 | 中国农业大学 | Preparation method and application of pigeon trichomonas and candida albicans bigeminal egg yolk antibody powder |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005027961A2 (en) * | 2003-09-23 | 2005-03-31 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Chlamydia pmpd autotransporter and its role as adhesin |
-
2011
- 2011-04-19 CN CN 201110098276 patent/CN102220285B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005027961A2 (en) * | 2003-09-23 | 2005-03-31 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Chlamydia pmpd autotransporter and its role as adhesin |
Non-Patent Citations (3)
| Title |
|---|
| JUNJING YANG et al..MOLECULAR CLONING AND CHARACTERISATIONOF THE GENES CODING FOR PASSENGER DOMAINOF THE PmpD FROM CHLAMYDOPHILA ABORTUS CP16.《Bull Vet Inst Pulawy》.2009,第53卷621-625. * |
| 杨君敬 等.流产嗜性衣原体1B 株pomp18 基因β折叠区的克隆与表达.《中国农业大学学报》.2009,第14卷(第1期),51-55. * |
| 梅仕林 等.猪流产嗜性衣原体间接ELISA抗体检测方法的建立.《第三届猪病防控学术研讨会会议论文集》.2008,821-825. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102220285A (en) | 2011-10-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103254307B (en) | HPV18E7 monoclonal antibody, hybridoma cell strain and application | |
| CN105504049B (en) | The relevant HPV E7 protein monoclonal antibody of cervical carcinoma and its application | |
| KR19990022509A (en) | Culture of Lausonia Intracellularis, Anti-Lausonia Intracellulose Vaccine and Diagnostic Reagent | |
| CN105131113B (en) | For cervical carcinoma detection and the grand antibody of list being classified and its application | |
| Philipson et al. | Recovery of a cytopathogenic agent from patients with non-diphtheritic croup and from day-nursery children. I. Properties of the agent | |
| CN102220285B (en) | Monoclonal antibody of outer membrane protein of chlamydia abortus and application thereof | |
| CN105524166A (en) | Monoclonal antibody for identifying HPV18 positive cervical epithelial cancer cells, and applications thereof | |
| CN105085673A (en) | Monoclonal antibody for detecting solid particles of coxsackievirus A16 and use of monoclonal antibody | |
| CN110746495A (en) | Recombinant protein E2 and application thereof | |
| CN101016541A (en) | Method of producing brucella vaccine antigen protein | |
| CN104498439B (en) | Hybridoma, PCV2 monoclonal antibodies and its application | |
| CN113817687B (en) | Hybridoma cell strain, influenza A virus nucleoprotein monoclonal antibody and application thereof | |
| CN105348372A (en) | Method for detecting porcine pseudorabies virus | |
| CN101982777B (en) | Duck plague virus antigen capturing ELISA method based on anti-recombination UL51 albumen antibody | |
| CN103614387B (en) | The carrying Cap gene of porcine circovirus type 2 gene optimized and recombinant plasmid and application | |
| CN105198969B (en) | The B cell epitope and its identification method of a kind of 1 type duck hepatitis A virus VP3 albumen and application | |
| CN104130326A (en) | Monoclonal antibody of Chlamydophila abortus macrophage infectivity potentiator and hybridoma cell thereof | |
| CA2605250A1 (en) | Lawsonia protein useful as a component in subunit vaccine and methods of making and using thereof | |
| KR20050039688A (en) | New bacterium causing poultry disease and vaccine derived thereof | |
| CN102776154A (en) | Mouse anti-human beta-Tubulin monoclonal antibody and hybridoma cell strain for secreting same | |
| CN108486066B (en) | Hybridoma cell strain and monoclonal antibody secreted by hybridoma cell strain and resisting chlamydia abortus | |
| CN104031152A (en) | Recombined pig/cow source escherichia coli heat stable enterotoxin fusion protein STp5-His, monoclonal antibody for resisting protein and application of protein | |
| CN107556379A (en) | Identify monoclonal antibody and its application of high-risk HPV E7 albumen | |
| CN110791479B (en) | DEV gB protein monoclonal antibody and blocking ELISA kit for detecting DEV antibody | |
| CN103305472A (en) | Bluetongue virus serum 1 (BTV1) VP2 protein monoclonal antibody (BTV1-3E8), B-cell epitope polypeptide identified by BTV1-3E8 and application of BTV1-3E8 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |