CN117344059A - Dual-fluorescence quantitative PCR (polymerase chain reaction) detection kit for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus and application thereof - Google Patents
Dual-fluorescence quantitative PCR (polymerase chain reaction) detection kit for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus and application thereof Download PDFInfo
- Publication number
- CN117344059A CN117344059A CN202311460952.7A CN202311460952A CN117344059A CN 117344059 A CN117344059 A CN 117344059A CN 202311460952 A CN202311460952 A CN 202311460952A CN 117344059 A CN117344059 A CN 117344059A
- Authority
- CN
- China
- Prior art keywords
- porcine
- virus
- epidemic diarrhea
- respiratory syndrome
- diarrhea virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241001135549 Porcine epidemic diarrhea virus Species 0.000 title claims abstract description 83
- 241001135989 Porcine reproductive and respiratory syndrome virus Species 0.000 title claims abstract description 74
- 238000001514 detection method Methods 0.000 title claims abstract description 73
- 238000003753 real-time PCR Methods 0.000 title claims abstract description 23
- 238000003752 polymerase chain reaction Methods 0.000 title description 26
- 239000007850 fluorescent dye Substances 0.000 claims abstract description 24
- 230000009977 dual effect Effects 0.000 claims abstract description 22
- 239000000203 mixture Substances 0.000 claims abstract description 13
- 239000000523 sample Substances 0.000 claims description 57
- 230000003321 amplification Effects 0.000 claims description 43
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 43
- 238000006243 chemical reaction Methods 0.000 claims description 34
- 108020004707 nucleic acids Proteins 0.000 claims description 24
- 102000039446 nucleic acids Human genes 0.000 claims description 24
- 150000007523 nucleic acids Chemical class 0.000 claims description 24
- 102000004190 Enzymes Human genes 0.000 claims description 16
- 108090000790 Enzymes Proteins 0.000 claims description 16
- 239000013642 negative control Substances 0.000 claims description 16
- 238000002474 experimental method Methods 0.000 claims description 14
- 239000013641 positive control Substances 0.000 claims description 14
- 241000700605 Viruses Species 0.000 claims description 13
- 238000000034 method Methods 0.000 claims description 13
- 238000012360 testing method Methods 0.000 claims description 11
- 239000000243 solution Substances 0.000 claims description 8
- 125000006853 reporter group Chemical group 0.000 claims description 6
- 238000011144 upstream manufacturing Methods 0.000 claims description 6
- 239000012295 chemical reaction liquid Substances 0.000 claims description 4
- 238000004925 denaturation Methods 0.000 claims description 4
- 230000036425 denaturation Effects 0.000 claims description 4
- 238000002156 mixing Methods 0.000 claims description 4
- 238000012257 pre-denaturation Methods 0.000 claims description 4
- 238000010839 reverse transcription Methods 0.000 claims description 4
- 238000010802 RNA extraction kit Methods 0.000 claims description 3
- 208000032625 disorder of ear Diseases 0.000 claims description 3
- 238000000605 extraction Methods 0.000 claims description 3
- 238000002360 preparation method Methods 0.000 claims description 3
- 238000010791 quenching Methods 0.000 claims description 3
- 230000000171 quenching effect Effects 0.000 claims description 3
- 239000011535 reaction buffer Substances 0.000 claims description 3
- 238000005119 centrifugation Methods 0.000 claims description 2
- 238000002844 melting Methods 0.000 claims description 2
- 230000008018 melting Effects 0.000 claims description 2
- 239000002773 nucleotide Substances 0.000 claims description 2
- 125000003729 nucleotide group Chemical group 0.000 claims description 2
- 238000003149 assay kit Methods 0.000 claims 1
- 239000003153 chemical reaction reagent Substances 0.000 description 18
- 239000013612 plasmid Substances 0.000 description 15
- 208000005342 Porcine Reproductive and Respiratory Syndrome Diseases 0.000 description 6
- 238000011529 RT qPCR Methods 0.000 description 6
- 230000035945 sensitivity Effects 0.000 description 6
- 238000010257 thawing Methods 0.000 description 6
- 230000008014 freezing Effects 0.000 description 4
- 238000007710 freezing Methods 0.000 description 4
- 230000001133 acceleration Effects 0.000 description 3
- 201000010099 disease Diseases 0.000 description 3
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 3
- 108090000623 proteins and genes Proteins 0.000 description 3
- 238000012795 verification Methods 0.000 description 3
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 description 2
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 description 2
- 241000202347 Porcine circovirus Species 0.000 description 2
- 241000702665 Porcine rotavirus Species 0.000 description 2
- 241000701093 Suid alphaherpesvirus 1 Species 0.000 description 2
- 241000282887 Suidae Species 0.000 description 2
- 238000000137 annealing Methods 0.000 description 2
- 239000008280 blood Substances 0.000 description 2
- 210000004369 blood Anatomy 0.000 description 2
- 238000010276 construction Methods 0.000 description 2
- 238000007796 conventional method Methods 0.000 description 2
- 230000003247 decreasing effect Effects 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 238000010790 dilution Methods 0.000 description 2
- 239000012895 dilution Substances 0.000 description 2
- 238000001215 fluorescent labelling Methods 0.000 description 2
- 239000012634 fragment Substances 0.000 description 2
- 208000015181 infectious disease Diseases 0.000 description 2
- 230000002458 infectious effect Effects 0.000 description 2
- 244000052769 pathogen Species 0.000 description 2
- 230000001717 pathogenic effect Effects 0.000 description 2
- 229960005486 vaccine Drugs 0.000 description 2
- 108020004414 DNA Proteins 0.000 description 1
- 206010012735 Diarrhoea Diseases 0.000 description 1
- 238000002965 ELISA Methods 0.000 description 1
- 208000005577 Gastroenteritis Diseases 0.000 description 1
- 102100034343 Integrase Human genes 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 241001123971 Porcine reproductive and respiratory syndrome virus 1 Species 0.000 description 1
- 108010092799 RNA-directed DNA polymerase Proteins 0.000 description 1
- 102000004167 Ribonuclease P Human genes 0.000 description 1
- 108090000621 Ribonuclease P Proteins 0.000 description 1
- 241000711484 Transmissible gastroenteritis virus Species 0.000 description 1
- 101710160987 Uracil-DNA glycosylase Proteins 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 108010051210 beta-Fructofuranosidase Proteins 0.000 description 1
- 239000000872 buffer Substances 0.000 description 1
- 239000007853 buffer solution Substances 0.000 description 1
- 239000003086 colorant Substances 0.000 description 1
- 230000002498 deadly effect Effects 0.000 description 1
- 230000018044 dehydration Effects 0.000 description 1
- 238000006297 dehydration reaction Methods 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 230000004069 differentiation Effects 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000011049 filling Methods 0.000 description 1
- 235000011073 invertase Nutrition 0.000 description 1
- 239000001573 invertase Substances 0.000 description 1
- 238000002955 isolation Methods 0.000 description 1
- 230000031700 light absorption Effects 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 238000012544 monitoring process Methods 0.000 description 1
- 230000002265 prevention Effects 0.000 description 1
- 230000001850 reproductive effect Effects 0.000 description 1
- 208000023504 respiratory system disease Diseases 0.000 description 1
- 238000003757 reverse transcription PCR Methods 0.000 description 1
- 208000026775 severe diarrhea Diseases 0.000 description 1
- 238000013112 stability test Methods 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a dual fluorescent quantitative PCR detection kit for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus and application thereof, wherein the kit comprises a porcine epidemic diarrhea virus detection primer composition, a porcine reproductive and respiratory syndrome virus detection primer composition and a corresponding fluorescent probe.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a dual fluorescent quantitative PCR detection kit for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus and application thereof.
Background
Porcine Epidemic Diarrhea Virus (PEDV) is a highly infectious pathogen affecting pigs, causing Porcine Epidemic Diarrhea (PED). PED often causes severe diarrhea and dehydration in infants and pigs, especially the first few weeks after birth. This disease creates a significant economic loss to the pig industry, including decreased productivity and increased mortality in piglets. Early detection of PED is critical for taking control measures, quarantining infected animals and vaccine development.
Porcine Reproductive and Respiratory Syndrome (PRRSV) is a deadly pathogen causing Porcine Reproductive and Respiratory Syndrome (PRRS). This disease also causes significant economic losses to the pig industry, including reproductive problems, respiratory disease and decreased productivity. Early detection and monitoring of PRRS is critical for disease control and management, especially in the prevention of epidemic outbreaks and vaccine development.
Although there are a number of methods for detection of PEDV and PRRSV, including virus isolation, RT-PCR, ELISA, etc., there are some significant limitations to these methods. Conventional methods tend to be time consuming and complex, requiring highly skilled experimenters to perform. Furthermore, they also have problems in terms of specificity and sensitivity, possibly leading to false positives or false negatives. Particularly in the case of the simultaneous epidemic of PEDV and PRRSV, a rapid, accurate and specific dual detection method is needed to distinguish between the two viruses.
Disclosure of Invention
In order to solve the problems in the prior art, the invention provides a kit capable of rapidly and reliably detecting the presence of both PEDV and PRRSV simultaneously.
The technical scheme of the invention is as follows:
the invention provides a dual fluorescent quantitative PCR detection primer and a dual-color fluorescent probe for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus, wherein the nucleotide sequences of the primer composition and the fluorescent probe are as follows;
the upstream primer PEDV-F1: TGCTTGYTAGGCCGCAT, which is the sequence of SEQ ID NO. 1;
downstream primer PEDV-R1: GGACGACRAATGCGTGGT, which is the sequence of SEQ ID NO. 2;
fluorescent probe PEDV-P: FAM-TCTGGCCCCTGCCCACCACGT-BHQ1, which is the sequence of SEQ ID NO. 3.
The upstream primer PRRSV-F1: GCATCCTTATGGCTTGCATCAC, which is the sequence of SEQ ID NO. 4;
downstream primer PRRSV-R1: TCAGGATTGAAAGACCACC, which is the sequence of SEQ ID NO. 5;
fluorescent probe PRRSV-P: VIC-ACGGTTGTGGCGCAGGACACATTCT-BHQ1, which is SEQ ID NO.6 sequence, the fluorescent probe reporter group of porcine epidemic diarrhea virus is FAM, the fluorescent probe reporter group of porcine blue ear disease virus is VIC, and the quenching group is BHQ1.
The invention provides a dual fluorescent quantitative PCR detection kit for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus, which comprises a primer composition, a fluorescent probe, an enzyme system, an amplification reaction buffer solution, a PCR Mix, a negative control and a positive control.
Preferably, the enzyme system is a mixture of enzymes.
The kit is used for detecting porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus.
Preferably, the dual fluorescent quantitative PCR detection method for the porcine epidemic diarrhea virus and the porcine reproductive and respiratory syndrome virus comprises the following steps:
(1) Extracting RNA of a sample to be detected: extracting RNA from the collected sample by using a full-automatic nucleic acid extraction kit or an RNA extraction kit;
(2) Configuration of a reaction system: taking out the PCR Mix, enzyme system, positive control and negative control, placing the mixture at room temperature for complete melting, preparing PCR reaction liquid, split charging the PCR reaction liquid into different PCR reaction tubes, respectively adding RNA of a sample to be detected, the negative control and the positive control into the PCR reaction tubes, covering a tube cover, fully reversing and uniformly mixing, and then carrying out instantaneous centrifugation on the PCR reaction tubes;
(3) Fluorescent PCR operation: placing the instantaneously centrifuged PCR tube into a fluorescent PCR detector, marking, and setting a program to react, wherein two different fluorescent channels are respectively selected by porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus;
(4) And (3) result judgment: under two fluorescent channels, a typical amplification curve appears in the positive control, the CT value is less than 35, and no amplification curve or no CT value appears in the negative control, so that the experiment is established; otherwise, the experiment is invalid and the experiment needs to be carried out again;
the sample amplification result under the fluorescence channel selected by the porcine epidemic diarrhea virus detection has a typical amplification curve, and the porcine epidemic diarrhea virus can be judged positive when the CT value is less than 38; when the amplification result of the sample has no CT value, judging that the porcine epidemic diarrhea virus is negative; the amplification result of the sample has a typical amplification curve, and when the CT value is more than or equal to 38, the porcine epidemic diarrhea virus is judged to be suspicious, and if the porcine epidemic diarrhea virus is still suspicious, the porcine epidemic diarrhea virus is judged to be positive;
the sample amplification result under the fluorescence channel selected by the detection of the porcine reproductive and respiratory syndrome virus has a typical amplification curve, and the porcine reproductive and respiratory syndrome virus is positive when the CT value is less than 38; when the amplification result of the sample has no CT value, judging that the porcine reproductive and respiratory syndrome virus is negative; the amplification result of the sample has a typical amplification curve, and when the CT value is more than or equal to 38, the porcine reproductive and respiratory syndrome virus can be judged to be suspicious, and if the porcine reproductive and respiratory syndrome virus is still suspicious, the porcine reproductive and respiratory syndrome virus can be judged to be positive.
Preferably, in the step (2), the PCR Mix and the enzyme system are mixed thoroughly to prepare a PCR reaction solution by calculating the required number of preparation reactions in a ratio of (14×n) μl+ (1×n) μl= (15×n) μl, where n is the number of samples.
Preferably, in step (2), 15. Mu.L of LPCR reaction solution is added to each PCR reaction tube according to the number of the test samples, and 10. Mu.L of negative control, test sample RNA and positive control are added to each reaction tube containing 15. Mu.L of PCR reaction solution.
Preferably, the procedure in step (3) is set to the first stage, reverse transcription at 50℃for 10 minutes; a second stage, pre-denaturation at 95℃for 5min; in the third stage, denaturation at 95 ℃ for 10 seconds and extension at 60 ℃ for 30 seconds, 45 cycles in total; fluorescence collection was performed at 60℃extension per cycle in the third stage.
Compared with the prior art, the invention has the following beneficial effects:
1. the invention provides a kit for fluorescence quantitative detection of porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus and application thereof, wherein the kit comprises two pairs of primers and probes, and the Porcine Epidemic Diarrhea Virus (PEDV) and Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) can be detected simultaneously through the specific selection and dual fluorescence labeling of the primers and the probes, so that the highly specific dual detection is realized;
2. the invention provides a kit for fluorescence quantitative detection of porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus and application thereof, which introduces a double fluorescence labeling system, allows fluorescent signals with different colors to be captured in the same PCR reaction, ensures the differentiation of PEDV and PRRSV, and improves the detection reliability;
3. the invention provides a fluorescence quantitative detection kit for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus and application thereof, which adopts the design of specific primers and probes to respectively highly fit two virus genes so as to reduce cross reaction and false alarm, thereby improving the specificity of a detection method;
4. the invention provides a kit for fluorescence quantitative detection of porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus and application thereof, and the kit can detect two viruses simultaneously, so that the innovative technology also reduces detection cost and the requirements of laboratory equipment, reagents and human resources, thereby reducing detection cost.
Drawings
FIG. 1A shows the experimental results of the optimal primer set for porcine epidemic diarrhea virus according to the embodiment of the present invention;
FIG. 1B shows experimental results of the optimal primer set for porcine reproductive and respiratory syndrome virus in an embodiment of the present invention;
FIG. 2A is a graph showing the results of construction of a standard plasmid for porcine epidemic diarrhea virus according to the present invention;
FIG. 2B is a graph showing the construction results of a porcine reproductive and respiratory syndrome virus standard plasmid;
FIG. 3A is a graph showing a sensitivity test of a method for detecting porcine epidemic diarrhea virus according to an embodiment of the present invention;
FIG. 3B is a plot of sensitivity test of a porcine reproductive and respiratory syndrome virus detection method according to an embodiment of the present invention;
FIG. 4 is a graph showing the specificity of the detection method according to the embodiment of the present invention;
FIG. 5A is a graph showing the experimental verification of the thermal acceleration stability of the detection method for detecting porcine epidemic diarrhea virus according to the embodiment of the present invention;
FIG. 5B is a graph showing the experimental verification of the thermal acceleration stability of porcine reproductive and respiratory syndrome virus by using the detection method according to the embodiment of the present invention;
FIG. 6A is a graph of repeated freeze-thaw experiments for detecting porcine epidemic diarrhea virus according to the detection method of the present invention;
FIG. 6B is a graph showing the experimental verification of repeated freeze thawing of porcine reproductive and respiratory syndrome virus by using the detection method according to the embodiment of the present invention.
Detailed Description
The invention is further described below in connection with the preferred embodiments, and neither the endpoints of the ranges disclosed in the invention nor any of the values are limited to the precise range or value, and such range or value should be understood to include values near the range or value; for numerical ranges, one or more new numerical ranges may be found between the endpoints of each range, between the endpoint of each range and the individual point value, and between the individual point value, in combination with each other, and are to be considered as specifically disclosed herein.
Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.
The experimental methods in the following examples are conventional methods unless otherwise specified.
Example 1
The embodiment provides a dual fluorescent quantitative PCR detection primer and a double-color fluorescent probe for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus, wherein the primer composition and the nucleotide sequence of the fluorescent probe are as follows;
the upstream primer PEDV-F1: TGCTTGYTAGGCCGCAT, which is the sequence of SEQ ID NO. 1;
downstream primer PEDV-R1: GGACGACRAATGCGTGGT, which is the sequence of SEQ ID NO. 2;
fluorescent probe PEDV-P: FAM-TCTGGCCCCTGCCCACCACGT-BHQ1, which is the sequence of SEQ ID NO. 3.
The upstream primer PRRSV-F1: GCATCCTTATGGCTTGCATCAC, which is the sequence of SEQ ID NO. 4;
downstream primer PRRSV-R1: TCAGGATTGAAAGACCACC, which is the sequence of SEQ ID NO. 5;
fluorescent probe PRRSV-P: VIC-ACGGTTGTGGCGCAGGACACATTCT-BHQ1, which is SEQ ID NO.6 sequence, the fluorescent probe reporter group of porcine epidemic diarrhea virus is FAM, the fluorescent probe reporter group of porcine blue ear disease virus is VIC, and the quenching group is BHQ1..
Example 2
A dual fluorescent quantitative PCR detection kit for porcine epidemic diarrhea virus and porcine blue-ear virus comprises a primer composition, a fluorescent probe, an enzyme system, an amplification reaction buffer solution, a PCR Mix, a negative control and a positive control in the embodiment 1 and the embodiment 2, wherein the enzyme system is a mixture of various enzymes, such as taq enzyme, invertase, UDG enzyme and the like.
Example 3
The porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus were simultaneously detected using the detection kit provided in example 2.
Example 4
A dual fluorescent quantitative PCR detection method for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus comprises the following steps:
(1) Extracting RNA of a sample to be detected: extracting RNA from the collected sample by using a full-automatic nucleic acid extraction kit or an RNA extraction kit;
(2) Configuration of a reaction system: taking out PCR Mix, enzyme system, positive control and negative control, placing them into room temperature to make them be completely dissolved, calculating the required preparation reaction number according to the ratio of (14 Xn) mu L+ (1 Xn) mu L= (15 Xn) mu L, fully uniformly mixing them to obtain PCR reaction liquor, in which n is sample quantity, filling 15 mu LPCR reaction liquor into different PCR reaction tubes, respectively adding 10 mu L of negative control, sample RNA to be detected and positive control into the reaction tube filled with 15 mu L of PCR reaction liquor, covering tube cover, fully reversing and uniformly mixing them, and making the PCR reaction tube be instantaneously centrifuged;
(3) Fluorescent PCR operation: placing the instantaneously centrifuged PCR tube into a fluorescent PCR detector, marking, setting the program as a first stage, and carrying out reverse transcription for 10 minutes at 50 ℃; a second stage, pre-denaturation at 95℃for 5min; in the third stage, denaturation at 95 ℃ for 10 seconds and extension at 60 ℃ for 30 seconds, 45 cycles in total; fluorescence collection is performed during the third stage at 60 ℃ extension of each cycle, wherein porcine epidemic diarrhea virus selects FAM fluorescence channel and porcine blue ear virus selects VIC channel;
(4) And (3) result judgment: under two fluorescent channels, a typical amplification curve appears in the positive control, the CT value is less than 35, and no amplification curve or no CT value appears in the negative control, so that the experiment is established; otherwise, the experiment is invalid and the experiment needs to be carried out again;
the sample amplification result under the FAM fluorescent channel has a typical amplification curve, and the porcine epidemic diarrhea virus is positive when the CT value is less than 38; when the amplification result of the sample has no CT value, judging that the porcine epidemic diarrhea virus is negative; the amplification result of the sample has a typical amplification curve, and when the CT value is more than or equal to 38, the porcine epidemic diarrhea virus is judged to be suspicious, and if the porcine epidemic diarrhea virus is still suspicious, the porcine epidemic diarrhea virus is judged to be positive;
the sample amplification result under the VIC fluorescent channel has a typical amplification curve, and the porcine reproductive and respiratory syndrome virus is positive when the CT value is less than 38; when the amplification result of the sample has no CT value, judging that the porcine reproductive and respiratory syndrome virus is negative; the amplification result of the sample has a typical amplification curve, and when the CT value is more than or equal to 38, the porcine reproductive and respiratory syndrome virus can be judged to be suspicious, and if the porcine reproductive and respiratory syndrome virus is still suspicious, the porcine reproductive and respiratory syndrome virus can be judged to be positive.
Example 5
1. Optimal primer group experiment of double TaqMan qPCR detection method
Six samples are used for experiments, the same sample is respectively amplified by two pairs of F1R1 and F2R2 primers, fluorescent signals are collected, and the result shows that the optimal primer combination for detecting the porcine epidemic diarrhea virus is F1R1-P as shown in FIG. 1A, the combined fluorescent intensity is higher, and the ct value is also higher; FIG. 1B shows that the optimal primer combination for porcine reproductive and respiratory syndrome virus detection is F1R1-P, and the combined fluorescence intensity is higher, and the ct value is also higher. The experiment shows that one primer F1R1 of PEDV and one primer F1R1 of PRRSV in the kit are optimal primers for detection.
2. Establishment of standard curve of double TaqMan qPCR detection method
(1) Plasmid standards containing known PEDV and PRRSV gene fragments were prepared. These plasmids contain sequences that match the target gene fragment for use as standard samples.
(2) The light absorption ratio of the plasmid is determined by a spectrophotometer or other nucleic acid concentration determination method,
to estimate the concentration of plasmid (ng/. Mu.L).
(3) The initial copy number of each standard sample was determined based on plasmid concentration, plasmid length and Avogadro constant (6.022×10 23 ) And (5) calculating the same parameters. Calculated using the following formula: initial copy number
= (concentration (ng/. Mu.L). Times.10) (-9)) (plasmid Length (bp). Times.660 g/mol/bp)
6.022×10 23 。
(4) To establish a standard curve, a series of standard samples were prepared, including from 10 1 To 10 5 Copy number range of copies/. Mu.L.
(5) Preparing specific primers and probes of PEDV and PRRSV, buffer solution of PCR reaction and dNTPs,
DNA polymerase, reverse transcriptase, etc.
(6) A PCR reaction system was disposed in the reaction tube. Each PCR reaction includes specific primers and probes for PEDV and PRRSV, PCR buffer, dNTPs, DNA polymerase, RNase P reference, sample DNA, and an appropriate amount of water.
(7) According to reverse transcription at 50 ℃ for 10min; pre-denaturation at 95℃for 5min; denaturation at 95℃for 10s, annealing and extension
Performing amplification reaction at 60 ℃ for 30s for 45 cycles; fluorescence collection is carried out in the third stage at 60 ℃ annealing delay of each cycle; the porcine epidemic diarrhea virus selects FAM fluorescence channel, and the porcine blue ear virus selects VIC fluorescence channel.
(8) As shown in FIG. 2, FIG. 2A shows that the plasmid standard of porcine epidemic diarrhea virus consists of 1×10 5 copies/μL 1×10 1 Fluorescence amplification curves for five concentrations of copies/. Mu.L, FIG. 2B shows plasmid standard of porcine reproductive and respiratory syndrome virus consisting of 1X 10 5 copies/μL 1×10 1 Fluorescence amplification curves for five concentrations of copies/. Mu.L. As can be seen from FIG. 2, plasmid standards for testing the detection methods of the present invention have been successfully established, thereby demonstrating the reliability of the data of the detection methods of the present invention.
3. Sensitivity test of double TaqMan qPCR detection method
(1) Porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus plasmid standard was prepared according to 1×10 5 copies/μL 1×10 0 Six concentrations of copies/. Mu.L10-fold gradient dilutions were performed.
(2) Preparing fluorescent PCR detection reagents for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus, and adding diluted standard substance, wherein as shown in figure 3, figure 3A shows that the fluorescent quantitative PCR detection reagents for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus can detect porcine epidemic diarrhea virus 1×10 0 The copies/. Mu.L plasmid standard, ct value 37.51, FIG. 3B shows that porcine reproductive and respiratory syndrome virus and porcine reproductive and respiratory syndrome virus fluorescent quantitative PCR detection reagent can detect porcine reproductive and respiratory syndrome virus 1×10 0 The copies/mu L plasmid standard has a ct value of 37.67, and the results show that the dual detection reagent has good sensitivity to porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus.
4. Double TaqMan qPCR detection method specificity test
(1) Seven nucleic acid samples of porcine epidemic diarrhea virus nucleic acid, porcine reproductive and respiratory syndrome virus nucleic acid, porcine blood extracted nucleic acid, porcine rotavirus nucleic acid, porcine transmissible gastroenteritis virus nucleic acid, porcine circovirus nucleic acid, porcine pseudorabies virus nucleic acid were prepared respectively.
(2) The prepared fluorescent quantitative PCR detection reagent for the porcine epidemic diarrhea virus and the porcine reproductive and respiratory syndrome virus is prepared, and then the prepared nucleic acid sample is added, as shown in figure 4, only the amplification curves of the porcine epidemic virus nucleic acid and the porcine reproductive and respiratory syndrome virus nucleic acid appear, but the nucleic acid extracted from the porcine blood, the porcine rotavirus nucleic acid, the porcine infectious gastroenteritis virus nucleic acid, the porcine circovirus nucleic acid and the porcine pseudorabies virus nucleic acid are not amplified, so that the dual detection reagent has good specificity.
5. Thermal acceleration stability test of double TaqMan qPCR detection method
(1) The prepared fluorescent quantitative PCR detection reagent for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus is equally divided into two parts, wherein one part is placed at-20 ℃ to be a control group, and the other part is placed at 37 ℃ to be an experimental group for 5 days.
(2) After the two prepared reagents are placed for five days, the nucleic acid of the porcine epidemic diarrhea virus and the nucleic acid of the porcine reproductive and respiratory syndrome are tested by using gradient dilution, as shown in fig. 5, the results of fig. 5A and table 1 show that the detection performance of the porcine epidemic diarrhea virus is not remarkably reduced after the double detection reagent is placed for five days at 37 degrees, and the results of fig. 5B and table 2 show that the detection performance of the porcine reproductive and respiratory syndrome virus is not remarkably reduced after the double detection reagent is placed for five days at 37 degrees, and the results show that the reagent has good stability.
TABLE 1
| Sample type | Experimental group | Control group |
| Sample 1 | 26.59 | 26.52 |
| Sample 2 | 31.23 | 31.41 |
| Sample 3 | 34.89 | 35.16 |
| Sample 4 | 36.61 | 36.27 |
| Sample 5 | 35.97 | 35.81 |
| Sample 6 | 36.45 | 37.69 |
| Sample 7 | 38.44 | 37.71 |
| Negative control | Without any means for | Without any means for |
TABLE 2
6. Repeated freeze thawing test of double TaqMan qPCR detection method
(1) Preparing a fluorescence quantitative PCR detection reagent for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus, and then equally dividing the reagent into two parts, wherein one part is placed at-20 ℃ without repeated freezing and thawing to be used as a control group, and the other part is placed at-20 ℃ to be used as an experimental group after repeated freezing and thawing for 10 times.
(3) The test is carried out by using the gradient diluted porcine epidemic diarrhea virus nucleic acid and porcine reproductive and respiratory syndrome nucleic acid, as shown in fig. 6, the results of fig. 6A and table 3 show that the dual detection reagent has no significant drop in detection performance of porcine epidemic diarrhea virus after repeated freezing and thawing for 10 times, and the results of fig. 6B and table 4 show that the dual detection reagent has no significant drop in detection performance of porcine reproductive and respiratory syndrome virus after repeated freezing and thawing for 10 times, and the results show that the reagent can be repeatedly frozen and thawed for a plurality of times.
TABLE 3 Table 3
TABLE 4 Table 4
| Sample type | Experimental group | Control group |
| Sample 1 | 25.26 | 25.27 |
| Sample 2 | 28.99 | 28.77 |
| Sample 3 | 31.84 | 31.61 |
| Sample 4 | 34.66 | 34.83 |
| Sample 5 | 36.32 | 36.96 |
| Sample 6 | 36.77 | 37.22 |
| Sample 7 | Without any means for | Without any means for |
| Sample 8 | 39.23 | 39.71 |
| Negative control | Without any means for | Without any means for |
In conclusion, the detection kit, the detection primer combination and the application provided by the invention can accurately realize the detection and analysis of porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus in a sample; the method has the characteristics of simplicity, convenience, high speed, good stability, high detection sensitivity and strong specificity, and has wide application prospect.
The foregoing description is only illustrative of the present invention and is not intended to limit the scope of the invention, and all equivalent structures or equivalent processes or direct or indirect application in other related arts are included in the scope of the present invention.
Claims (8)
1. A dual fluorescent quantitative PCR detection primer and a dual-color fluorescent probe for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus are characterized in that: the primer composition and the fluorescent probe nucleotide sequence are as follows;
the upstream primer PEDV-F1: TGCTTGYTAGGCCGCAT, which is the sequence of SEQ ID NO. 1;
downstream primer PEDV-R1: GGACGACRAATGCGTGGT, which is the sequence of SEQ ID NO. 2;
fluorescent probe PEDV-P: FAM-TCTGGCCCCTGCCCACCACGT-BHQ1, which is the sequence of SEQ ID NO. 3.
The upstream primer PRRSV-F1: GCATCCTTATGGCTTGCATCAC, which is the sequence of SEQ ID NO. 4;
downstream primer PRRSV-R1: TCAGGATTGAAAGACCACC, which is the sequence of SEQ ID NO. 5;
fluorescent probe PRRSV-P: VIC-ACGGTTGTGGCGCAGGACACATTCT-BHQ1, which is SEQ ID NO.6 sequence, the fluorescent probe reporter group of porcine epidemic diarrhea virus is FAM, the fluorescent probe reporter group of porcine blue ear disease virus is VIC, and the quenching group is BHQ1.
2. A dual fluorescent quantitative PCR detection kit for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus is characterized in that: comprising the primer composition of claim 1, a fluorescent probe, an enzyme system, an amplification reaction buffer, a PCR Mix, a negative control, and a positive control.
3. The dual fluorescent quantitative PCR assay kit for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus of claim 2, wherein: the enzyme system is a mixture of various enzymes.
4. A dual fluorescent quantitative PCR detection method for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus is characterized in that: porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus detection using the kit of claim 2.
5. The dual fluorescent quantitative PCR detection method for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus according to claim 4, wherein: the method comprises the following steps:
(1) Extracting RNA of a sample to be detected: extracting RNA from the collected sample by using a full-automatic nucleic acid extraction kit or an RNA extraction kit;
(2) Configuration of a reaction system: taking out the PCR Mix, enzyme system, positive control and negative control, placing the mixture at room temperature for complete melting, preparing PCR reaction liquid, split charging the PCR reaction liquid into different PCR reaction tubes, respectively adding RNA of a sample to be detected, the negative control and the positive control into the PCR reaction tubes, covering a tube cover, fully reversing and uniformly mixing, and then carrying out instantaneous centrifugation on the PCR reaction tubes;
(3) Fluorescent PCR operation: placing the instantaneously centrifuged PCR tube into a fluorescent PCR detector, marking, and setting a program to react, wherein the porcine epidemic diarrhea virus selects a FAM fluorescent channel, and the porcine blue ear virus selects a VIC fluorescent channel;
(4) And (3) result judgment: under two fluorescent channels, a typical amplification curve appears in the positive control, the CT value is less than 35, and no amplification curve or no CT value appears in the negative control, so that the experiment is established; otherwise, the experiment is invalid and the experiment needs to be carried out again;
the sample amplification result under the fluorescence channel selected by the porcine epidemic diarrhea virus detection has a typical amplification curve, and the porcine epidemic diarrhea virus can be judged positive when the CT value is less than 38; when the amplification result of the sample has no CT value, judging that the porcine epidemic diarrhea virus is negative; the amplification result of the sample has a typical amplification curve, and when the CT value is more than or equal to 38, the porcine epidemic diarrhea virus is judged to be suspicious, and if the porcine epidemic diarrhea virus is still suspicious, the porcine epidemic diarrhea virus is judged to be positive;
the sample amplification result under the fluorescence channel selected by the detection of the porcine reproductive and respiratory syndrome virus has a typical amplification curve, and the porcine reproductive and respiratory syndrome virus is positive when the CT value is less than 38; when the amplification result of the sample has no CT value, judging that the porcine reproductive and respiratory syndrome virus is negative; the amplification result of the sample has a typical amplification curve, and when the CT value is more than or equal to 38, the porcine reproductive and respiratory syndrome virus can be judged to be suspicious, and if the porcine reproductive and respiratory syndrome virus is still suspicious, the porcine reproductive and respiratory syndrome virus can be judged to be positive.
6. The dual fluorescent quantitative PCR detection method for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus according to claim 5, wherein the method comprises the following steps: in the step (2), the PCR Mix and enzyme system were mixed thoroughly to prepare a PCR reaction solution by calculating the number of necessary preparation reactions in a ratio of (14×n) μl+ (1×n) μl= (15×n) μl, where n is the number of samples.
7. The dual fluorescent quantitative PCR detection method for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus according to claim 5, wherein the method comprises the following steps: in the step (2), 15. Mu.L of the PCR reaction solution was added to each of the PCR reaction tubes according to the number of the test samples, and 10. Mu.L of the negative control, the RNA of the test sample, and the positive control were added to the reaction tube containing 15. Mu.L of the PCR reaction solution, respectively.
8. The method for detecting porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus by double fluorescence quantitative PCR according to claim 5, wherein the method comprises the following steps: the procedure in step (3) is set as the first stage, reverse transcription is carried out for 10 minutes at 50 ℃; a second stage, pre-denaturation at 95℃for 5min; in the third stage, denaturation at 95 ℃ for 10 seconds and extension at 60 ℃ for 30 seconds, 45 cycles in total; fluorescence collection was performed at 60℃extension per cycle in the third stage.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311460952.7A CN117344059A (en) | 2023-11-03 | 2023-11-03 | Dual-fluorescence quantitative PCR (polymerase chain reaction) detection kit for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311460952.7A CN117344059A (en) | 2023-11-03 | 2023-11-03 | Dual-fluorescence quantitative PCR (polymerase chain reaction) detection kit for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117344059A true CN117344059A (en) | 2024-01-05 |
Family
ID=89361360
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202311460952.7A Pending CN117344059A (en) | 2023-11-03 | 2023-11-03 | Dual-fluorescence quantitative PCR (polymerase chain reaction) detection kit for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117344059A (en) |
-
2023
- 2023-11-03 CN CN202311460952.7A patent/CN117344059A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111020064B (en) | Novel coronavirus ORF1ab gene nucleic acid detection kit | |
| CN112725537A (en) | Multiplex real-time fluorescent quantitative PCR (polymerase chain reaction) kit and method for detecting 2019 novel coronavirus and primer probe composition | |
| EP4159875A1 (en) | Novel coronavirus rapid detection kit based on thermal convection pcr | |
| CN111500791B (en) | Triple FQ-PCR detection method for porcine epidemic diarrhea virus, porcine delta coronavirus and porcine acute diarrhea syndrome coronavirus | |
| CN112063756A (en) | Method and kit for multiplex detection of respiratory virus nucleic acid | |
| CN113584232B (en) | Novel coronavirus and delta mutant strain detection kit and detection method thereof | |
| CN110592286B (en) | RAA primer probe for detecting nodular skin disease virus and detection method | |
| CN112176103A (en) | African swine fever virus fluorescence ERA constant temperature rapid detection kit | |
| CN112094953A (en) | Kit, primer and probe for simultaneously detecting bovine viral diarrhea virus, bovine rotavirus and bovine coronavirus | |
| CN113462820A (en) | Multiplex RT-PCR primer probe set for real-time fluorescent quantitative detection of four porcine diarrhea viruses, kit and detection method thereof | |
| CN111621602B (en) | Porcine circovirus type 3 rapid detection fluorescent quantitative PCR kit and application thereof | |
| CN111518959A (en) | Digital PCR detection method and kit for novel coronavirus | |
| CN112430686A (en) | Kit, primer and probe for simultaneously detecting BVDV-1, BVDV-2 and BVDV-3 | |
| CN110885900B (en) | Freeze-dried microchip, kit and method for identifying classical strain of porcine reproductive and respiratory syndrome virus and NADC30-Like strain | |
| CN112522445A (en) | Primer-probe combination, kit and method for detecting novel coronavirus | |
| CN116814859A (en) | Primer probe composition, kit and method for identifying African swine fever virus genes I and II | |
| CN109536625B (en) | iiPCR detection method and detection kit for mycoplasma bovis | |
| CN110885902B (en) | Freeze-drying microchip, kit and method for detecting porcine reproductive and respiratory syndrome virus and identifying highly pathogenic classical variant strain of porcine reproductive and respiratory syndrome virus | |
| CN116162734B (en) | Specific primer, probe and kit for rapidly detecting African swine fever wild strain and gene deletion strain | |
| CN112779352A (en) | Double digital PCR detection technology for swine fever and African swine fever and special kit thereof | |
| CN117344059A (en) | Dual-fluorescence quantitative PCR (polymerase chain reaction) detection kit for porcine epidemic diarrhea virus and porcine reproductive and respiratory syndrome virus and application thereof | |
| CN115261519A (en) | RT-RAA amplification primer probe, kit and method for horse viral arterivirus nucleic acid detection | |
| CN111719020B (en) | Kit, primer and probe for detecting bovine rotavirus | |
| CN114438265A (en) | Nucleic acid composition, kit and detection method for simultaneously detecting porcine delta coronavirus, reovirus and porcine kobuvirus | |
| CN114317835B (en) | Multiplex PCR detection primer set, kit and detection method for waterfowl parvovirus, duck enteritis virus and goose astrovirus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |