CN117363578A - Cell production method for delaying CAR-T cell exhaustion - Google Patents

Cell production method for delaying CAR-T cell exhaustion Download PDF

Info

Publication number
CN117363578A
CN117363578A CN202311294176.8A CN202311294176A CN117363578A CN 117363578 A CN117363578 A CN 117363578A CN 202311294176 A CN202311294176 A CN 202311294176A CN 117363578 A CN117363578 A CN 117363578A
Authority
CN
China
Prior art keywords
car
cells
cell
calcithiol
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202311294176.8A
Other languages
Chinese (zh)
Inventor
汤光辉
戴卫国
李书萍
周雨晴
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Suzhou Danluo Pharmaceutical Co ltd
Original Assignee
Suzhou Danluo Pharmaceutical Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Suzhou Danluo Pharmaceutical Co ltd filed Critical Suzhou Danluo Pharmaceutical Co ltd
Priority to CN202311294176.8A priority Critical patent/CN117363578A/en
Publication of CN117363578A publication Critical patent/CN117363578A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0636—T lymphocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • C12N2500/35—Polyols, e.g. glycerin, inositol
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Hematology (AREA)
  • Cell Biology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a cell production method for delaying CAR-T cell exhaustion, and relates to the field of cell immunotherapy of tumors. The method comprises the following steps: adding calcithiol with working concentration of 10-50nM into the cell culture system with stable CAR expression, and culturing; stable CAR expression refers to days 3-10 after viral transduction. Cells can be more younger after culture, and the depletion-associated phenotype is significantly weaker than that without calcithiol. The addition of Calcitriol is helpful for prolonging the action timeliness of the CAR-T cells in vivo, and has great significance for improving the curative effect of CAR-T treatment.

Description

Cell production method for delaying CAR-T cell exhaustion
Technical Field
The invention relates to the field of cellular immunotherapy of tumors, in particular to a cell production method for delaying CAR-T cell exhaustion.
Background
Chimeric antigen receptor (Chimeric antigen receptor, CAR) is an artificially synthesized T cell receptor that mimics TCR function, consisting of an extracellular antigen targeting sequence, a linker sequence, a transmembrane sequence, and a T cell activation signal domain. The extracellular antigen targeting sequence is composed of a single-chain antibody or ligand and has the function of specifically binding to a target antigen. The CAR modified T cells recognize tumor surface antigens through extracellular targeting sequences, and target and kill tumor cells expressing related antigens in a patient, so that the effect of eliminating the tumor cells is achieved.
In recent years, CAR-T technology has shown remarkable therapeutic effects in the treatment of recurrent/refractory malignant B-cell tumors as an emerging tumor immunotherapy means, and at present, many medical institutions worldwide have registered to develop clinical trials for Acute Lymphoblastic Leukemia (ALL), chronic Lymphoblastic Leukemia (CLL), non-hodgkin lymphoma (NHL), and to specifically kill tumor cells expressing the corresponding antigens by infusing modified T cells into patients, and to achieve relatively good cure rates. However, CAR-T therapy still has a number of limitations, for example, studies have shown that complete remission median time after treatment is typically around 8 months, with a significant number of patients still relapsing, which may be associated with a short residence time of CAR-T cells in patients, and thus, increasing CAR-T cell residence time in vivo has a significant implication for increasing the efficacy of CAR-T therapy.
Calcithiol is the most active metabolite of vitamin D, and is effective in inhibiting PHA-induced lymphocyte proliferation by a multivitamin D receptor (VDR) -mediated mechanism, inhibiting 70% tritium-labeled thymidine incorporation after 72 hours of culture. Callitriol inhibits interleukin-2 (IL-2) secretion in PHA-stimulated peripheral blood mononuclear cells in a concentration-dependent manner. Calcithiol increases intracellular calcium ion concentration within 5 seconds by mobilizing calcium from the endoplasmic reticulum and the formation of inositol 1,4, 5-triphosphate and diglyceride. Calcithiol can inhibit proliferation of human prostatic cancer cells and promote differentiation of human prostatic cancer cells. Callitriol selectively reduces the secretion levels of collagenase type IV (MMP-2 and MMP-9). Calcithiol has antiproliferative activity and enhances the antitumor activity of platinum-based drugs in squamous cell carcinoma and prostate cancer. Can increase G0/G1 phase retardation, induce apoptosis and differentiation, and regulate the expression of growth factor receptor. Calcithiol promotes the anti-tumor effect of many cytotoxic agents and inhibits tumor cell invasiveness and formation of new blood vessels.
Because a series of gene knockout operations are involved in the production process of general CAR-T (UCAR-T), such as TCR knockout using CRISPR/Cas9 system, gvHD is prevented from occurring, and HLA knockout reduces HvGD. However, gene knockout manipulation increases the stress of UCAR-T cells, which exhibit an enhanced depletion phenotype. How to reduce cell depletion during UCAR-T cell production has important significance for the treatment effect.
Human experimental study shows that calcithiol can play an anticancer role by delaying the depletion of immune cells; also, studies have shown that calcithiol may have adverse effects on cell proliferation.
In view of this, the present invention has been made.
Disclosure of Invention
The invention aims to provide a cell production method for delaying the exhaustion of CAR-T cells, thereby improving the in-vivo residence time of the CAR-T cells and having great significance for improving the curative effect of CAR-T treatment.
The invention is realized in the following way:
in a first aspect, the invention provides a method of delaying CAR-T cell depletion comprising the steps of: adding calcithiol with working concentration of 10-50nM into the cell culture system with stable CAR expression, and culturing; stable CAR expression refers to days 3-10 after viral transduction.
The inventors have found that, by adding calcithiol at a working concentration of 10-50nM to a cell culture system during a specific cell growth time, the cells can be more younger and the degree of depletion of the cells is significantly weaker than that of the cells without calcithiol. The addition of Calcitriol is helpful for prolonging the action timeliness of the CAR-T cells in vivo, and has great significance for improving the curative effect of CAR-T treatment.
Calcithriol: CAS number: 32222-06-3; the molecular formula: c (C) 27 H 44 O 3 The method comprises the steps of carrying out a first treatment on the surface of the Alias name: RO215535, topatriol, 1,25-Dihydroxyvitamin D3; chinese name calcitriol.
The structural formula is as follows:
the calcithiol in the present invention includes solution forms such as ethanol solution, DMSO solution, etc. not limited to calcithiol, or the analytically pure substance of calcithiol is directly added to the cell culture system.
The working concentration is: the cell culture system after adding calcithiol to the cell culture system contains an effective concentration of calcithiol.
The working concentration is, for example, selected from 10nM, 11nM, 12nM, 13nM, 15nM, 18nM, 20nM, 22nM, 25nM, 28nM, 30nM, 32nM, 35nM, 38nM, 40nM, 42nM, 45nM, 46nM, 49nM or 50nM.
Stable CAR expression refers to day 3, day4, day5, day 6, day 7, day8, day 9, or day 10 after viral transduction.
CAR expression stabilization can be confirmed by methods including, but not limited to: the stability of CAR-T cell CAR expression after prolonged culture is detected by detecting the level of CAR expression at different time nodes (e.g., flow cytometry), and if the long term expression CAR expression stability does not differ much, it is indicative that CAR expression is stable.
In a preferred embodiment of the present invention, calcithiol is added at a working concentration of 10-50nM for 2-3 consecutive days in a cell culture system following days 3-10 after viral transduction.
The addition of calcithiol at a working concentration of 10-50nM for 2-3 consecutive days helped to better inhibit cell depletion. The manner in which calcithiol is added one or more days apart will have some effect in inhibiting cell depletion.
The inventors have unexpectedly found that if the working concentration of calcithiol exceeds 50nM, the effect of inhibiting T cell expansion is exerted, but rather, the proliferation of T cells is inhibited.
In a preferred embodiment of the invention, calcithiol is added to the cell culture system at a working concentration of 10-50nM for 3 consecutive days, either 4 th or 8 th day after viral transduction.
In a preferred embodiment of the invention, viral transduction means: mixing T cells subjected to gene knockout or not subjected to gene knockout with a viral vector, and culturing; the viral vector is selected from at least one of adeno-associated virus, adenovirus, lentivirus, and retrovirus.
In a preferred embodiment of the invention, gene knockout means that at least one gene selected from the group consisting of: TCR genes, HLA-class I molecules, HLA-II encoding or regulatory genes, CD7, CD8, CD38, CD47, FAS, TGFBRII, PD-1, TIM3, CTLA4, LAG3, CD52, TIGIT, ID3, SO4, CD70, SNX9, ngR1, LXRb, and IL6 genes;
the HLA-II encoding or regulatory gene is selected from the group consisting of: HLA-DP gene, HLA-DM gene, HLA-DOA gene, HLA-DOB gene, HLA-DQ gene, HLA-DR gene, CIITA, RFX5, and combinations thereof.
In an alternative embodiment, the endogenous TCR α or β gene is knocked out.
HLA-class I molecules are heterodimers formed by a heavy chain (alpha chain) and a light chain (beta chain) linked via a non-covalent bond. The alpha chain is encoded by HLA-A and HLA-B, HLA-C, HLA-E, HLA-F, HLA-G genes respectively, and the beta chain is beta 2 microglobulin, which mainly acts to stabilize HLA-I molecules and enable the HLA-I molecules to be effectively expressed on the surface of cells. The rejection of allogeneic organ transplantation or the ineffectiveness of cell infusion of the same individual can be reduced by knocking out the coding gene of the HLA class molecule.
All HLA-class II molecules consist of two polypeptide chains (. Alpha.,. Beta.) linked by non-covalent bonds. The basic structures of the two chains are similar, but are encoded by different MHC genes, respectively, and both have polymorphisms. Spectral analysis demonstrated some similarity to class I molecules. Class II molecules can also be divided into four regions: (1) peptide binding region: the extracellular portions of the alpha and beta chains are each subdivided into two fragments of 90 amino acid residues each, referred to as the alpha 1, alpha 2 and beta 1, beta 2 peptide binding regions include the alpha 1 and beta 1 fragments, which form a peptide binding cleft (cleft) that accommodates about 14 amino acid residues. Polymorphic residues of class II molecules are mainly concentrated in the α1 and β1 fragments, and this polymorphism determines the biochemical structure of the binding site for the polypeptide and also determines the specificity and affinity for binding to peptides and T cell recognition. (2) lg-like region: this region consists of alpha 2 and beta 2 fragments, both of which contain intrachain disulfide bonds and belong to the lg gene superfamily. During antigen presentation, the site of binding of the CD4 molecule of TH cells to the class II molecule is located in the lg-like non-polypeptide domain. (3) Transmembrane and cytoplasmic regions: the two regions are structurally similar to the corresponding regions of the alpha chain of class I molecules. Most are located on Antigen Presenting Cells (APC), such as macrophages. Such provision is the case outside the cell, such as when bacteria invade the tissue, and after ingestion by macrophages, bacterial debris is presented to helper T cells using MHC to initiate an immune response. Genes which are found to regulate MHC-II expression include CIITA, RFX5, and the like.
CD7 is a pan-T cell antigen that is expressed on most T cells, so CD7 antigen-specific CAR-T cells can produce severe suicide during the preparation process, resulting in production failure. By gene knockout of the CD7 gene, CD7 expression on the cell surface can be effectively reduced and suicide of CD 7-targeted CAR-T cells can be minimized. In addition, the absence of CD7 does not affect proliferation and short-term effector function of CAR-T cells, allowing expansion of CAR-T cells with high antitumor activity.
In a preferred embodiment of the present invention, the gene knockout is performed using at least one of Zinc Finger Nuclease (ZFN), transcription activator-like nuclease (TALEN) technology, CRISPR/Cas12 technology, CRISPR/Cas9 technology, and ARCUS gene editing technology.
In an alternative embodiment, a CD7 antibody blocking, CD7 sorting step may also be included after viral transduction.
In a preferred embodiment of the invention for use, the CAR-T cells are universal CAR-T cells or autologous CAR-T cells.
In a second aspect, the invention also provides the use of calcithiol for delaying CAR-T cell depletion, for the purpose of non-disease treatment, the use comprising: callitriol with a working concentration of 10-50nM is added to the cell culture system after stable CAR expression and cultured.
In a preferred embodiment of the invention for use, stable CAR expression refers to days 3-10 after viral transduction.
Callitriol was added at a working concentration of 10-50nM for 2-3 consecutive days in the cell culture system from day 3 to day 10 post viral transduction.
Calcritol was added to the cell culture system at a working concentration of 10-50nM for 3 consecutive days, either 4 th or 8 th day after viral transduction.
The invention has the following beneficial effects:
the invention provides a new application of calcithiol in delaying the exhaustion of CAR-T cells. The inventors found that the addition of calcithiol at a working concentration of 10-50nM to the cell culture system resulted in a more youthful cell after incubation and a significantly weaker degree of cell depletion than without calcithiol for a specific cell growth time. The addition of Calcitriol is helpful for prolonging the action timeliness of the CAR-T cells in vivo, and has great significance for improving the curative effect of CAR-T treatment.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments will be briefly described below, it being understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and other related drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 is a graph showing the statistical results of the cell activity and the fold expansion of CAR-T cells prepared in examples 1 to 3 and comparative examples 1 to 3 using a cytometer in Experimental example 1;
FIG. 2 is a graph showing the results of statistics of the molecular expression levels associated with depletion shown in Experimental example 2 (the abscissa time is calculated from the day of initiation of activation of the selection);
FIG. 3 is a graph showing the result of killing the tumor cells in the killing system within 100 hours as shown in experimental example 2;
FIG. 4 is a graph of the results of continuous killing of tumor cells by continued in vitro culture of CAR-T cells for 20 days to depletion (time on the abscissa calculated from the day of initiation of selective activation);
FIG. 5 is a graph showing the results of statistics of the molecular expression levels associated with depletion shown in Experimental example 3 (the abscissa time is calculated from the day of initiation of activation of the selection);
FIG. 6 is a graph showing the results of killing the tumor cells in the killing system within 100 hours as shown in Experimental example 3.
Detailed Description
Reference now will be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. Indeed, it will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the scope or spirit of the invention. For example, features illustrated or described as part of one embodiment can be used on another embodiment to yield still a further embodiment.
Unless otherwise indicated, practice of the present invention will employ conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry and immunology, which are within the ability of a person skilled in the art. This technique is well explained in the literature, as is the case for molecular cloning: laboratory Manual (Molecular Cloning: A Laboratory Manual), second edition (Sambrook et al, 1989); oligonucleotide Synthesis (Oligonucleotide Synthesis) (M.J.Gait et al, 1984); animal cell culture (Animal Cell Culture) (r.i. freshney, 1987); methods of enzymology (Methods in Enzymology) (Academic Press, inc.), experimental immunology handbook (Handbook of Experimental Immunology) (D.M.Weir and C.C.Blackwell, inc.), gene transfer vectors for mammalian cells (Gene Transfer Vectors for Mammalian Cells) (J.M.Miller and M.P.calos, inc., 1987), methods of contemporary molecular biology (Current Protocols in Molecular Biology) (F.M.Ausubel et al, inc., 1987), PCR: polymerase chain reaction (PCR: the Polymerase Chain Reaction, inc., 1994), and methods of contemporary immunology (Current Protocols in Immunology) (J.E.Coligan et al, 1991), each of which is expressly incorporated herein by reference.
In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.
The features and capabilities of the present invention are described in further detail below in connection with the examples.
Example 1
The embodiment provides a preparation method of a universal CART cell, which comprises the following steps:
(1) Day0 sort activation:
thawing frozen PBMC (given by Bai of Shanghai) in a water bath kettle at 37 ℃ for 2min, transferring to a biosafety cabinet, sucking cell suspension by a pipette, placing into a 50ml centrifuge tube filled with AIM serum-free culture medium, gently blowing and mixing uniformly, taking 20 μl, and detecting cell activity and number by using a cell counter; after centrifugation, the supernatant was discarded and the cells were resuspended by autoMACS Running Buffer for 1.0X10 7 cell/80. Mu.l was used.
Pan T Cell Isolation Kit (from Meitian and Biotechnology Co., ltd.) was taken out of the refrigerator at 4℃every 10 7 Adding 10uL Pan T Cell Biotin-Antibody Cocktail to the cells, screwing the bottle cap, and incubating at low temperature in a refrigerator at 4 ℃ for 5min. After the incubation, every 10 times is added into the incubation system 7 Adding 30uL autoMACS Running Buffer cells, and blowing and uniformly mixing for later use. Every 10 7 Cells were added 20uL Pan T Cell Microbead Cocktail. Mixing, and incubating at 4deg.C for 10min.
At a further 5min from the end of incubation, the sorting column (LS) was mounted on a MACS sorting magnet rack (available from Meitian Biotechnology Co., ltd.) in a biosafety cabinet, and a filter was placed, a sterile 15mL centrifuge tube was placed under the column, and then 3mL autoMACS Running Buffer (available from Meitian Biotechnology Co., ltd.) was added to the sorting column for rinsing.
After incubation was completed, 3mL autoMACS Running Buffer light blow was added to the cell suspension. The prepared cell suspension was slowly added to the column (maximum sorting amount per LS sorting column was 1.0X10) 8 cells), 3mL autoMACS Running Buffer was added to the column at the completion of the cell suspension passing through the column and allowed to stand until no more liquid was allowed to drip, and this step was repeated once. Unlabeled cells passing through the column were collected, and after the unlabeled cells were completely dropped, the cell suspension in a 15mL centrifuge tube was blown, mixed and counted and centrifuged (centrifugation speed: 300g, centrifugation time: 10min, centrifugation temperature: 23 ℃, rising speed: 8, falling speed: 8). After centrifugation, the cells were resuspended to 2.0X10 s with complete medium according to the counting result 6 The cell/mL density was in a suitable flask.
Based on the result of the counting, the addition amount (beads volume: 1.0X10) of CD3/CD28 Dynabeads (available from Sesameimer technology) was calculated 6 cells/25. Mu.l). Taking out the corresponding amount of magnetic beads, adding the magnetic beads into a 50mL centrifuge tube filled with a proper amount of culture medium, blowing and uniformly mixing, placing the centrifuge tube on a 50mL magnetic rack, standing for 3min, and sucking out and discarding the culture medium after the liquid in the tube is clarified; the centrifugal tube is repeatedly washed once (the operation of blowing and beating the uniformly mixed magnetic beads is needed to be taken out of the magnetic frame). Finally, the magnetic beads are resuspended by 1-2 mL of complete culture medium, and are added into a culture bottle with adjusted cell culture density, and the mixture is stirred gently and stirred uniformly and then is subjected to stationary culture for 24 hours.
(2) Day1 TCR gene knockout:
taking out the culture flask from the incubator, blowing and beating uniformly mixed cells, transferring the cell suspension into a centrifuge tube, then placing the centrifuge tube on a magnetic rack for standing for three minutes, and transferring the cell suspension into a new centrifuge tube to achieve the aim of removing magnetic beads; gently blow and mix the mixture and count, then place the centrifuge tube into a centrifuge for centrifugation. After centrifugation, the supernatant was discarded, and the result was counted to 3X 10 6 cell/100 ul was added to T Buffer to resuspend cell pellet; at the same time, the corresponding Cas9 enzyme (5 ug, purchased from Invitrogen), 2uL sgRNA (targeted TCR,75uM, gold strep synthesis), was taken for incubation to form Cas9-RNA complex according to the count results.
The electrotometer (Invitrogen Neon) was tuned to the parameters of interest: 1600V, 10ms. After uniformly mixing the cell suspension and cas9-RNA complex, sucking the suspension by an electrokinetic transfer gun, and loading the suspension into an electrokinetic transfer cup for electrokinetic transfer operation, thus obtaining the KOT.
After the electrotransfer, the cell suspension in the electrotransfer gun is added into a culture bottle filled with a preheated complete culture medium for culturing for 72 hours.
The sgRNA target sequence targeting the TCR may be selected from one of:
TCR-G1:TTCGGAACCCAATCACTGAC；
TCR-G2:TCAGGGTTCTGGATATCTGT；
TCR-G3:AAGTTCCTGTGATGTCAAGC；
TCR-G4:CTGGATATCTGTGGGACAAG；
TCR-G5:AGAGTCTCTCAGCTGGTACA；
TCR-G6:TGGATTTAGAGTCTCTCAGC；
TCR-G7:CTTCAAGAGCAACAGTGCTG；
TCR-G8:GCTGGTACACGGCAGGGTCA。
the sequence of sgrnas is as follows:
TCR-G1：
5'-mU*mU*mC*GGAACCCAAUCACUGACGUUUUAGAGCUAGA AAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAA AAAGUGGCACCGAGUCGGUGCU*mU*mU*mU-3'
TCR-G2：
5'-mU*mC*mA*GGGUUCUGGAUAUCUGUGUUUUAGAGCUAGA AAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAA AAAGUGGCACCGAGUCGGUGCU*mU*mU*mU-3'
TCR-G3：
5'-mA*mA*mG*UUCCUGUGAUGUCAAGCGUUUUAGAGCUAGA AAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAA AAAGUGGCACCGAGUCGGUGCU*mU*mU*mU-3'
TCR-G4：
5'-mC*mU*mG*GAUAUCUGUGGGACAAGGUUUUAGAGCUAGA AAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAA AAAGUGGCACCGAGUCGGUGCU*mU*mU*mU-3'
TCR-G5：
5'-mA*mG*mA*GUCUCUCAGCUGGUACAGUUUUAGAGCUAGA AAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAA AAAGUGGCACCGAGUCGGUGCU*mU*mU*mU-3'
TCR-G6：
5'-mU*mG*mG*AUUUAGAGUCUCUCAGCGUUUUAGAGCUAGA AAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAA AAAGUGGCACCGAGUCGGUGCU*mU*mU*mU-3'
TCR-G7：
5'-mC*mU*mU*CAAGAGCAACAGUGCUGGUUUUAGAGCUAGA AAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAA AAAGUGGCACCGAGUCGGUGCU*mU*mU*mU-3'
TCR-G8：
5'-mG*mC*mU*GGUACACGGCAGGGUCAGUUUUAGAGCUAGA AAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAA AAAGUGGCACCGAGUCGGUGCU*mU*mU*mU-3'
wherein m represents 2' O-Methyl RNA and x represents phosphothioate
(3) Day4 viral transduction:
lentivirus packaging is carried out before virus transduction, and the lentivirus packaging process is as follows:
the PEI transfection method (for T75 flasks) was as follows:
(a) Resuscitate 293T/17 cells into 1 x T75, medium volume 15mL, and culture for 2 days;
(b) Taking 293T/17 cells of step (a) and passaging into 1T 225, culturing for 2 days,
45mL of culture medium;
(c) 293T/17 cells were passaged into 3X T75 cells at a plating density of approximately 6X 10 6 Individual cells/T75 flasks;
(d) And (3) virus packaging: the state of cells was observed before transfection, and transfection was performed at a confluency of about 90%. The medium in the bottle was discarded, replaced with 15mL of fresh DMEM medium (without antibiotics), and cultured for 30min;
preparing a solution A: taking 17.7 mug of pHR-Traditional CAR (anti-CD 19 CAR expression plasmid from Addgene), 8.8 mug of auxiliary plasmid pRSV-REV, 8.8 mug of auxiliary plasmid pMDLg/pRRE and 4.4 mug of auxiliary plasmid pMD2.G, wherein the transfection ratio is 4:2:2:1, the total amount is 40 mug, diluting to constant volume to 0.75mL by serum-free DMEM after mixing, and standing for 5min at room temperature after mixing;
preparing a solution B: taking 630 mu L of DMEM, adding 120 mu L of PEI working solution (1 mg/mL, stored at 4 ℃ C., and Yuanli Biotechnology Co., ltd.), fully and uniformly mixing, and standing at room temperature for 5min;
and (3) dropwise adding the solution B into the solution A, gently mixing, and incubating for 20min at room temperature. Dropwise adding the mixed solution into cells, gently mixing, and culturing in 5% carbon dioxide for 6h;
(e) The original medium was discarded in the morning, and 15mL of DMEM medium free of serum and antibiotics was added for cultivation. Viruses were harvested after 36 h. Cell supernatants were harvested and centrifuged at 4000rpm for 10min. The supernatant was filtered through a 0.45 μm filter, and then transferred into a high-speed centrifuge tube, trimmed, centrifuged at 30000g and 4℃for 6 hours, the supernatant was blotted, the virus particles were resuspended by adding 120. Mu.L of sterile PBS buffer, mixed well at 60. Mu.L/branch and kept in a refrigerator at 80 ℃.
Viral transduction: taking out cells from the incubator, lightly blowing and uniformly mixing, and detecting the density and the activity rate by using a counter; and adding the lentivirus packaged in advance according to the MOI=4 according to the counting result, and standing for culturing after gently shaking and mixing. While a small amount of KOT was left for further culture. Culture conditions: (37+ -1) DEGC, (5+ -0.5)% CO 2 。
(4) Day5 resuspended cells:
and taking out the cells, uniformly mixing and counting the cells after 18-24 hours, loading the cells into a centrifuge tube for centrifugation, discarding supernatant after the centrifugation is finished, and re-suspending the cells in a culture flask by using a complete culture medium for continuous stationary culture for 72 hours. Culture conditions: (37+ -1) DEGC, (5+ -0.5)% CO 2 。
(5) Day8 added calcithiol (i.e., calcithiol was added on Day4 after viral transduction, available from MCE):
the cells were removed from the incubator, gently swirled, mixed, 20. Mu.l of the cell suspension was aspirated, and cell viability and number were detected using a cell counter. According to the counting result, 8×10 5 culture density of cells/ml three days after day8, and calcithiol was added to the culture system at a working concentration of 10 nM. Culture conditions: (37+ -1) DEGC, (5+ -0.5)% CO 2 。
(6) Day11: the cells were removed from the incubator and mixed well, 20. Mu.l of the cell suspension was aspirated, and cell viability and number were measured using a cell counter.
Example 2
In comparison with example 1, the only difference is that step (5) is different, the remaining steps are identical:
in step (5), this embodiment: according to the counting result, 8×10 5 culture Density of cells/ml three days after 8 days (i.e., 4 days after viral transduction), calcithiol was added to the culture system at a working concentration of 25 nM.
Example 3
In comparison with example 1, the only difference is that step (5) is different, the remaining steps are identical:
in step (5), this embodiment: according to the counting result, 8×10 5 culture Density of cells/ml three days after 8 days (i.e., 4 days after viral transduction), calcithiol was added to the culture system at a working concentration of 50nM.
Example 4
In comparison with example 1, steps (1-3) are identical, the remaining steps being different:
step (4)
Day5 resuspended cells:
and taking out the cells, uniformly mixing and counting the cells after 18-24 hours, loading the cells into a centrifuge tube for centrifugation, discarding supernatant after the centrifugation is finished, and re-suspending the cells in a culture flask by using a complete culture medium for continuous stationary culture for 5 days. Culture conditions: (37+ -1) DEGC, (5+ -0.5)% CO 2 。
Step (5) Day11 (i.e. Day 7 after viral transduction):
the cells were removed, gently swirled, mixed, 20. Mu.l of the cell suspension was aspirated, cell viability and number were measured using a cytometer, and appropriate amounts of cells were removed for flow-testing of CAR and depletion phenotypes (Tim-3, LAG-3, TGFBRII, TIGIT, PD-1). Based on the count result, two sets of cells of the same number (1X 10 6 cells) were used as control and experimental groups, respectively.
Control group: at 8×10 5 The cells/ml were cultured continuously at a culture density of three days.
Experimental group: prepared calcithiol was added to the same culture system as the control group at a working concentration of 50nM and treated for three days.
Culture conditions: (37+ -1) °C, (5+ -0.5)%CO 2 。
Step (6) Day14:
control group: appropriate amount of cells were taken for flow detection of CAR and depletion phenotype (Tim-3, LAG-3, TGFBRII, TIGIT, PD-1).
Experimental group: changing the culture medium to remove calcithiol in the culture system for continuous culture; and simultaneously taking a proper amount of cells and performing flow detection on CAR and depletion phenotype (Tim-3, LAG-3 and TGFBRII, TIGIT, PD-1) together with a control group.
The results of the assays are shown in the table below and show that the addition of Calcitriol treatment at day11 (i.e., from day 7 after viral transduction) can inhibit the expression level of CAR.
Group of Control group Experimental group
CAR(％) 55 45
Comparative example 1
In comparison with example 1, the only difference is that step (5) is different, the remaining steps are identical:
in step (5), this embodiment: according to the counting result, 8×10 5 culture Density of cells/ml three days after day8, calcriol was added to the culture system at a working concentration of 75 nM.
Comparative example 2
In comparison with example 1, the only difference is that step (5) is different, the remaining steps are identical:
this embodiment is in step (5): according to the counting result, 8×10 5 culture Density of cells/ml three days after day8, calcriol was added to the culture system at a working concentration of 100 nM.
Comparative example 3
In comparison with example 1, the difference is only that step (5) is different, calcithiol is not added in this comparative example, and the rest steps are the same:
in step (5), this embodiment: according to the counting result, 8×10 5 The culture density of cells/ml was continued for three days from day8 to the end of the culture.
Day11: the cells were removed from the incubator and mixed well, 20. Mu.l of the cell suspension was aspirated, and cell viability and number were measured using a cell counter.
Experimental example 1
This experimental example uses a cytometer to detect the fold expansion and cell activity of CAR-T cells prepared in examples 1-3 and comparative examples 1-3.
As a result, referring to FIG. 1, the addition of calcithiol at a working concentration of 10-50nM to the culture system had a higher expansion of CAR-T cells than the addition of calcithiol at working concentrations of 75nM and 100nM, with no apparent difference in cell activity.
Experimental example 2
This experimental example examined the killing effect of CAR-T cells of the experimental and control groups of example 1 on tumor cells. The control group was CAR-T cells obtained by culturing in a culture system without Callitriol treatment, and the control group was treated in the same manner as in step (5) Day8 of example 1.
1) Exhaustion-related molecule detection:
cells from control and experimental groups were taken at days 11, 15, 18 after cell activation for flow detection of CAR and depletion phenotypes (Tim-3, LAG-3, TGFBRII, TIGIT, PD-1).
The expression level of the molecules related to depletion is shown in fig. 2, ctrl is a control group, calcithiol is an experimental group, and the results show that the CAR-T cells treated by calcithiol express less molecules related to depletion, which suggests that the CAR-T cells have better persistence.
2) Killing ability detection:
to evaluate CAR-T depletion resistance and sustained killing of target cells after calcithiol treatment, the inventors performed experiments using an induced depletion model (CAR-T cells were continued to be cultured in vitro for 20 days to depleted state).
The experimental group and the control group are respectively 2 multiplied by 10 5 After adding KOT (i.e., T cells after gene knockout) from example 1, which was continued to be cultured in step (3), to control cells, the total T cells of both groups were kept identical. Thereafter, 8X 10 cells were added to both groups of cells 5 Is obtained from ATCC. After centrifugation, the cells were resuspended in 1ml of tumor cell medium, and 100ul of the cell suspension was taken after mixing and the tumor cell proportion in the killing system was examined with a flow meter as baseline for comparison of the subsequent killing changes.
Killing for 24 hours, mixing the cells, taking 100ul of cell suspension from two groups, and detecting the proportion of tumor cells in the killing system by using a flow meter.
Killing for 48 hours, mixing the cells uniformly, taking 100ul of cell suspension from two groups, and detecting the proportion of tumor cells in the killing system by using a flow meter.
Killing for 72 hours, mixing the cells uniformly, taking 100ul of cell suspension from two groups, and detecting the proportion of tumor cells in the killing system by using a flow meter.
Results referring to figure 3, the sustained inhibition of target cells by calcithiol treated CAR-T was significantly better than the control.
3) CAR expression detection:
the following table shows the results of the detection of CAR expression levels for the control and experimental groups at day14, showing no significant differences in CAR expression capacity between the two groups.
Group of Control group Experimental group
CAR(％) 64.3 62.2
To evaluate whether the proliferation potency of CAR-T cells was affected after calcithiol treatment, the proliferation potency of cells was compared for 12-18 days, and as a result, there was no significant difference between CAR-T cells after calcithiol treatment and control group as shown in fig. 4.
Experimental example 3
An experiment was performed according to the method of example 4 on day11 (step (5)) as follows:
Day11：
the cells were removed from the incubator, gently swirled, mixed, 20. Mu.l of the cell suspension was aspirated, cell viability and number were measured using a cell counter, and appropriate amounts of cells were removed for flow-testing of CAR and depletion phenotypes (Tim-3, LAG-3, TGFBRII, TIGIT, PD-1).
Based on the count result, two sets of cells of the same number (1X 10 6 cells) were used as control and experimental groups, respectively.
Control group: at 8×10 5 The cells/ml were cultured continuously at a culture density of three days.
Experimental group: prepared calcithiol was added to the same culture system as the control group at a working concentration of 50nM and treated for three days.
Experimental group: changing the culture medium to remove calcithiol in the culture system for continuous culture;
1) CAR expression detection:
cells from the control and experimental groups were taken on day14 for flow detection of CARs. The levels of CAR expression are shown in the following table, and the experimental group can significantly inhibit the expression level of CAR-T cells.
Group of Control group Experimental group
CAR(％) 62.4 54.2
2) Exhaustion-related phenotype detection:
cells from the control and experimental groups were taken on day11, day 13 and day 17 for flow-through detection of the depletion phenotype (Tim-3, LAG-3, TGFBRII, TIGIT, PD-1).
3) Killing detection:
to evaluate CAR-T depletion resistance and sustained killing of target cells after calcithiol treatment, the inventors performed experiments using an induced depletion model (CAR-T cells were continued to be cultured in vitro for 20 days to depleted state).
The experimental group and the control group are respectively 2 multiplied by 10 5 After that, KOT, which was continuously cultured in step (3) of example 1, was added to the cells of the control group, so that the total T cells of both groups were kept identical. Thereafter, 8X 10 cells were added to both groups of cells 5 Is obtained from ATCC. After centrifugation, the cells were resuspended in 1ml of tumor cell medium, and 100ul of the cell suspension was taken after mixing and the tumor cell proportion in the killing system was examined with a flow meter as baseline for comparison of the subsequent killing changes.
Day12: killing for 24 hours, mixing the cells, taking 100ul of cell suspension from two groups, and detecting the proportion of tumor cells in the killing system by using a flow meter.
Killing for 48 hours, mixing the cells uniformly, taking 100ul of cell suspension from two groups, and detecting the proportion of tumor cells in the killing system by using a flow meter.
Killing for 72 hours, mixing the cells uniformly, taking 100ul of cell suspension from two groups, and detecting the proportion of tumor cells in the killing system by using a flow meter.
The phenotype data and killing data are collected, the molecular expression amount related to depletion is shown by referring to figure 5, ctrl is a control group, calcitriol is an experimental group, and the result shows that the CAR-T cells treated by Calcitriol express less depletion related molecules, and the CAR-T cells are indicated to have better persistence.
The results of killing the proportion of tumor cells in the killing system within 100 hours are shown by referring to FIG. 6, and the results show that the sustained inhibition effect of CAR-T after Callitriol treatment on target cells is obviously better than that of a control group.
From a combination of experimental examples 2 and 3, it was found that the cells of both experimental groups to which calcithiol was added were younger and depleted significantly less than those of the two control groups to which calcithiol was not added. From the killing plots of the two experimental examples, it was found that the killing effect of the experimental group treated with calciriol was better at Day8-Day11 (i.e., from Day4 after virus transduction) than the experimental group treated with calciriol at Day11-Day14 (i.e., from Day 7 after virus transduction).
The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims (10)

1. A cell production method for delaying CAR-T cell depletion, comprising the steps of: adding calcithiol with working concentration of 10-50nM into the cell culture system with stable CAR expression, and culturing; the stable CAR expression refers to days 3-10 after viral transduction.
2. A method of cell production to delay CAR-T cell depletion according to claim 1 wherein calcithiol at a working concentration of 10-50nM is added for 2-3 consecutive days in the cell culture system following days 3-10 after viral transduction.
3. A method of delaying CAR-T cell depletion according to claim 2, wherein calcithiol at a working concentration of 10-50nM is added to the cell culture system for 3 consecutive days from day4 or day8 after viral transduction.
4. The method of cell production to delay CAR-T cell depletion of claim 1, wherein the viral transduction is: mixing T cells with or without gene knockout with a viral vector, and culturing; the viral vector is selected from at least one of adeno-associated virus, adenovirus, lentivirus and retrovirus.
5. The method of claim 4, wherein the gene knockout is a knockout of at least one gene selected from the group consisting of: TCR genes, HLA-class I molecules, HLA-II encoding or regulatory genes, CD7, CD8, CD38, CD47, FAS, TGFBRII, PD-1, TIM3, CTLA4, LAG3, CD52, TIGIT, ID3, SO4, CD70, SNX9, ngR1, LXRb, and IL6 genes;
the HLA-II encoding or regulatory gene is selected from the group consisting of: HLA-DP gene, HLA-DM gene, HLA-DOA gene, HLA-DOB gene, HLA-DQ gene, HLA-DR gene, CIITA, RFX5, and combinations thereof.
6. The method of claim 5, wherein the gene knockout is performed using at least one of Zinc Finger Nuclease (ZFN), transcription activator-like nuclease (TALEN) technology, CRISPR/Cas12 technology, CRISPR/Cas9 technology, and ARCUS gene editing.
7. A cell production method that delays depletion of CAR-T cells according to any of claims 1-6, characterized in that the CAR-T cells are universal CAR-T cells or autologous CAR-T cells.
Use of calcithiol for delaying CAR-T cell depletion, wherein said use is for the treatment of a non-disease, said use comprising: adding calcithiol with working concentration of 10-50nM into the cell culture system with stable CAR expression, and culturing; the stable CAR expression refers to days 3-10 after viral transduction.
9. The use according to claim 8, wherein calcithiol at a working concentration of 10-50nM is added for 2-3 consecutive days in the cell culture system from day 3 to day 10 after viral transduction.
10. The use according to claim 9, wherein calcithiol at a working concentration of 10-50nM is added to the cell culture system for 3 consecutive days, starting on day4 or 8 after viral transduction.
CN202311294176.8A 2023-10-08 2023-10-08 Cell production method for delaying CAR-T cell exhaustion Pending CN117363578A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311294176.8A CN117363578A (en) 2023-10-08 2023-10-08 Cell production method for delaying CAR-T cell exhaustion

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311294176.8A CN117363578A (en) 2023-10-08 2023-10-08 Cell production method for delaying CAR-T cell exhaustion

Publications (1)

Publication Number Publication Date
CN117363578A true CN117363578A (en) 2024-01-09

Family

ID=89399511

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311294176.8A Pending CN117363578A (en) 2023-10-08 2023-10-08 Cell production method for delaying CAR-T cell exhaustion

Country Status (1)

Country Link
CN (1) CN117363578A (en)

Similar Documents

Publication Publication Date Title
JP6678215B2 (en) Targeting CD138 in cancer
Lamb et al. Natural killer cell therapy for hematologic malignancies: successes, challenges, and the future
US11098284B2 (en) Enhanced generation of cytotoxic T-lymphocytes by IL-21 mediated FOXP3 suppression
JP6630074B2 (en) Manipulation and delivery of therapeutic compositions of newly isolated cells
Hongeng et al. Generation of CD3+ CD56+ cytokine-induced killer cells and their in vitro cytotoxicity against pediatric cancer cells
Miller et al. Expansion and homing of adoptively transferred human natural killer cells in immunodeficient mice varies with product preparation and in vivo cytokine administration: implications for clinical therapy
CN108699523B (en) NK cell culture medium addition kit and NK cell culture method using same
JP5906168B2 (en) Method for activating natural killer cells in vitro by tumor cell preparations
US20220000930A1 (en) Natural killer cell containing exogenous mitochondrium and pharmaceutical composition comprising same
KR20180086204A (en) Composition for use in immunotherapy
JP2022065022A (en) Methods for generating engineered human primary blood dendritic cell lines
EP3778649A1 (en) Method and composition for treating tumors
US11834677B2 (en) Expansion and use of expanded NK cell fractions
Cany et al. Umbilical cord blood–derived cellular products for cancer immunotherapy
Biondi et al. Redirecting T cells with Chimeric Antigen Receptor (CAR) for the treatment of childhood acute lymphoblastic leukemia
EP3834849A1 (en) Method for treating tumor using immune effector cell
WO2003038062A2 (en) Generation of use of tc1 and tc2 cells
Plantinga et al. Clinical grade production of wilms’ tumor-1 loaded cord blood-derived dendritic cells to prevent relapse in pediatric AML after cord blood transplantation
JP7225107B2 (en) natural killer cells
JP3541950B2 (en) Use of modified TALL-104 cells to treat cancer and viral diseases
JP6963560B2 (en) Methods of T cell expansion and activation
CN117363578A (en) Cell production method for delaying CAR-T cell exhaustion
Rabinowich et al. Clonal analysis of human tumor infiltrating lymphocytes reactive with autologous tumor cells: different target cell specificities of NK-like and cytotoxic T-cell clones
US20220378872A1 (en) Composition for treatment and/or prevention of tumor
US20230346936A1 (en) Ex vivo expansion of regulatory t cells for suppression of graft versus host disease

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination