CN117338917A

CN117338917A - Influenza vaccine

Info

Publication number: CN117338917A
Application number: CN202210748987.XA
Authority: CN
Inventors: 易应磊; 方熠; 尹曼曼; 蔡毅骅; 沈海法; 李航文
Original assignee: Siwei Shanghai Biotechnology Co ltd
Current assignee: Siwei Shanghai Biotechnology Co ltd
Priority date: 2022-06-28
Filing date: 2022-06-28
Publication date: 2024-01-05

Abstract

The present invention provides polynucleotides, particularly RNAs, such as mrnas, encoding influenza hemagglutinin. The invention also provides a composition, vaccine or pharmaceutical composition comprising the polynucleotide, and in particular relates to a tetravalent mRNA influenza vaccine. The composition, vaccine or pharmaceutical composition of the invention, in particular a tetravalent mRNA influenza vaccine, can be used for the prevention and/or treatment of influenza virus infection.

Description

Influenza vaccine

Technical Field

The invention relates to the technical field of vaccines, in particular to an mRNA vaccine, and particularly relates to a tetravalent mRNA influenza vaccine. The invention also provides uses and methods of use of the vaccine.

Background

Seasonal influenza is an infectious respiratory disease caused by influenza virus. Influenza virus is a member of the orthomyxoviridae family, being an enveloped negative-strand RNA virus. Influenza a and b viruses are the main types that spread and cause seasonal epidemics. Among them, the mountain lineages (B/Yamagata) and Victoria lineages (B/Victoria) of influenza a viruses H1N1 and H3N2 and influenza B viruses are four major subtypes prevalent in humans.

Influenza virus is an enveloped virus containing Hemagglutinin (HA), neuraminidase (NA) and matrix protein 2 (M2) surface proteins. Among them, HA protein is the most predominant surface protein of influenza virus, and mediates the entry of virus into cells by binding to sialic acid receptor on the surface of host cell membrane. It is generally believed that mutation in the HA and NA proteins causes antigen drift (antigenic drift) associated with seasonal influenza, and is also an important challenge in influenza vaccine development.

Traditional influenza vaccines include inactivated influenza vaccines, attenuated influenza vaccines and recombinant influenza vaccines. Traditionally, chick embryo based influenza vaccines have long production cycles, requiring at least 6 months from viral strain prediction to final production. In addition, influenza viruses are highly variable, and the continual occurrence of antigen drift often causes the mismatch between the vaccine production strains and the current epidemic strains, resulting in a significant reduction in the effectiveness of influenza vaccines. The effectiveness of influenza vaccines currently on the market is only 10% -60% as counted. Thus, there remains a need in the art for effective influenza vaccines.

mRNA vaccines induce specific immune responses against antigen polypeptides by expressing the antigen polypeptides they encode in vivo. mRNA epidemic vaccine has the characteristics of high effectiveness and good safety. In addition, the mRNA vaccine has short production period and can rapidly cope with the mutation of influenza virus.

CN110352071a (see also WO 2018078053) discloses lipid nanoparticles containing mRNA, and in particular mRNA vaccines encoding Hemagglutinin (HA) of four different influenza strains, wherein the combination of the four influenza strains comprises: (1) Influenza a/california/7/2009 (H1N 1), influenza a/chinese hong kong/4801/2014 (H3N 2), influenza B/brisban/60/2008 (B), and influenza a/vietnam/1203/2004 (H5N 1); (2) H1N1 influenza a/netherlands/602/2009, H3N2 influenza a/chinese hong kong/4801/2014, influenza b/brisban/60/2008 and influenza b/pragin island/3073/2013; (3) Influenza a/california/7/2009 (H1N 1), influenza a/chinese hong kong/4801/2014 (H3N 2), influenza b/brisban/60/2008 and influenza b/plagion/3073/2013; (4) H1N1 influenza a/netherlands/602/2009, H3N2 influenza a/chinese hong kong/4801/2014, influenza b/brisban/60/2008 and influenza a/vietnam/1203/2004 (H5N 1).

Disclosure of Invention

The present invention provides an influenza vaccine comprising at least one RNA, wherein the at least one RNA comprises at least one coding region encoding influenza hemagglutinin selected from the group consisting of:

(1) A first coding region that (a) encodes the amino acid sequence of SEQ ID NO. 1 or an amino acid sequence that is at least 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO. 1; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOs 5 to 9;

(2) A second coding region that (a) encodes the amino acid sequence of SEQ ID NO. 2 or an amino acid sequence that is at least 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO. 2; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOs 11-15;

(3) A third coding region that (a) encodes the amino acid sequence of SEQ ID NO. 3 or an amino acid sequence that is at least 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO. 3; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOs 17 to 20; and

(4) A fourth coding region that (a) encodes the amino acid sequence of SEQ ID NO. 4 or an amino acid sequence that is at least 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO. 4; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOS.22-28.

In one embodiment, the at least one coding region is selected from the group consisting of:

(1) A first coding region comprising the nucleotide sequence of any one of SEQ ID NOs 5 to 9;

(2) A second coding region comprising the nucleotide sequence of any one of SEQ ID NOs 11 to 15;

(3) A third coding region comprising the nucleotide sequence of any one of SEQ ID NOS.17-20; and

(4) A fourth coding region comprising the nucleotide sequence of any one of SEQ ID NOS.22-28.

(1) A first coding region comprising the nucleotide sequence of SEQ ID NO. 5;

(2) A second coding region comprising the nucleotide sequence of SEQ ID NO. 12;

(3) A third coding region comprising the nucleotide sequence of SEQ ID NO. 17; and

(4) A fourth coding region comprising the nucleotide sequence of SEQ ID NO. 26.

In a specific embodiment, the at least one RNA is selected from the group consisting of:

(1) A first RNA comprising a first coding region, wherein the first coding region comprises the nucleotide sequence of SEQ ID No. 5;

(2) A second RNA comprising a second coding region, wherein the second coding region comprises the nucleotide sequence of SEQ ID NO. 12;

(3) A third RNA comprising a third coding region, wherein the third coding region comprises the nucleotide sequence of SEQ ID No. 17; and

(4) A fourth RNA comprising a fourth coding region, wherein said fourth coding region comprises the nucleotide sequence of SEQ ID NO. 26.

In one embodiment, the at least one RNA further comprises a 5' utr, a 3' utr, a 5' cap, a poly (a) sequence, or a combination thereof.

(1) A first RNA comprising the nucleotide sequence of SEQ ID NO. 34;

(2) A second RNA comprising the nucleotide sequence of SEQ ID NO. 40;

(3) A third RNA comprising the nucleotide sequence of SEQ ID NO. 44; and

(4) And a fourth RNA comprising the nucleotide sequence of SEQ ID NO. 52.

In one embodiment, the vaccine of the invention comprises a first RNA, a second RNA, a third RNA and a fourth RNA as described above.

In one embodiment, the RNA comprises a modified nucleoside. In a preferred embodiment, the RNA is modified by replacing all uridine with 1-methyl-pseudouridine.

In one embodiment, the RNA is encapsulated in a lipid particle.

In a specific embodiment, the vaccine of the invention comprises a first RNA, a second RNA, a third RNA and a fourth RNA as described above, and wherein the first RNA, the second RNA, the third RNA and the fourth RNA are co-encapsulated in the same lipid particle.

In one embodiment, the RNA associates with at least one cationic polymer into at least one complex, and the at least one complex is encapsulated in the lipid particle to form a lipid-multimeric complex.

In one embodiment, the lipid particle comprises a cationic lipid, a non-cationic lipid, and a PEG-modified lipid.

In one embodiment, the cationic lipid comprises M5, which has the following structure:

in one embodiment, the lipid particle comprises 10-70 mole% M5, 10-70 mole% 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 10-70 mole% cholesterol, and 0.05-20 mole% 1, 2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG) 2000.

In one embodiment, the vaccine of the invention is a pharmaceutical composition, and optionally further comprises a pharmaceutically acceptable carrier.

The invention also provides a polynucleotide comprising or encoding any of the RNAs of the invention.

The invention also provides a composition comprising at least one polynucleotide of the invention.

In one embodiment, the composition comprises:

(1) A first RNA comprising the nucleotide sequence of SEQ ID NO. 34;

(2) A second RNA comprising the nucleotide sequence of SEQ ID NO. 40;

(3) A third RNA comprising the nucleotide sequence of SEQ ID NO. 44; and

(4) And a fourth RNA comprising the nucleotide sequence of SEQ ID NO. 52.

In one embodiment, the mass ratio of the first RNA, the second RNA, the third RNA, and the fourth RNA in the vaccine or composition of the present invention is 1:0.5-2:0.5-4:0.5-4. In a preferred embodiment, the mass ratio of the first RNA, the second RNA, the third RNA, and the fourth RNA is 1:1:1:1, 1:1:2:2, or 1:1:4:4. In a more preferred embodiment, the mass ratio of the first RNA, the second RNA, the third RNA, and the fourth RNA is 1:1:2:2.

The invention also provides the use of the vaccine, polynucleotide or composition of the invention in the manufacture of a medicament for the prophylaxis and/or treatment of influenza virus infection.

Drawings

FIG. 1A shows a schematic structural diagram of mRNA encoding influenza HA.

FIG. 1B shows HA protein expression of different mRNA-LPP vaccines by Western immunoblotting analysis after transfection of HEK-293 cells with different mRNA-LPP.

FIGS. 2A-2B show in vivo screening of candidate mRNA-LPP vaccines. Figure 2A shows the design of a pestilence inoculation and sample collection protocol. FIG. 2B shows the titers of HA-specific IgG in mouse immune sera analyzed by ELISA assay on day 14 (D14) and day 28 (D28); data are expressed as geometric mean ± geometric SD.

FIGS. 3A-3D show immunogenicity assessment of candidate mRNA-LPP vaccines. Figure 3A shows the design of a pestilence inoculation and sample collection protocol. Figure 3B shows the bound antibody titer (bound IgG titer) in mouse immune serum analyzed by ELISA assay on day 28; data are expressed as geometric mean ± geometric SD. FIG. 3C shows the neutralizing antibody titer (HAI titer) analyzed by HAI assay on day 28; data are expressed as mean ± SEM. FIG. 3D shows the T cell frequency of IFN-gamma secretion in spleen cells of immunized mice analyzed by ELISPot assay on day 35; data are expressed as Spot Forming Cells (SFC)/10 ⁶ Spleen cells, mean ± SEM.

FIGS. 4A-4B show the antibody persistence characterization represented by the Opti 1-LPP (H1N 1) vaccine. Figure 4A shows the design of a pestilence inoculation and sample collection protocol. Fig. 4B shows HA-specific IgG titers in mouse immune sera analyzed by ELISA assay on days 14, 28, 49, 90 and 120. Data are expressed as geometric mean ± geometric SD.

FIGS. 5A-5C show immunogenicity assessment of tetravalent influenza mRNA-LPP vaccine. Figure 5A shows the design of a pestilence inoculation and sample collection protocol. FIG. 5B shows mouse immunity analyzed by ELISA assay on day 28HA-specific binding antibody (IgG) titers in epidemic serum; data are expressed as geometric mean ± geometric SD. FIG. 5C shows the T cell frequency of IFN-gamma secretion in spleen cells of an immunized mouse analyzed by ELISPot assay on day 35; data are expressed as Spot Forming Cells (SFC)/10 ⁶ Spleen cells, mean ± SEM.

Detailed Description

General terms and definitions

All patents, patent applications, scientific publications, manufacturer's instructions and guidelines, and the like, cited herein, whether supra or infra, are hereby incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the disclosure is not entitled to antedate such disclosure.

Unless otherwise defined, scientific and technical terms used herein have the meanings commonly understood by one of ordinary skill in the art. Also, the terms related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, as used herein, are terms that are widely used in the corresponding arts (see, e.g., molecular Cloning: A Laboratory Manual,2 ^nd Edition, j. Sambrook et al eds., cold Spring Harbor Laboratory Press, cold Spring Harbor 1989). Meanwhile, in order to better understand the present invention, definitions and explanations of related terms are provided below.

As used herein, the terms "comprises," "comprising," "includes," "including," "containing," and "having" are open-ended, meaning the inclusion of the stated elements, steps, or components, but not the exclusion of other non-recited elements, steps, or components. The expression "consisting of … …" does not include any elements, steps or components not specified. The expression "consisting essentially of … …" means that the scope is limited to the specified elements, steps, or components, plus any optional elements, steps, or components that do not significantly affect the basic and novel properties of the claimed subject matter. It should be understood that the expressions "consisting essentially of … …" and "consisting of … …" are encompassed within the meaning of the expression "comprising".

As used herein, the singular forms "a," "an," or "the" include plural referents unless the context clearly dictates otherwise. The term "one (species)" or "at least one (species)" encompasses 1, 2, 3, 4, 5, 6, 7, 8, 9 (species) or more.

As used herein, unless the context indicates otherwise or clearly contradicted by context, the expression "selected from" encompasses any element of the group of elements listed thereafter or any combination of any two or more elements.

Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each separate value is incorporated into the specification as if it were individually recited herein. Unless specifically indicated to the contrary, the numerical values or ranges set forth herein are modified by the word "about" to mean the recited or stated numerical values or ranges are + -20%, + -10%, + -5%, or + -3%.

All methods described herein can be performed in any suitable order unless otherwise indicated.

As used herein, the term "wild-type" means that the sequence is naturally occurring and not artificially modified. The term encompasses naturally occurring mutants.

As used herein, the term "polypeptide" refers to a polymer comprising two or more amino acids covalently linked by peptide bonds. A "protein" may comprise one or more polypeptides, wherein the polypeptides interact with each other by covalent or non-covalent means. Unless otherwise indicated, "polypeptide" and "protein" may be used interchangeably.

As used herein, the term "% identity" or "percent identity" with respect to sequences refers to the percentage of nucleotides or amino acids that are identical in the optimal alignment between the sequences to be compared. The difference between the two sequences may be distributed over a local area (section) or the entire length of the sequences to be compared. Typically, the percent identity between two sequences is determined after optimal alignment of the segments or "comparison windows". The optimal alignment may be performed manually or by means of algorithms known in the art, including but not limited to the local homology algorithms described in Smith and Waterman,1981,Ads App.Math.2,482 and Neddleman and Wunsch,1970, j.mol. Biol.48,443, the similarity search method described in Pearson and Lipman,1988,Proc.Natl Acad.Sci.USA 88,2444, or using computer programs such as GAP, BESTFIT, FASTA, BLAST P, BLAST N and tfast a in Wisconsin Genetics Software Package, genetics Computer Group,575Science Drive,Madison, wis. For example, the percent identity of two sequences may be determined using the BLASTN or BLASTP algorithm commonly available at the National Center for Biotechnology Information (NCBI) website.

The percent identity is obtained by determining the number of identical positions corresponding to the sequences to be compared, dividing this number by the number of positions compared (e.g., the number of positions in the reference sequence), and multiplying this result by 100. In some embodiments, the degree of identity is given to a region of at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% of the entire length of the reference sequence. In some embodiments, the degree of identity is given to the entire length of the reference sequence. Alignment for determining sequence identity can be performed using tools known in the art, preferably using optimal sequence alignment, e.g., using Align, using standard settings, preferably EMBOSS:: needle, matrix: blosum62, gap Open 10.0, gap extension 0.5.

Herein, "nucleotide" includes deoxyribonucleotides and ribonucleotides and derivatives thereof. As used herein, a "ribonucleotide" is a constituent material of ribonucleic acid (RNA) and consists of one molecule of base, one molecule of pentose, and one molecule of phosphate, which refers to a nucleotide having a hydroxyl group at the 2' -position of the β -D-ribofuranosyl group. "deoxyribonucleotide" is a constituent substance of deoxyribonucleic acid (DNA) and also comprises one molecule of base, one molecule of five-carbon sugar and one molecule of phosphoric acid, and refers to a nucleotide in which the hydroxyl group at the 2' -position of the beta-D-ribofuranosyl group is replaced by hydrogen, and is a main chemical component of a chromosome. "nucleotide" is generally referred to by the single letter representing the base therein: "A (a)" means adenine-containing deoxyadenylate or adenylate, "C (C)" means cytidine-containing deoxycytidine or cytidine-containing deoxyguanylate or guanylate, "G (G)" means guanine-containing deoxyguanylate or guanylate, "U (U)" means uracil-containing uridylate, "T (T)" means thymine-containing deoxythymidylate.

As used herein, the terms "polynucleotide" and "nucleic acid" are used interchangeably to refer to a polymer of deoxyribonucleotides (deoxyribonucleic acid, DNA) or a polymer of ribonucleotides (ribonucleic acid, RNA). "Polynucleotide sequence", "nucleic acid sequence" and "nucleotide sequence" are used interchangeably to refer to the ordering of nucleotides in a polynucleotide. It will be appreciated by those skilled in the art that the coding strand (sense strand) of DNA can be considered to have the same nucleotide sequence as the RNA it encodes, with deoxythymidylate in the sequence of the coding strand of DNA corresponding to uridylate in the sequence of the RNA it encodes.

As used herein, the term "vector" refers to a vehicle for introducing nucleic acid into a host cell. Vectors may include expression vectors and cloning vectors. Generally, expression vectors contain the desired coding sequence and appropriate DNA sequences necessary for expression of the operably linked coding sequence in a particular host organism (e.g., bacteria, yeast, plant, insect or mammal) or in an in vitro expression system. Cloning vectors are generally used to engineer (perform recombinant DNA procedures) and amplify desired DNA fragments and may lack the functional sequences required to express the desired DNA sequences. Examples of vectors include, but are not limited to, plasmid, cosmid, phage (e.g., lambda phage) vectors, viral vectors (e.g., retroviral, adenoviral, or baculovirus vectors), or artificial chromosome (e.g., bacterial Artificial Chromosome (BAC), yeast Artificial Chromosome (YAC), or P1 Artificial Chromosome (PAC)) vectors.

As used herein, the term "expression" includes transcription and/or translation of a nucleotide sequence. Thus, expression may involve the production of transcripts and/or polypeptides. The term "transcription" relates to the process of transcribing the genetic code in a DNA sequence into RNA (transcript). The term "In vitro transcription" refers to the In vitro synthesis of RNA, in particular mRNA, in a cell-free system (e.g. In a suitable cell extract) (see e.g. Pardi n., muramatsu h., weissman d., karik et al (2013): in: rabinovich p. (eds) Synthetic Messenger RNA and Cell Metabolism modules In Molecular Biology (Methods and Protocols), vol 969.Humana Press,Totowa,NJ). Vectors that can be used to produce transcripts are also referred to as "transcription vectors" which contain the regulatory sequences required for transcription. The term "transcription" encompasses "in vitro transcription".

As used herein, "encoding" refers to the inherent properties of a particular nucleotide sequence in a polynucleotide, such as the ability of a gene, cDNA or RNA (particularly mRNA) to act as a template for the synthesis of polymers and macromolecules in other biological processes, provided that there is a defined nucleotide sequence or a defined amino acid sequence. If an mRNA corresponding to a DNA sequence (including the same coding strand as the mRNA sequence and the template strand complementary thereto) is translated into a polypeptide in a biological process, the DNA sequence or mRNA sequence may be considered to encode the polypeptide.

As used herein, the term "host cell" refers to a cell that is used to receive, hold, replicate, express a polynucleotide or vector. In some embodiments, the host cell may be a cell in which a polynucleotide of the invention is expressed.

As used herein, "isolated" refers to a substance (e.g., a polynucleotide or polypeptide) that is separate from the source or environment in which it is present. The isolated polynucleotide or polypeptide may be present in a substantially pure form (e.g., in a composition), or may be present in a non-natural environment, e.g., a host cell. In some embodiments, the polynucleotides of the invention are isolated. The term "naturally occurring" refers to the fact that an object may be found in nature. For example, polypeptides or polynucleotides that are present in organisms (including viruses) and that can be isolated from natural sources and that have not been intentionally modified by man in the laboratory are naturally occurring.

As used herein, the term "recombinant" means produced by "genetic engineering. In general, recombinant molecules (e.g., recombinant proteins and recombinant nucleic acids) are non-naturally occurring. The polypeptides and polynucleotides of the invention may be recombinant molecules.

As used herein, the term "binding antibody" refers to an antibody or fragment thereof that is capable of recognizing and binding to a particular antigen. As used herein, the term "neutralizing antibody" refers to an antibody or fragment thereof that is capable of neutralizing, i.e., preventing, inhibiting, reducing, or interfering with the ability of a pathogen to initiate and/or maintain infection in a host (e.g., host organism or host cell). According to the invention, binding and neutralizing antibodies to influenza hemagglutinin can be produced in a subject vaccinated with the vaccine of the invention, e.g., in the immune serum of the subject. Bound or neutralizing antibody titers in immune serum can be measured using methods known in the art.

The term "antigen" refers to a substance comprising an epitope therein against which an immune response may be generated. The immune response may involve the production of antibodies, or specific immunogenically active cells, or both. In particular embodiments, the antigen may bind to a T cell epitope or T or B cell receptor, or to an immunoglobulin, such as an antibody. It will be appreciated by those skilled in the art that any of the DNA or RNA herein, the nucleotide sequence or portions thereof, may encode a protein capable of eliciting an acquired immunity in the body. Still further, it will be understood by those skilled in the art that an antigen need not solely encode the full length nucleotide sequence of only one gene. It is apparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene, and that these nucleotide sequences form different mixtures to induce the onset of a response. Still further, it will be appreciated by those skilled in the art that the antigen need not be encoded entirely by one gene. Obviously, the antigen may be synthetically produced, or may be derived from a biological sample.

Polypeptide antigens

In this context, "polypeptide antigen" refers to a polypeptide that is an antigen, including but not limited to the polypeptide itself or processed products thereof (e.g., antigens that are processed and presented in vivo). According to the invention, influenza hemagglutinin or a processed product thereof as described herein may be a polypeptide antigen and induce an immune response as an immunogenic active ingredient in a vaccine. The polypeptide antigen may be influenza hemagglutinin, immunogenic fragments of influenza hemagglutinin, and combinations thereof. Immunogenic fragments of influenza hemagglutinin include, but are not limited to, HA1, HA2, HA head and HA stem.

As used herein, "influenza hemagglutinin", "HA" or "HA protein" refers to hemagglutinin of an influenza virus. Hemagglutinin is the major envelope glycoprotein of influenza a and b viruses. Hemagglutinin is a key protein that mediates viral invasion into host cells. HA comprises two subunits, HA1 and HA2, distributed on the surface of the viral envelope in the form of trimeric spines. HA trimer can be structurally divided into two parts, head and stem. The HA head contains its receptor binding site and the HA stem contains a hydrophobic membrane fusion peptide and a transmembrane region formed by the C-terminus of HA 2.

In some embodiments, the Influenza hemagglutinin is derived from an Influenza a virus (Influenza a), an Influenza B virus (Influenza B), or a combination thereof. In some embodiments, the influenza hemagglutinin is derived from A/Victoria/2570/2019 (H1N 1), A/Cambodia/e0826360/2020 (H3N 2), B/Washington/02/2019 (B/Victoria), B/PHUKET/3073/2013 (B/mountain shape), or a combination thereof. In one embodiment, the influenza hemagglutinin comprises the amino acid sequence of any of SEQ ID NOs 1, 2, 3, and 4. In one embodiment, the influenza hemagglutinin comprises an amino acid sequence having at least 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence of any of SEQ ID NOs 1, 2, 3, and 4.

Polynucleotide

In one aspect, the invention provides a polynucleotide comprising at least one coding region encoding influenza hemagglutinin, wherein the at least one coding region is selected from the group consisting of:

The polynucleotide may be single-stranded or double-stranded. Polynucleotides include, but are not limited to, DNA, cDNA, RNA (e.g., mRNA), recombinantly produced, and chemically synthesized polynucleotides. The polynucleotide may be contained in a vector. Polynucleotides of the invention may include naturally occurring, synthetic, and modified nucleotides. In some embodiments, polynucleotides of the invention are used for expression in host cells to provide an antigen.

The polynucleotide may comprise one or more coding regions (e.g., 1, 2, 3, 4, 5, 6, 7, 8 coding regions) comprising a coding sequence for a polypeptide of interest (e.g., a polypeptide antigen described herein). As used herein, "coding region" refers to a portion of a polynucleotide that comprises a nucleotide sequence that can be used as a template for synthesis of a polypeptide having a defined nucleotide sequence (e.g., tRNA and mRNA) or a defined amino acid sequence in a biological process. The coding region may comprise coding sequences, including DNA sequences and RNA sequences.

As used herein, "codon" refers to three consecutive nucleotide sequences (also known as triplet codes) in a polynucleotide that encode a particular amino acid. Synonymous codons (codons encoding the same amino acid) are used differently in different species, termed "codon bias". It is generally believed that for a given species, coding sequences using codons that are favored by it can have higher translational efficiency and accuracy in the expression system of that species. Thus, a polynucleotide may be "codon optimized," i.e., codons in the polynucleotide are altered to reflect codons favored by the host cell, preferably without altering the amino acid sequence it encodes. In certain embodiments, the polynucleotides of the invention (particularly the coding regions thereof) comprise codons optimized for the host (e.g., subject, particularly human) cell such that the polypeptide antigen as described herein is optimally expressed in the host (e.g., subject, particularly human).

The polynucleotides of the invention may comprise at least one nucleotide sequence of a coding region as described herein, or comprise a nucleotide sequence complementary to a nucleotide sequence of said coding region. In one embodiment, the coding region does not comprise an initiation codon at its 5 'end and does not comprise a termination codon at its 3' end. In one embodiment, the coding region comprises an initiation codon at its 5 'end and a termination codon at its 3' end. In one embodiment, the coding region comprises an Open Reading Frame (ORF) as described herein.

In particular embodiments, the polynucleotide may comprise coding sequences for the polypeptide of interest as well as regulatory sequences (including but not limited to transcription and translation regulatory sequences). Regulatory sequences include, but are not limited to, promoter sequences, 5 'untranslated region (5' UTR) sequences, 3 'untranslated region (3' UTR) sequences, and poly (A) sequences.

In one embodiment, the first coding region (a) encodes the amino acid sequence of SEQ ID NO. 1; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOS: 5-9. In one embodiment, the first coding region (a) encodes the amino acid sequence of SEQ ID NO. 1; and (b) comprises a nucleotide sequence having at least 95% identity to the nucleotide sequence of SEQ ID NO. 5. In one embodiment, the first coding region comprises the nucleotide sequence of any one of SEQ ID NOs 5 to 9. In a preferred embodiment, the first coding region comprises the nucleotide sequence of SEQ ID NO. 5.

In one embodiment, the second coding region (a) encodes the amino acid sequence of SEQ ID NO. 2; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOS: 11-15. In one embodiment, the second coding region (a) encodes the amino acid sequence of SEQ ID NO. 2; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO. 12. In one embodiment, the second coding region comprises the nucleotide sequence of any one of SEQ ID NOS.11-15. In a preferred embodiment, the second coding region comprises the nucleotide sequence of SEQ ID NO. 12.

In one embodiment, the third coding region (a) encodes the amino acid sequence of SEQ ID NO. 3; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOS: 17-20. In one embodiment, the third coding region (a) encodes the amino acid sequence of SEQ ID NO. 3; and (b) comprises a nucleotide sequence having at least 95% identity to the nucleotide sequence of SEQ ID NO. 17. In one embodiment, the third coding region comprises the nucleotide sequence of any one of SEQ ID NOS.17-20. In one embodiment, the third coding region comprises the nucleotide sequence of SEQ ID NO. 17.

In one embodiment, the fourth coding region (a) encodes the amino acid sequence of SEQ ID NO. 4; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOS.22-28. In one embodiment, the fourth coding region (a) encodes the amino acid sequence of SEQ ID NO. 4; and (b) comprises a nucleotide sequence having at least 95% identity to the nucleotide sequence of SEQ ID NO. 26. In one embodiment, the fourth coding region comprises the nucleotide sequence of any one of SEQ ID NOS.22-28. In one embodiment, the fourth coding region comprises the nucleotide sequence of SEQ ID NO. 26.

In one embodiment, a polynucleotide of the invention comprises a first coding region, a second coding region, a third coding region, or a fourth coding region as described herein. In one embodiment, a polynucleotide of the invention comprises any combination of a first coding region, a second coding region, a third coding region, and a fourth coding region as described herein. In one embodiment, a polynucleotide of the invention comprises a first coding region, a second coding region, a third coding region, and a fourth coding region as described herein.

The polynucleotides of the invention include, but are not limited to, a first polynucleotide (first RNA), a second polynucleotide (second RNA), a third polynucleotide (third RNA), or a fourth polynucleotide (fourth RNA) as described herein. In a specific embodiment, the polynucleotide of the invention is an RNA comprising an RNA of the invention. In one embodiment, the polynucleotide of the invention is an RNA comprising a first RNA, a second RNA, a third RNA, or a fourth RNA as described herein. In a specific embodiment, the polynucleic acid of the invention is a DNA encoding an RNA of the invention.

In one embodiment, the first polynucleotide (first RNA) comprises a first coding region as described herein. In one embodiment, the first polynucleotide (first RNA) comprises the nucleotide sequence of any one of SEQ ID NOs 34-38. In a preferred embodiment, the first polynucleotide (first RNA) comprises the nucleotide sequence of SEQ ID NO. 34.

In one embodiment, the second polynucleotide (second RNA) comprises a second coding region as described herein. In one embodiment, the second polynucleotide (second RNA) comprises the nucleotide sequence of any one of SEQ ID NOS.39-43. In a preferred embodiment, the second polynucleotide (second RNA) comprises the nucleotide sequence of SEQ ID NO. 40.

In one embodiment, the third polynucleotide (third RNA) comprises a third coding region as described herein. In one embodiment, the third polynucleotide (third RNA) comprises the nucleotide sequence of any one of SEQ ID NOS 44-47. In a preferred embodiment, the third polynucleotide (third RNA) comprises the nucleotide sequence of SEQ ID NO. 44.

In one embodiment, the fourth polynucleotide (fourth RNA) comprises a fourth coding region as described herein. In one embodiment, the fourth polynucleotide (fourth RNA) comprises the nucleotide sequence of any one of SEQ ID NOs 48-54. In a preferred embodiment, the fourth polynucleotide (fourth RNA) comprises the nucleotide sequence of SEQ ID NO. 52.

RNA

In some embodiments, the polynucleotides of the invention are RNA. As used herein, the definition of "RNA" encompasses single-stranded, double-stranded, linear, and circular RNAs. The RNA of the invention may be RNA produced by chemical synthesis, recombination and in vitro transcription. In one embodiment, the RNA of the invention is used to express a polypeptide antigen as described herein in a host cell.

In one embodiment, the RNA of the invention is single stranded RNA. In one embodiment, the RNA of the invention is in vitro transcribed RNA (IVT-RNA). IVT-RNA can be obtained by in vitro transcription with a DNA template by RNA polymerase (e.g., as described herein).

In some embodiments, the RNA of the invention comprises at least one coding region as described herein. In one embodiment, the RNA of the invention comprises a first coding region, a second coding region, a third coding region, or a fourth coding region as described herein. In one embodiment, the RNA of the invention comprises any combination of a first coding region, a second coding region, a third coding region, and a fourth coding region as described herein. In one embodiment, the RNA of the invention comprises a first coding region, a second coding region, a third coding region, and a fourth coding region as described herein.

In some embodiments, the RNAs of the invention further comprise structural elements that help to improve stability and/or translation efficiency of the RNAs, including, but not limited to, 5' caps, 5' utrs, 3' utrs, and poly (a) sequences.

In some embodiments, the RNA of the invention is messenger RNA (mRNA). In general, mRNA can comprise a 5'utr sequence, a coding sequence for a polypeptide, a 3' utr sequence, and optionally a poly (a) sequence. mRNA can be produced, for example, by in vitro transcription or chemical synthesis. The mRNA may be non-replicating mRNA (NRM) or self-amplifying mRNA (SAM).

In one embodiment, the mRNA of the invention is obtained by in vitro transcription by RNA polymerase (e.g., T7RNA polymerase) using a DNA template. In one embodiment, the mRNA of the present invention comprises (1) an optionally present 5' cap, (2) a 5' utr, (3) a coding region, (4) a 3' utr, and (5) an optionally present poly (a) sequence. The 5' cap, 5' UTR, coding region, 3' UTR and poly (A) sequences are as described herein. In one embodiment, the mRNA of the present invention is a nucleoside modified mRNA.

As used herein, the term "untranslated region (UTR)" generally refers to a region in RNA (e.g., mRNA) that is not translated into an amino acid sequence (non-coding region), or a corresponding region in DNA. In general, a UTR located 5' (upstream) of the open reading frame (start codon) may be referred to as a 5' untranslated region (5 ' UTR); the UTR located 3' (downstream) of the open reading frame (stop codon) may be referred to as the 3' untranslated region (3 ' UTR). In the presence of a 5 'cap, the 5' UTR is located downstream of the 5 'cap, e.g., immediately adjacent to the 5' cap. In particular embodiments, an optimized "Kozak sequence" may be included in the 5' utr, e.g., adjacent to the start codon, to increase translation efficiency. Preferably, the "3' UTR" does not comprise a poly (A) sequence. In the presence of a poly (A) sequence, the 3' UTR is located upstream of the poly (A) sequence, e.g., immediately adjacent to the poly (A) sequence.

In some embodiments, the RNA of the invention comprises a 5' utr. In one embodiment, the 5' UTR comprises the nucleotide sequence of SEQ ID NO. 31. In some embodiments, the RNA of the invention comprises a 3' utr. In one embodiment, the 3' UTR comprises the nucleotide sequence of any one of SEQ ID NOs 32. In some embodiments, the RNA of the invention comprises a 5'utr and a 3' utr. In one embodiment, the 5'UTR comprises the nucleotide sequence of SEQ ID NO. 31 and the 3' UTR comprises the nucleotide sequence of SEQ ID NO. 32.

As used herein, the term "poly (a) sequence" or "poly (a) tail" refers to a nucleotide sequence comprising continuous or discontinuous adenylates. The poly (A) sequence is typically located at the 3' end of the RNA, e.g., 3' end (downstream) of the 3' UTR. In some embodiments, the poly (a) sequence does not comprise nucleotides other than adenylate at its 3' end. Poly (A) sequences may be transcribed from the coding sequence of the DNA template by a DNA-dependent RNA polymerase during the preparation of IVT-RNA or may be linked to the free 3' end of the IVT-RNA, e.g.the 3' end of the 3' UTR, by a DNA-independent RNA polymerase (Poly (A) polymerase).

In some embodiments, the RNA of the invention comprises a poly (a) sequence. In one embodiment, the poly (A) sequence comprises contiguous adenylates. In one embodiment, the poly (a) sequence can comprise at least 20, 30, 40, 50, 60, 70, 80, or 100 and up to 120, 150, 180, 200, 300 adenylates. In one embodiment, the contiguous adenylate sequence in the poly (a) sequence is interrupted by a sequence comprising U, C or G nucleotides.

The poly (a) sequence may comprise at least 20, 30, 40, 50, 60, 70, 80 or 100 and up to 120, 150, 180, 200, 300 nucleotides. In one embodiment, the poly (a) sequence comprises at least 50 nucleotides. In one embodiment, the poly (a) sequence comprises at least 80 nucleotides. In one embodiment, the poly (a) sequence comprises at least 100 nucleotides. In some embodiments, the poly (a) sequence comprises about 70, 80, 90, 100, 120, or 150 nucleotides. In a specific embodiment, the poly (A) sequence comprises the nucleotide sequence of SEQ ID NO. 33.

As used herein, the term "5' cap" generally relates to an N7-methylguanosine structure (also known as "m" or ⁷ G cap "," m ⁷ Gppp- ". The 5' cap may be co-transcribed into the RNA in vitro transcription (e.g., using the anti-reverse cap analogue "ARCA") or may be post-transcriptionally linked to the RNA using a capping enzyme.

In some embodiments, cap analogs are used to generate 5' cap modified RNAs. For a description of "cap analogues" see, for example, contreeas, R.et al (1982) Nucl. Acids Res. 10,6353-6363 and US7074596B2. Examples of cap analogs include, but are not limited to, N7-methylguanosine-5 '-triphosphate-5' guanosine (m) ⁷ G (5 ') ppp (5') G), N7-methylguanosine-5 '-triphosphate-5' -adenosin (m) ⁷ G (5 ') ppp (5 ') A) and 3' -O-Me-m ⁷ G (5 ') ppp (5') G (ARCA). The mRNA may be an mRNA comprising the structure of Cap0 (no methylation of ribose of adjacent nucleotides of m 7G), cap1 (methylation of ribose of adjacent nucleotides of m 7G), or Cap2 (methylation of ribose of a second nucleotide downstream of m 7G).

In some embodiments, the RNA of the invention comprises a 5' cap. In some embodiments, the RNA of the invention is Cap0 RNA. In some embodiments, the RNA of the invention is Cap1RNA.

The RNAs of the invention are not limited to the first, second, third and fourth RNAs as described herein. In some embodiments, the RNA of the invention comprises a first RNA, a second RNA, a third RNA, or a fourth RNA as described herein.

Modified nucleotides

In some embodiments, the nucleotides in the polynucleotides of the invention (particularly RNA, e.g., mRNA) can be naturally occurring nucleotides and modified nucleotides. The modified nucleotides comprised by the RNA of the invention may be, for example, nucleotides that are not present in naturally occurring RNA (e.g. naturally occurring ribonucleotides), such as non-standard nucleotides or deoxynucleotides. Modification of the nucleotide may occur on the nucleoside, for example on the ribose moiety and/or nucleobase moiety. The modified nucleotides may be incorporated during transcription (e.g., in vitro transcription) or may be added during RNA chemical synthesis.

In one embodiment, the modified nucleobase comprises a modified cytosine, a modified uracil, or a combination thereof. In one embodiment, the modified uracil is independently selected from pseudouracil, 1-methyl-pseudouracil, 5-methyl-uracil, or a combination thereof. In one embodiment, the modified cytosine is independently selected from 5-methylcytosine, 5-hydroxymethylcytosine, or a combination thereof.

The RNA (e.g., mRNA) of the present invention can be a nucleoside modified RNA (e.g., mRNA). In one embodiment, the RNA (e.g., mRNA) is modified by replacing one or more uridine with a modified uridine. Examples of modified uridine may include, but are not limited to: 1-methyluridine, 1-methyl-pseudouridine, 3-methyl-uridine, 3-methyl-pseudouridine, 2-methoxy-uridine, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 1-ethyl-pseudouridine, 5-methylaminomethyl-2-thio-uridine, 5-carbamoylmethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurine methyl-uridine, 1-taurine methyl-pseudouridine, 5-taurine methyl-2-thio-uridine, 1-taurine methyl-4-thio-pseudouridine, 5-methyl-2-thio-uridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5, 6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, 3- (3-amino-3-carboxypropyl) uridine, 5- (isocyanatomethyl) uridine, 5- (2-thio) -methyl-1-deaza-uridine, 2 '-methyl-2' -thio-amino-2 '-methyl-2' -thio-2 '-O-methyl-2' -thio-uridine, 2 '-O-methyl-2' -O-thio-uridine, O-methyl-2 '-O-thio-2' -O-methyl-uridine, 5-methoxycarbonylmethyl-2 ' -O-methyl-uridine, 5-carbamoylmethyl-2 ' -O-methyl-uridine, 5-carboxymethylaminomethyl-2 ' -O-methyl-uridine, 3,2' -O-dimethyl-uridine, 5- (isopentenylaminomethyl) -2' -O-methyl-uridine, 1-thio-uridine, 5- (2-methoxycarbonylethyl) uridine and 5- [3- (1-E-propenyl) amino ] uridine.

In one embodiment, the RNA (e.g., mRNA) is modified by replacing at least one uridine with a modified uridine. In one embodiment, the RNA (e.g., mRNA) is modified by replacing all uracils with modified uracils. In one embodiment, the proportion of modified uridine in the RNA (e.g. mRNA) is 10% -100%, e.g. 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%. In one embodiment, the proportion of modified uridine in the RNA (e.g. mRNA) is 20% -100%. In one embodiment, 20% -100% of uridine in the RNA (e.g., mRNA) is replaced by 1-methyl pseudouridine. In a preferred embodiment, 100% of uridine in the RNA (e.g., mRNA) is replaced by 1-methyl pseudouridine. 1-methyl-pseudouridine has the following structure:

in a specific embodiment, the mRNA of the present invention comprises the nucleotide sequence of any of SEQ ID NOS.34-54, and wherein 100% of the uridine is replaced with 1-methyl pseudouridine. In a preferred embodiment, the mRNA of the invention comprises the nucleotide sequence of SEQ ID NO 34, 40, 44 or 52 and wherein 100% of the uridine is replaced by 1-methyl pseudouridine.

DNA

In some embodiments, the polynucleotides of the invention are DNA. As will be appreciated by those skilled in the art, deoxythymidylate (T) in DNA is replaced by uridylate (U) in the RNA it encodes. Thus, it will be appreciated that the polynucleic acids of the invention represented by a particular RNA encompass DNA encoding said RNA, wherein each "U" in said RNA is replaced by a "T".

The DNA of the invention may be, for example, a DNA template for in vitro transcription of the RNA of the invention or a DNA vaccine for expression of a polypeptide antigen in a host cell. The DNA may be double-stranded, single-stranded, linear and circular.

The DNA template may be provided in a suitable transcription vector. In general, a DNA template may be a double-stranded complex comprising a nucleotide sequence (coding strand) identical to a coding sequence described herein and a nucleotide sequence (template strand) complementary to a coding sequence described herein. As known to those skilled in the art, a DNA template may comprise a promoter, a 5'utr, a coding sequence, a 3' utr, and optionally a poly (a) sequence. Promoters may be available to suitable RNA polymerases (particularly DNA-dependent RNA polymerases) known to those skilled in the art, including but not limited to promoters of SP6, T3 and T7RNA polymerases. In some embodiments, the 5'utr sequence, coding sequence, 3' utr sequence, and poly (a) sequence in the DNA template are or are complementary to the corresponding sequences contained in the RNAs described herein. Polynucleotides as DNA vaccines may be provided in plasmid vectors (e.g., circular plasmid vectors).

In some embodiments, the DNA of the invention encodes the RNA of the invention. In some embodiments, the DNA of the invention comprises, from the 5 'end to the 3' end, (1) a T7 promoter, (2) a 5'utr, (3) a coding region, (4) a 3' utr, and (5) an optionally present poly (a) sequence as described herein.

Composition, vaccine and pharmaceutical composition

In yet another aspect, the invention provides a composition comprising at least one (e.g., 1, 2, 3, 4, 5, 6, or 7) polynucleotide of the invention. In some embodiments, the compositions of the invention comprise at least one DNA of the invention. In some embodiments, the compositions of the invention comprise at least one RNA of the invention. In one embodiment, the RNA is in vitro transcribed RNA. In one embodiment, the RNA is mRNA.

As used herein, the term "vaccine composition" refers to a composition comprising an antigen that, when vaccinated into a subject, induces an immune response sufficient to prevent and/or reduce at least one symptom associated with a pathogen or disease infection. In certain embodiments, the composition or pharmaceutical composition of the invention is a vaccine composition.

The invention also provides a vaccine comprising at least one (e.g., 1, 2, 3, 4, 5, 6 or 7) polynucleotide of the invention. The vaccine of the invention may be used to provide at least one (e.g., 1, 2, 3, 4, 5, 6, 7 or more) antigen (e.g., a polypeptide antigen as described herein) derived from influenza hemagglutinin in a subject in need thereof, thereby inducing prophylactic and/or therapeutic immunity against influenza virus in the subject. In some embodiments, the vaccine of the invention induces a protective immune response against influenza virus infection in a subject. The vaccine of the present invention may also be referred to as influenza vaccine. In particular embodiments, the polynucleotides of the invention or combinations thereof, compositions or combinations thereof, or pharmaceutical compositions or combinations thereof, may also be referred to as vaccines.

The vaccine of the invention may comprise one or more (e.g. 1, 2, 3, 4, 5, 6, 7 or more) vaccine compositions. In some embodiments, the vaccine of the invention comprises a plurality of vaccine compositions, wherein each vaccine composition comprises at least one RNA (particularly mRNA) of the invention. Vaccines comprising a plurality of vaccine compositions may also be referred to as "vaccine combinations".

The vaccines of the present invention may be multivalent vaccines (e.g., bivalent, trivalent, and tetravalent vaccines) comprising one or more polynucleotides (particularly RNA, e.g., mRNA) encoding two or more antigens (e.g., polypeptide antigens described herein). In a particular embodiment, the vaccine of the invention is a tetravalent vaccine comprising one or more polynucleotides (in particular RNA, e.g. mRNA) encoding four antigens (e.g. the polypeptide antigens described herein).

In a particular embodiment, the composition or vaccine of the invention is a pharmaceutical composition. Accordingly, the invention also provides a pharmaceutical composition comprising a polynucleotide (in particular RNA, such as mRNA), composition or vaccine of the invention and a pharmaceutically acceptable carrier. In one embodiment, the pharmaceutical composition comprises an LNP or LPP as described herein.

As used herein, the term "pharmaceutically acceptable" refers to the non-toxicity of a substance that does not interact with the interaction of the active components of the pharmaceutical composition. As used herein, "pharmaceutically acceptable carrier" includes, but is not limited to, excipients, binders, diluents, lubricants, thickening agents, surfactants, preservatives, stabilizers, emulsifiers, buffers, isotonicity agents, flavoring agents and coloring agents. Suitable carriers include, but are not limited to, sterile water, ringer's solution of lactic acid, sterile sodium chloride solution, isotonic saline, polyalkylene glycols, naphthalene hydroxide, and biocompatible polymers (e.g., lactide polymers, lactide/glycolide copolymers, or polyoxyethylene/polyoxypropylene copolymers). Additional description of pharmaceutically acceptable carriers can be found, for example, in Remington's Pharmaceutical Sciences, mack Publishing co. (A.R Gennaro kit.1985).

In particular embodiments, the vaccine and pharmaceutical compositions may further comprise an adjuvant. As used herein, the term "adjuvant" refers to a substance capable of promoting, extending and/or enhancing an immune response. Examples of adjuvants include, but are not limited to: oil emulsions (e.g., freund's adjuvant), aluminum hydroxide, mineral oil, bacterial products (e.g., pertussis toxin).

The compositions, vaccines and pharmaceutical compositions of the present invention are preferably administered parenterally. As used herein, the term "parenteral administration" refers to administration in any manner other than by the gastrointestinal tract. In some embodiments, the pharmaceutical compositions of the invention are administered intravenously, subcutaneously, intradermally, intramuscularly. In a preferred embodiment, the composition, vaccine or pharmaceutical composition of the invention is administered by subcutaneous, intradermal or intramuscular injection.

The composition, vaccine or pharmaceutical composition of the invention may further comprise one or more (e.g. 1, 2, 3, 4, 5, 6, 7 or more) other polynucleotides (in particular RNA, such as mRNA) encoding at least one other antigen which may be selected from the group consisting of influenza hemagglutinin head, influenza hemagglutinin stem, HA1, HA2, neuraminidase (NA), nucleoprotein, matrix protein 1 (M1), matrix protein 2 (2), nonstructural protein 1 (NS 1) and nonstructural protein 2 (NS 2).

In some embodiments, the compositions, vaccines or pharmaceutical compositions of the present invention comprise at least one polynucleotide (particularly RNA, e.g., mRNA), wherein the at least one polynucleotide (particularly RNA, e.g., mRNA) comprises at least one coding region encoding influenza hemagglutinin selected from the group consisting of:

(1) A first coding region as described herein;

(2) A second coding region as described herein;

(3) A third coding region as described herein; and

(4) A fourth coding region as described herein.

In one embodiment, the at least one polynucleotide comprises a first coding region, a second coding region, a third coding region, or a fourth coding region as described herein. In one embodiment, the at least one polynucleotide comprises any combination of a first coding region, a second coding region, a third coding region, and a fourth coding region as described herein. In one embodiment, the at least one polynucleotide comprises a first coding region, a second coding region, a third coding region, and a fourth coding region as described herein.

In some embodiments, the compositions, vaccines or pharmaceutical compositions of the present invention comprise at least one polynucleotide (particularly RNA, such as mRNA), wherein the at least one polynucleotide is selected from the group consisting of:

(1) A first polynucleotide (first RNA) as described herein;

(2) A second polynucleotide (second RNA) as described herein;

(3) A third polynucleotide (third RNA) as described herein; and

(4) A fourth polynucleotide (fourth RNA) as described herein.

In one embodiment, a composition, vaccine or pharmaceutical composition of the invention comprises a first polynucleotide (first RNA), a second polynucleotide (second RNA), a third polynucleotide (third RNA) or a fourth polynucleotide (fourth RNA) as described herein. In one embodiment, the composition, vaccine or pharmaceutical composition of the invention comprises any combination of a first polynucleotide (first RNA), a second polynucleotide (second RNA), a third polynucleotide (third RNA) and a fourth polynucleotide (fourth RNA) as described herein. In one embodiment, a composition, vaccine or pharmaceutical composition of the invention comprises a first polynucleotide (first RNA), a second polynucleotide (second RNA), a third polynucleotide (third RNA) and a fourth polynucleotide (fourth RNA) as described herein.

The first polynucleotide (first RNA), the second polynucleotide (second RNA), the third polynucleotide (third RNA) and the fourth polynucleotide (fourth RNA) may be present in any ratio in the composition, vaccine or pharmaceutical composition. For example, the mass ratio of the first RNA, the second RNA, the third RNA, and the fourth RNA may be 1:1:1:1, 1:1:2:2, 1:1:2.5:2.5, 1:1:3:3, 1:1:4:4, 1:1:5:5, 1:1:6:6, 1:1:10:10, 2:2:1:1, 4:4:1:1, 5:5:1:1, or 10:10:1). In one embodiment, the mass ratio of the first RNA, the second RNA, the third RNA, and the fourth RNA is 1:0.5-2:0.5-4:0.5-4. In one embodiment, the mass ratio of the first RNA, the second RNA, the third RNA, and the fourth RNA is 1:1:1:1, 1:1:2:2, or 1:1:4:4. In a preferred embodiment, the mass ratio of the first RNA, the second RNA, the third RNA and the fourth RNA is 1:1:2:2.

Lipid particles

In a preferred embodiment, at least one polynucleotide of the invention (in particular RNA, e.g. mRNA) is formulated in a lipid particle.

In some embodiments, the composition, vaccine or pharmaceutical composition of the invention is a nucleic acid composition. Particularly preferred nucleic acid compositions may be, for example, lipid Nanoparticles (LNP) and lipid multimeric complexes (LPP). Methods of preparing such compositions can be found, for example, in kaczmark, j.c. et al, 2017,Genome Medicine 9,60 or as described herein. The size (diameter) of the lipid particles in the nucleic acid composition may generally be, for example, from about 30nm to about 1000nm, from about 50nm to about 900nm, from about 100nm to about 500nm, or from about 150nm to about 300nm, such as from about 800nm, about 700nm, about 600nm, about 400nm, about 200nm, about 175nm, about 125nm, about 90nm, or about 75nm.

In some embodiments, the compositions, vaccines or pharmaceutical compositions of the present invention comprise a polynucleotide of the present invention (particularly RNA, e.g., mRNA) and a lipid particle encapsulating the polynucleotide.

In some implementations, the polynucleotide in the compositions, vaccines or pharmaceutical compositions of the present invention is RNA, wherein the RNA is associated with a cationic polymer into a complex, which is encapsulated in a lipid particle.

In some embodiments, the composition, vaccine or pharmaceutical composition of the invention comprises at least two RNAs, and the at least two RNAs are co-encapsulated in the same lipid particle. In some embodiments, the composition, vaccine or pharmaceutical composition of the invention comprises at least two RNAs, and the at least two RNAs are each encapsulated in a different lipid particle.

In some embodiments, a composition, vaccine, or pharmaceutical composition of the invention comprises a first RNA, a second RNA, a third RNA, or a fourth RNA as described herein encapsulated in a lipid particle;

optionally, the first, second, third, or fourth RNA is associated with a cationic polymer as a complex, and is co-encapsulated in the lipid particle to form a lipid-multimeric complex.

In some preferred embodiments, the composition, vaccine or pharmaceutical composition of the invention comprises a first RNA, a second RNA, a third RNA and a fourth RNA as described herein encapsulated in a lipid particle;

optionally, the first, second, third, and fourth RNAs are associated with a cationic polymer as a complex, collectively encapsulated in the lipid particle to form a lipid-multimeric complex.

In some embodiments, the first RNA, the second RNA, the third RNA, and the fourth RNA as described herein are co-encapsulated in the same lipid particle, e.g., the first RNA, the second RNA, the third RNA, and the fourth RNA may be pre-mixed prior to encapsulation of the pre-mixed RNAs in the lipid particle. In some embodiments, the first RNA, the second RNA, the third RNA, and the fourth RNA, as described herein, are each encapsulated in different lipid particles.

As used herein, the term "lipid" refers to an organic compound comprising a hydrophobic moiety and optionally also a hydrophilic moiety. Lipids are generally poorly soluble in water but soluble in many organic solvents. Generally, amphiphilic lipids comprising a hydrophobic portion and a hydrophilic portion may be organized in an aqueous environment as a lipid bilayer structure, for example in the form of vesicles. Lipids may include, but are not limited to: fatty acids, glycerides, phospholipids, sphingolipids, glycolipids, and steroids and cholesterol esters, and the like.

In some embodiments, the lipid particle encapsulating a polynucleotide (particularly RNA, e.g., mRNA) comprises a cationic lipid and a non-cationic lipid. In a preferred embodiment, the cationic lipid is an ionizable cationic lipid.

In one embodiment, the cationic lipid comprises DOTMA, DOTAP, DDAB, DOSPA, DODAC, DODAP, DC-Chol, DMRIE, DMOBA, DLinDMA, DLenDMA, CLinDMA, DMORIE, DLDMA, DMDMA, DOGS), N4-cholesteryl-spermine, DLin-KC2-DMA, DLin-MC3-DMA, or a combination thereof.

in one embodiment, the non-cationic lipid comprises a phospholipid as described herein. In one embodiment, the non-cationic lipid comprises a steroid as described herein. In one embodiment, the non-cationic lipid comprises a phospholipid and a steroid as described herein. In one embodiment, the phospholipid comprises DSPC, DPPC, DMPC, DOPC, POPC, DOPE, DOPG, DPPG, POPE, DPPE, DMPE and DSPE or a combination thereof. In one embodiment, the steroid is cholesterol. In one embodiment, the non-cationic lipid comprises DOPE. In one embodiment, the non-cationic lipid comprises DSPC. In one embodiment, the non-cationic lipid comprises cholesterol. In one embodiment, the non-cationic lipid comprises DOPE and cholesterol. In one embodiment, the non-cationic lipid comprises DSPC and cholesterol.

In one embodiment, the cationic lipid comprises M5 and the non-cationic lipid comprises DOPE and cholesterol. In one embodiment, the cationic lipid comprises M5 and the non-cationic lipid comprises DSPC and cholesterol.

In some embodiments, the lipid particle encapsulating a polynucleotide (particularly RNA, e.g., mRNA) further comprises a polyethylene glycol modified lipid. In one embodiment, the polyethylene glycol modified lipid comprises DMG-PEG (e.g., DMG-PEG 2000), dog PEG, and DSPE-PEG, or a combination thereof. In one embodiment, the polyethylene glycol modified lipid comprises DSPE-PEG. In one embodiment, the polyethylene glycol modified lipid comprises DMG-PEG (e.g., DMG-PEG 2000).

In some embodiments, the compositions, vaccines or pharmaceutical compositions of the present invention further comprise a cationic polymer that associates with the RNA (e.g., mRNA) as a complex, collectively encapsulated in the lipid particle.

In one embodiment, the cationic polymer comprises poly-L-lysine, protamine, polyethylenimine (PEI), or a combination thereof. In one embodiment, the cationic polymer is protamine. In one embodiment, the cationic polymer is a polyethyleneimine.

In one embodiment, the amount of lipid in the composition is calculated as mole percent (mole%) based on the total moles of lipid in the composition.

In one embodiment, the amount of cationic lipid in the composition is from about 10 to about 70 mole%. In some embodiments, the amount of cationic lipid in the composition is from about 20 to about 60 mole%, from about 30 to about 50 mole%, from about 35 to about 45 mole%, from about 38 to about 45 mole%, from about 40 to about 50 mole%, or from about 45 to about 50 mole%.

In one embodiment, the amount of phospholipid in the composition is from about 10 to about 70 mole%. In one embodiment, the amount of phospholipid in the composition is from about 20 to about 60 mole%, from about 30 to about 50 mole%, from about 10 to about 30 mole%, from about 10 to about 20 mole%, or from about 10 to about 15 mole%.

In one embodiment, the amount of cholesterol in the composition is from about 10 to about 70 mole%. In one embodiment, the amount of cholesterol in the composition is from about 20 to about 60 mole%, from about 30 to about 50 mole%, from about 35 to about 40 mole%, from about 35 to about 45 mole%, from about 40 to about 45 mole%, or from about 45 to about 50 mole%.

In one embodiment, the amount of polyethylene glycol modified lipid in the composition is from about 0.05 to about 20 mole%. In one embodiment, the amount of polyethylene glycol modified lipid in the composition is from about 0.5 to about 15 mole%, from about 1 to about 10 mole%, from about 5 to about 15 mole%, from about 1 to about 5 mole%, from about 1.5 to about 3 mole%, or from about 2 to 5 mole%.

In some embodiments, the RNA (particularly mRNA) of the invention is formulated as Lipid Nanoparticles (LNP). As used herein, "lipid nanoparticle" or "LNP" refers to particles formed from lipids in which nucleic acids (e.g., mRNA) are encapsulated.

In one embodiment, the LNP comprises at least one RNA of the invention and lipid particles encapsulating the RNA, wherein the lipid particles comprise cationic lipids, phospholipids, cholesterol, and polyethylene glycol modified lipids. In one embodiment, the cationic lipid is M5. In one embodiment, the phospholipid is DSPC. In one embodiment, the polyethylene glycol modified lipid is DMG-PEG 2000. In one embodiment, the cationic lipid is M5, the phospholipid is DSPC, and the polyethylene glycol modified lipid is DMG-PEG 2000.

In one embodiment, the RNA-encapsulated lipid particle comprises 50 mole% M5, 10 mole% DSPC, 38.5 mole% cholesterol, and 1.5 mole% DMG-PEG 2000.

In some embodiments, the RNA (particularly mRNA) of the invention is formulated as a Lipopolyplex (LPP). As used herein, "lipid multimeric complex" or "LPP" refers to a core-shell structure comprising a nucleic acid core encapsulated by a lipid outer shell, the core comprising a nucleic acid (e.g., mRNA) associated with a polymer.

In one embodiment, the LPP comprises at least one RNA of the invention, which associates with the cationic polymer as a complex; and lipid particles encapsulating the complex, wherein the lipid particles comprise cationic lipids, non-cationic lipids, and polyethylene glycol modified lipids. In one embodiment, the non-cationic lipid comprises a phospholipid and a steroid. In one embodiment, the non-cationic lipid comprises a phospholipid selected from 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), distearoyl phosphatidylcholine (DSPC), or a combination thereof, and cholesterol. In one embodiment, the cationic polymer comprises protamine. In one embodiment, the polyethylene glycol modified lipid comprises DMG-PEG 2000.

the non-cationic lipid comprises a phospholipid selected from 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), distearoyl phosphatidylcholine (DSPC), or a combination thereof, and cholesterol;

the polyethylene glycol modified lipid comprises 1, 2-dimyristoyl-rac-glycerol-3-methoxypolyethylene glycol 2000 (DMG-PEG 2000);

The cationic polymer comprises protamine.

In one embodiment, the cationic polymer is protamine, the cationic lipid is M5, the phospholipid is DOPE, and the polyethylene glycol modified lipid is DMG-PEG 2000.

In one embodiment, the lipid particle of the encapsulation complex comprises 40 mole% M5, 15 mole% DOPE, 43.5 mole% cholesterol, and 1.5 mole% DMG-PEG 2000.

In one embodiment, the composition, vaccine or pharmaceutical composition of the invention comprises at least one RNA of the invention and lipid particles encapsulating said RNA, said lipid particles comprising 10 to 70 mole% M5, 10 to 70 mole% 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 10 to 70 mole% cholesterol and 0.05 to 20 mole% 1, 2-dimyristoyl-rac-glycerol-3-methoxypolyethylene glycol (DMG-PEG) 2000.

Cationic lipids

Cationic lipids are lipids that carry a net positive charge at a specified pH. Lipids with a net positive charge can associate with nucleic acids through electrostatic interactions.

Examples of cationic lipids include, but are not limited to, 1, 2-di-O-octadecenyl-3-trimethylammonium propane (1, 2-di-O-octadienyl-3-trimethylammonium propane (DOTMA), 1, 2-dioleoyl-3-trimethylammonium propane (DOTAP), didecyl dimethylammonium bromide (Didecyldimethylammonium bromide, DDAB), 2, 3-dioleyloxy-N- [2 (sperminecarboxamide) ethyl ] -N, N-dimethyl-propylamine trifluoroacetate (2, 3-dioleoyl-N- [2 (spermine carboxamide) ethyl ] -N, N-dimethyl-propanamium trifluoroacetate, DOSPA), dioleyl dimethylammonium chloride (dioctadecyldimethyl ammonium chloride, DODAC), 1,2-dioleoyl-3-dimethylammonium bromide (2, 3-dioleoyl-N- [2 (spermamide) ethyl ] -N, N-dimethyl-N- [ 2- (2-diamino-carboxamide) ethyl ] -N, N-dimethyl-N- [2 (spermine carboxamide) ethyl ] -N, N-dimethyl-858-3, DODAP), 1,2-dioleoyl-3-dimethylammonium chloride (DAP), N- (2, 3-dimethyl-carbamide) ethyl ] -N, N- (2-dimethyl-N-carbamide) methyl-N- (2-carbamide) ethyl) -N- (2-methyl-N-carbamide) methyl-3-trimethyl-propane (N- (2-methyl-N-methyl-trimethyl-2, N-trimethyl-propane (N, N-trimethyl-methyl-2-trimethyl-propane), n-dimethyl-3,4-dioleyloxybenzylamine (N, N-dimethylol-3, 4-dioleylbenzoxybenzylamine, DMOBA), 1, 2-dioleyloxyN, N-dimethylaminopropane (1, 2-dioleylethyloxy-N, N-dimethylol-minopropane, DLinDMA), 1, 2-dioleyloxyN, N-dimethylaminopropane (1, 2-dioleylenoxy-N, N-dimethylol-minopropane, DLenDMA), 3-dimethylamino-2- (cholest-5-ene-3-beta-oxybutane-4-oxy) -1- (cis, cis-9, 12-octadecadienyloxy) propane (3-dimethyllamino-2- (cholest-5-en-3-beta-oxybutynin-4-oxy) -1- (cis, cis-9, 12-oc-tadecadienyloxy) propane, clinDMA), N- (2-aminoethyl) -N, N-dimethyl-2,3-bis (tetradecyloxy) propane-1-aminium bromide (N- (2-aminoethyl) -N, N-dimethyl-2,3-bis (tetradecyloxy) propane-1-aminium bromide, DMRIE), N-dimethyl-2,3-bis (dodecyloxy) propane-1-amine (N, N-dimethyl-2,3-bis (dodecyloxy) propane-1-amine, DLDMA), N-dimethyl-2,3-bis (tetradecyloxy) propane-1-amine (N, N-dimethyl-2,3-bis (tetradecyloxy) pro-an-1-amine, DMDMA), dioctadecyl amidoglycyl spermine (dioctadecylamidoglycyl spermine, DOGS), N4-cholesteryl-spermine (N4-cholesteryl-spermine), 2-dioleyl-4- (2-dimethylaminoethyl) - [1,3] -dioxolane (2, 2-dioleylel-4- (2-dimethylmineethyl) - [1,3] -dioxolane, DLin-KC 2-DMA), triacontan-6,9,28,31-tetraen-19-yl-4- (dimethylamino) butanoate (heptatriacronate-6,9,28,31-tetraen-19-yl-4- (dimethyllamino) butanoate, DLin-MC 3-DMA), decan-9-yl-8- ((2-hydroxyethyl) (6-oxo-6- ((decyloxy) hexyl) amino) octanoate) (heptatan-9-yl 8- ((2-hydroxyyethyl) (6-oxo-6- (undecylexy) hexy) amino) octanoate), (4-hydroxybutyl) azadialkyl) bis (hexane-6, 1-diyl) bis (2-hexyl decanoate) bis (4-hydroxybutyl) azanediyl) bis (2-hexydecanoate).

In some embodiments, the cationic lipid is preferably an ionizable cationic lipid. The ionizable cationic lipid carries a net positive charge at, for example, an acidic pH, and is neutral at a higher pH (e.g., physiological pH). Examples of ionizable cationic lipids include, but are not limited to: dioctadecyl amidoglycyl spermine (dioctadecylamidoglycyl spermine, DOGS), N4-cholesteryl-spermine (N4-cholesteryl-spermine), 2-dioleyl-4- (2-dimethylaminoethyl) - [1,3] -dioxolane (2, 2-dioleyl-4- (2-dimethylmineethyl) - [1,3] -dioleyl-KC 2-DMA), triacontanyl-6,9,28,31-tetraen-19-yl-4- (dimethylamino) butanoate (hepatriacta-6,9,28,31-tetraen-19-yl-4- (dimethylamino) butanoate, DLin-MC 3-DMA), decaheptan-9-yl-8- ((2-hydroxyethyl) (6-oxo-6- ((decyloxy) hexyl) amino) octanoate (heptadecan-9-yl-8-hydroxy) (6-dimethyl-6-dioxa-6-1-dioxa-1-dioleyl) 2-dioleyl-1- (1-dioxan-6-dioleyl) butanoate).

In a preferred embodiment, the cationic lipid comprises M5, which has the following structure:

Non-cationic lipids

Herein, "non-cationic lipids" refers to lipids that do not carry a net positive charge at a specified pH, such as anionic lipids and neutral lipids. The term "neutral lipid" refers to a lipid that exists in an uncharged, neutral or zwitterionic form at physiological pH. Neutral lipids may include, but are not limited to, phospholipids and steroids.

Examples of phospholipids include, but are not limited to: 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1-palmitoyl-2-oleoyl-phosphoethanolamine (POPE), distearoyl-phospholipidylcholine (DSPC), distearoyl-phospholipidylethanolamine (DSPE), dioleoyl-phospholipidylcholine (DOPC), dimyristoyl-phospholipidylcholine (DMPC), DPPC), ditolylphosphoryl phosphatidylcholine (DAPC), ditolylphosphoryl phosphatidylcholine (DBPC), ditridecylphospholipid line (DTPC), ditetradecylphospholipid Line (DLPC), palmitoyl-phosphatidylcholine (POPC), ditolyl-phosphatidylethanolamine (DPPE), ditolyl-phosphatidylethanolamine (DLPE).

Examples of steroids include, but are not limited to, for example, cholesterol, cholestanol, cholestanone, cholestenone, cholestanyl-2 '-hydroxyethylether, cholestanyl-4' -hydroxybutyl ether, tocopherol, and derivatives thereof.

Polyethylene glycol modified lipids

As used herein, the term "polyethylene glycol modified lipid" refers to a molecule comprising a polyethylene glycol moiety and a lipid moiety. Examples of polyethylene glycol modified lipids include, but are not limited to: 1, 2-dimyristoyl-rac-glycerol-3-methoxypolyethylene glycol (1, 2-dimyristoyl-rac-glycerol-3-methoxypolyethylene glycol, DMG-PEG), 1, 2-Dioleoyl-rac-glycerol, methoxy-polyethylene glycol (1, 2-Dioleoyl-rac-glycerol, methoxypolyethylene Glycol, dog eg) and 1, 2-Distearoyl-sn-glycerol-3-phosphoethanolamine-poly (ethylene glycol) (1, 2-Distearoyl-sn-glycerol-3-phosphoethanolamine-Poly (ethylene glycol), DSPE-PEG).

In one embodiment, the polyethylene glycol modified lipid is DMG-PEG, such as DMG-PEG 2000. In one embodiment, the DMG-PEG 2000 has the following structure:

wherein n has an average value of 44.

Cationic polymers

As used herein, the term "cationic polymer" refers to any ionic polymer capable of carrying a net positive charge at a specified pH to electrostatically bind nucleic acids. Examples of cationic polymers include, but are not limited to: poly-L-lysine, protamine and Polyethylenimine (PEI). The polyethyleneimine may be a linear or branched polyethyleneimine.

The term "protamine" refers to arginine-rich low molecular weight basic proteins that are present in sperm cells of various animals (particularly fish) and bind to DNA in place of histones. In a preferred embodiment, the cationic polymer is protamine (e.g., protamine sulfate).

Prevention and/or treatment of influenza virus infection

The present invention provides polynucleotides (particularly RNAs, e.g., mrnas), compositions, vaccines or pharmaceutical compositions of the invention for use in preventing and/or treating influenza virus infection in a subject in need thereof. The present invention provides polynucleotides (particularly RNAs, such as mrnas), compositions, vaccines or pharmaceutical compositions of the invention for inducing an immune response against influenza virus in a subject in need thereof.

The present invention provides the use of a polynucleotide (particularly RNA), composition, vaccine or pharmaceutical composition of the invention in the manufacture of a medicament for the prophylaxis and/or treatment of influenza virus infection.

The present invention provides a method for inducing an immune response against influenza virus in a subject in need thereof, the method comprising administering to the subject an effective amount of a polynucleotide (particularly RNA), composition, vaccine or pharmaceutical composition of the invention.

The present invention also provides a method for preventing and/or treating influenza virus infection in a subject in need thereof, the method comprising administering to the subject an effective amount of a polynucleotide (particularly RNA), composition, vaccine or pharmaceutical composition of the invention.

In one embodiment, the influenza virus infection comprises an infection by at least one influenza virus. In one embodiment, the influenza virus is selected from the group consisting of influenza a virus and influenza b virus. In one embodiment, the influenza virus infection is seasonal influenza. In one embodiment, the influenza virus infection is seasonal influenza caused by influenza a and/or b virus. In one embodiment, the influenza a virus is selected from the group consisting of H1N1 and H3N2. In one embodiment, the influenza B virus is selected from the group consisting of B/victoria lineage virus and B/gable lineage virus.

In some preferred embodiments of the methods of the invention, the methods comprise administering an effective amount of a composition comprising an mRNA of the invention, particularly a composition comprising an LNP or LPP as described herein.

The term "effective amount" refers to an amount sufficient to prevent or inhibit the occurrence of a disease or condition and/or to slow, alleviate, delay the progression or severity of a disease or condition. In this context, an "effective amount" also refers to an amount sufficient to induce an immune response. The effective amount is affected by factors including, but not limited to: the rate and severity of the disease or condition, the age, sex, weight and physiological condition of the subject, the duration of the treatment, and the particular route of administration. An effective amount may be administered in one or more doses. An effective amount may be achieved by continuous or intermittent administration.

In some embodiments, the effective amount is provided in one or more administrations. In some embodiments, the effective amount is provided in two administrations. In some embodiments, the effective amount is provided in three administrations. In some embodiments of the methods of the invention, the methods comprise administering an effective amount of a polynucleotide (particularly RNA), composition, vaccine, or pharmaceutical composition of the invention by a "prime-boost" strategy.

In some embodiments, polynucleotides (particularly RNAs), compositions, vaccines or pharmaceutical compositions of the invention may be administered to a subject by any method known to those of skill in the art, such as parenterally, orally, transmucosally, transdermally, intramuscularly, intravenously, intradermally, subcutaneously or intraperitoneally. Preferably, the composition, vaccine or pharmaceutical composition of the invention is administered by intramuscular injection.

As used herein, the term "subject" describes an organism, e.g., a mammal, to which prophylactic or therapeutic immunity using a polynucleotide, composition, vaccine, or pharmaceutical composition of the invention may be provided. In a preferred embodiment, the subject is a human.

Embodiments of the present invention may be exemplified as follows:

1. An influenza vaccine comprising at least one RNA, wherein the at least one RNA comprises at least one coding region encoding influenza hemagglutinin selected from the group consisting of:

2. The vaccine of item 1, wherein the at least one coding region is selected from the group consisting of:

(1) A first coding region (a) encoding the amino acid sequence of SEQ ID NO. 1; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOs 5 to 9;

(2) A second coding region (a) encoding the amino acid sequence of SEQ ID NO. 2; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOS: 11-15;

(3) A third coding region (a) encoding the amino acid sequence of SEQ ID NO. 3; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOS: 17-20; and

(4) A fourth coding region (a) encoding the amino acid sequence of SEQ ID NO. 4; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOS.22-28.

3. The vaccine of item 2, wherein the at least one coding region is selected from the group consisting of:

4. The vaccine of item 2, wherein the at least one coding region is selected from the group consisting of:

(1) A first coding region (a) encoding the amino acid sequence of SEQ ID NO. 1; and (b) comprises a nucleotide sequence having at least 95% identity to the nucleotide sequence of SEQ ID NO. 5;

(2) A second coding region (a) encoding the amino acid sequence of SEQ ID NO. 2; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO. 12;

(3) A third coding region (a) encoding the amino acid sequence of SEQ ID NO. 3; and (b) comprises a nucleotide sequence having at least 95% identity to the nucleotide sequence of SEQ ID NO. 17; and

(4) A fourth coding region (a) encoding the amino acid sequence of SEQ ID NO. 4; and (b) comprises a nucleotide sequence having at least 95% identity to the nucleotide sequence of SEQ ID NO. 26.

5. The vaccine of item 3 or 4, wherein the at least one coding region is selected from the group consisting of:

(1) A first coding region comprising the nucleotide sequence of SEQ ID NO. 5;

(2) A second coding region comprising the nucleotide sequence of SEQ ID NO. 12;

(4) A fourth coding region comprising the nucleotide sequence of SEQ ID NO. 26.

6. The vaccine of item 1, wherein the at least one RNA is selected from the group consisting of:

(1) A first RNA comprising a first coding region, wherein the first coding region (a) encodes the amino acid sequence of SEQ ID No. 1 or an amino acid sequence having at least 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence of SEQ ID No. 1; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOs 5 to 9;

(2) A second RNA comprising a second coding region, wherein the second coding region (a) encodes the amino acid sequence of SEQ ID No. 2 or an amino acid sequence having at least 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence of SEQ ID No. 2; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOS: 11-15;

(3) A third RNA comprising a third coding region, wherein the third coding region (a) encodes the amino acid sequence of SEQ ID No. 3 or an amino acid sequence having at least 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence of SEQ ID No. 3; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOS: 17-20; and

(4) A fourth RNA comprising a fourth coding region, wherein the fourth coding region (a) encodes the amino acid sequence of SEQ ID No. 4 or an amino acid sequence having at least 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence of SEQ ID No. 4; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOS.22-28.

7. The vaccine of item 6, wherein the at least one RNA is selected from the group consisting of:

(1) A first RNA comprising a first coding region, wherein the first coding region (a) encodes the amino acid sequence of SEQ ID No. 1; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOs 5 to 9;

(2) A second RNA comprising a second coding region, wherein the second coding region (a) encodes the amino acid sequence of SEQ ID No. 2; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOS: 11-15;

(3) A third RNA comprising a third coding region, wherein the third coding region (a) encodes the amino acid sequence of SEQ ID No. 3; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOS: 17-20; and

(4) A fourth RNA comprising a fourth coding region, wherein the fourth coding region (a) encodes the amino acid sequence of SEQ ID No. 4; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOS.22-28.

8. The vaccine of item 7, wherein the at least one RNA is selected from the group consisting of:

(1) A first RNA comprising a first coding region, wherein said first coding region comprises the nucleotide sequence of any one of SEQ ID NOs 5-9;

(2) A second RNA comprising a second coding region, wherein said second coding region comprises the nucleotide sequence of any one of SEQ ID NOs 11-15;

(3) A third RNA comprising a third coding region, wherein the third coding region comprises the nucleotide sequence of any one of SEQ ID NOs 17-20; and

(4) A fourth RNA comprising a fourth coding region, wherein said fourth coding region comprises the nucleotide sequence of any one of SEQ ID NOS.22-28.

9. The vaccine of item 7, wherein the at least one RNA is selected from the group consisting of:

(1) A first RNA comprising a first coding region, wherein the first coding region (a) encodes the amino acid sequence of SEQ ID No. 1; and (b) comprises a nucleotide sequence having at least 95% identity to the nucleotide sequence of SEQ ID NO. 5;

(2) A second RNA comprising a second coding region, wherein the second coding region (a) encodes the amino acid sequence of SEQ ID No. 2; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO. 12;

(3) A third RNA comprising a third coding region, wherein the third coding region (a) encodes the amino acid sequence of SEQ ID No. 3; and (b) comprises a nucleotide sequence having at least 95% identity to the nucleotide sequence of SEQ ID NO. 17; and

(4) A fourth RNA comprising a fourth coding region, wherein the fourth coding region (a) encodes the amino acid sequence of SEQ ID No. 4; and (b) comprises a nucleotide sequence having at least 95% identity to the nucleotide sequence of SEQ ID NO. 26.

10. The vaccine of item 8 or 9, wherein the at least one RNA is selected from the group consisting of:

11. The vaccine of any one of claims 1-10, wherein the at least one RNA further comprises a 5' utr, a 3' utr, a 5' cap, a poly (a) sequence, or a combination thereof.

12. The vaccine of item 8, wherein the at least one RNA is selected from the group consisting of:

(1) A first RNA comprising the nucleotide sequence of any one of SEQ ID NOS.34-38;

(2) A second RNA comprising the nucleotide sequence of any one of SEQ ID NOS.39-43;

(3) A third RNA comprising the nucleotide sequence of any one of SEQ ID NOS 44-47; and

(4) A fourth RNA comprising the nucleotide sequence of any one of SEQ ID NOS.48-54.

13. The vaccine of item 10, wherein the at least one RNA is selected from the group consisting of:

(1) A first RNA comprising the nucleotide sequence of SEQ ID NO. 34;

(2) A second RNA comprising the nucleotide sequence of SEQ ID NO. 40;

(3) A third RNA comprising the nucleotide sequence of SEQ ID NO. 44; and

(4) And a fourth RNA comprising the nucleotide sequence of SEQ ID NO. 52.

14. The vaccine of any one of claims 6-13, comprising the first RNA, the second RNA, the third RNA, and the fourth RNA, and wherein the mass ratio of the first RNA, the second RNA, the third RNA, and the fourth RNA is 1:0.5-2:0.5-4:0.5-4;

Preferably, the mass ratio of the first RNA, the second RNA, the third RNA, and the fourth RNA is 1:1:1:1, 1:1:2:2, or 1:1:4:4;

more preferably, the mass ratio of the first RNA, the second RNA, the third RNA, and the fourth RNA is 1:1:2:2.

15. The vaccine of any one of claims 1-14, wherein the RNA comprises a modified nucleoside;

preferably, the RNA is modified by replacing all uridine with 1-methyl-pseudouridine.

16. The vaccine of any one of claims 1-15, wherein the RNA is encapsulated in a lipid particle.

17. The vaccine of any one of claims 6-14, comprising the first RNA, the second RNA, the third RNA, and the fourth RNA, and wherein the first RNA, the second RNA, the third RNA, and the fourth RNA are co-encapsulated in the same lipid particle.

18. The vaccine of claim 16 or 17, wherein said RNA associates with at least one cationic polymer into at least one complex, said at least one complex being encapsulated in said lipid particle to form a lipid multimeric complex.

19. The vaccine of item 18, wherein the at least one cationic polymer is selected from the group consisting of poly-L-lysine, protamine, and polyethylenimine; preferably, the cationic polymer is protamine.

20. The vaccine of any one of claims 16-19, wherein the lipid particle comprises a cationic lipid, a non-cationic lipid, and a PEG-modified lipid.

21. The vaccine of item 20, wherein

(1) The cationic lipid comprises M5, which has the following structure:

(2) The non-cationic lipid comprises 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) and cholesterol; and/or

(4) The PEG modified lipids comprise 1, 2-dimyristoyl-rac-glycerol-3-methoxypolyethylene glycol (DMG-PEG) 2000.

22. The vaccine of item 21, wherein the lipid particle comprises 10-70 mole% M5, 10-70 mole% 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 10-70 mole% cholesterol, and 0.05-20 mole% 1, 2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG) 2000;

preferably, the lipid particle comprises M5, 1, 2-dioleoyl-sn-glycero-3-phosphate ethanolamine (DOPE), cholesterol and 1, 2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG) 2000 in a molar ratio of 40:15:43.5:1.5,

23. the vaccine of any one of claims 1-22, which is a pharmaceutical composition, and optionally further comprising a pharmaceutically acceptable carrier.

24. A polynucleotide comprising or encoding any one of the RNAs as defined in any one of claims 1 to 13.

25. A composition comprising at least one polynucleotide of item 24.

26. The composition of item 25, comprising:

27. The composition of item 25, comprising:

(1) A first RNA comprising the nucleotide sequence of SEQ ID NO. 34;

(2) A second RNA comprising the nucleotide sequence of SEQ ID NO. 40;

(3) A third RNA comprising the nucleotide sequence of SEQ ID NO. 44; and

(4) And a fourth RNA comprising the nucleotide sequence of SEQ ID NO. 52.

28. The composition of clause 26 or 27, wherein the mass ratio of the first RNA, the second RNA, the third RNA, and the fourth RNA is 1:0.5-2:0.5-4:0.5-4; preferably, the mass ratio of the first RNA, the second RNA, the third RNA, and the fourth RNA is 1:1:1:1, 1:1:2:2, or 1:1:4:4; more preferably, the mass ratio of the first RNA, the second RNA, the third RNA, and the fourth RNA is 1:1:2:2.

29. Use of the vaccine of any one of items 1 to 23, the polynucleotide of item 24 or the composition of any one of items 25 to 28 in the manufacture of a medicament for the prophylaxis and/or treatment of influenza virus infection.

30. A vaccine according to any one of claims 1 to 23, a polynucleotide according to claim 24 or a composition according to any one of claims 25 to 28 for use in the prevention and/or treatment of influenza virus infection in a subject in need thereof.

31. A vaccine of any one of claims 1-23, a polynucleotide of claim 24, or a composition of any one of claims 25-28, for inducing an immune response against influenza virus in a subject in need thereof.

32. A method for inducing an immune response against influenza virus in a subject in need thereof, the method comprising administering to the subject an effective amount of the vaccine of any one of items 1-23, the polynucleotide of item 24, or the composition of any one of items 25-28.

33. A method for preventing and/or treating an influenza virus infection in a subject in need thereof, the method comprising administering to the subject an effective amount of the vaccine of any one of items 1-23, the polynucleotide of item 24, or the composition of any one of items 25-28.

Advantageous effects

The polynucleotides, compositions, vaccines, pharmaceutical compositions and methods of the present invention have at least one of the following beneficial effects:

(1) Providing higher levels of antigen expression;

(2) Inducing high levels and persistence of binding and neutralizing antibodies to influenza hemagglutinin in a subject;

(3) Inducing a high level of a cellular immune response, particularly a T cell mediated immune response, in a subject; and

(4) Inducing strong humoral and cellular immune responses at lower immune doses, e.g., compared to commercially available inactivated viral vaccines.

Examples

The invention is further described by reference to the following examples. It should be understood that these embodiments are by way of example only and are not limiting of the invention. The following materials and instruments are commercially available or prepared according to methods well known in the art. The following experiments were performed according to the manufacturer's instructions or according to methods and procedures well known in the art.

Materials and methods

Cells, proteins, antibodies and vaccines

HEK293 cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% FBS (Gibco), 100U/mL penicillin and 100mg/mL streptomycin (Gibco) at 37℃and 5% CO ₂ 。

Recombinant HA proteins were purchased from the state of sense perk and expressed in HEK293 cells or baculovirus-insect cells. HA proteins for ELISA assays include: influenuza A H1N1 (A/Victoria/2570/2019) Hemagglutinin/HA Protein (His-Tag) (40787-V08B) (abbreviated as "H1N1 HA"), influenuza A H3N2 (A/Cambodia/e 082660/2020) Hemagglutinin/HA Protein (His-Tag) (40789-V08H 1) (abbreviated as "H3N2 HA"), influenuza B (B/PHUKET/3073/2013) Hemagglutinin/HA Protein (His-Tag) (40498-V08B) (abbreviated as "B/Victoria HA") and Influenuza B (B/Washington/02/2019) Hemagglutinin/HA Protein (His-Tag) (40722-V08H) (abbreviated as "B/Yamagata HA").

Antibodies for western blotting include: mouse anti-influenza a virus H1N1HA monoclonal antibody (GTX 28262), rabbit anti-influenza a virus H3N2HA polyclonal antibody (GTX 127363) and rabbit anti-influenza b virus HA polyclonal antibody (GTX 128542), all purchased from GeneTex; and anti-mouse horseradish peroxidase (HRP) -conjugated antibodies and anti-rabbit horseradish peroxidase (HRP) -conjugated antibodies, both purchased from Abbkine.

Benchmark (Benchmark) vaccine: tetravalent split virus influenza vaccines were purchased from Walland biological vaccine Co., ltd (lot number: 202106B 008). The tetravalent vaccine contained 60 μg total hemagglutinin per dose (15 μg per strain hemagglutinin) from Influenza strains Influnza A H1N1 (A/Victoria/2570/2019), influnza A H3N2 (A/Cambodia/e 082660/2020), influnza B (B/PHUKET/3073/2013) and Influnza B (B/Washington/02/2019).

Detection of bound IgG antibodies

Four recombinant HA proteins (H1N 1HA, H3N2HA, B/Victoria HA and B/Yamagata HA) were diluted to 0.5. Mu.g/ml with 0.05M sodium carbonate buffer, respectively, and added to 96-well ELISA platesGreiner) was coated overnight at 4 ℃. The plates were washed with PBS-T (phosphate buffered saline+0.05% Tween-20) followed by blocking with 2% BSA (formulated in PBS-T) for 60 min at 37 ℃. A 2-fold serial dilution of mouse serum samples was added to the coated plates and incubated for 60 minutes at 37 ℃. The plates were then incubated with HRP conjugated secondary antibody for 60 minutes at 37 ℃. After washing the plates 3 times, TMB substrate (bi yun sky biotechnology) was added. After termination of the reaction, the Optical Density (OD) at 450 wavelengths was read using a microplate reader (BioTek). The reciprocal value of the highest dilution of the sample with absorbance value higher than 2.1 times negative control sample was determined as the final titer.

Hemagglutination inhibition (HAI) assay

Standard procedures were used to detect HAI titers in serum samples to assess the level of neutralizing antibodies in mouse immune serum that were able to inhibit hemagglutination due to binding of HA on the influenza virus surface to cell surface receptors. Briefly, serum was treated with receptor destroying enzymes (Denka-Seiken, tokyo, japan) to eliminate non-specific inhibitors, and then inactivated at 56℃for 30 minutes. The treated sera were serially diluted in 96-well hemagglutination plates at an initial dilution of 1:10, and inactivated Influenza virus Influenza A H1N1 (A/Victoria/2570/2019), influenza A H3N2 (A/Cambodia/e 0826360/2020), influenza B (B/PHUKET/3073/2013) or Influza B (B/Washington/02/2019 (British national institute of biological products (NIBSC)) (4 hemagglutination units/well) was added to the wells for 30 min.

ELISA spot (ELISPot) assay

IFN-. Gamma.ELISPot was used according to the manufacturer's instructions ^PLUS The mouse IFN-. Gamma.ELISPot.assay was performed using the kit (Mabtech). Briefly, plates were blocked in RPMI 1640 medium (supplemented with 10% fbs) and incubated for 30 min. Spleen cells were cultured at 3X 10 ⁵ Cells/well were plated and stimulated in vitro with HA protein (10. Mu.g/mL), phytohemagglutinin (PHA) + ionomycin (positive control) or RPMI 1640 medium alone (negative control), at 37 ℃,5% CO ₂ Incubate for 20 hours. After that, with biotinylated IFN-gamma-detecting antibody and streptavidin-alkaline phosphatase (ALP), BCIP/NBT-plus (5-bromo-4-chloro-3-indole-phosphate/nitro blue tetrazolium-plus) substrate was added for color development and counted with an ELISPOT reader (ImmunoSpot S6 Core Analyzer (CTL)).

Animal study

Female BALB/c mice were immunized with 100. Mu.L of mRNA-LPP vaccine or Benchmark vaccine (0.1 dose) on day 0 (D0) and day 14 (D14), respectively, by double-sided intramuscular injection for 6-8 weeks. All blood samples were collected by retroorbital blood sampling, about 200 μl blood/time, and centrifuged at 1,500g at 4 ℃ for 10 minutes for serum separation.

Statistical analysis

Statistical analysis of animal studies was performed using GraphPad Prism 8.0 software. Data are expressed as geometric mean ± SD or mean ± SEM. Two experimental groups were compared using a two-tailed T-test. For comparison of more than two experimental groups, one-way ANOVA was used. P values less than 0.05 are considered significant. * P <0.05; * P <0.01; * P <0.001.

Example 1 influenza virus hemagglutinin-based mRNA design and preparation

Based on the wild-type coding sequences of Hemagglutinin (HA) of four influenza strains, a codon-optimized DNA Open Reading Frame (ORF) sequence encoding the following HA proteins was designed: H1N1 (A/Victoria/2570/2019) HA (SEQ ID NO: 1), H3N2 (A/Cambodia/e 0826360/2020) HA (SEQ ID NO: 2), B/Washington/02/2019 (B/Victoria) HA (SEQ ID NO: 3) and B/PHUKET/3073/2013 (B/Yamagata) HA (SEQ ID NO: 4). The wild-type and optimized RNA ORF, DNA ORF sequences encoding these four HA proteins are summarized in table 1, where Ori represents the wild-type sequence and Opti represents the optimized sequence.

The wild-type or optimized DNA ORF sequence was then ligated with the T7 promoter sequence (SEQ ID NO: 30), the 5'UTR sequence (SEQ ID NO:31, which contains the Kozak sequence "GCCACC"), the 3' UTR sequence (SEQ ID NO: 32) and the poly (A) tail (SEQ ID NO: 33), respectively, and total gene synthesis (SU Jin Weizhi Biotechnology Co., ltd.) was performed using Puc57 as a vector to obtain a plasmid DNA template.

The DNA template was obtained by PCR amplification (Ai Ben Germany) using a pair of primers (upstream primer: 5'TTGGACCCTCGTACAGAAGCTAATACG 3'; and downstream poly (T) long primer: 5 'TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTACTTCCTACTCAGGCTTTATTCAAAGACCA') and a high-fidelity DNA polymerase-based PCR amplification kit (Bao Ri doctor materials technology (Beijing) Co., ltd.).

1.3 in vitro transcription of mRNA from DNA templates

The purified PCR product prepared in example 1.2 was used as a template for co-transcription capping reaction with T7RNA polymerase, and RNA was transcribed in vitro, thereby producing Cap1mRNA (FIG. 1A). 1-methyl-pseudouridine triphosphate was added in place of Uridine Triphosphate (UTP) in vitro transcription, so that the modification ratio of 1-methyl-pseudouracil in vitro transcribed Cap1mRNA was 100%. After transcription ends, the DNA template is digested with dnaseli (zernike feishi technologies limited) to reduce the risk of residual DNA template. mRNA was purified using DynabeadsMyone (Sesameimer Feiche technologies Co.). Purified mRNA was dissolved in 1 mM sodium citrate buffer (pH 6.5±0.1), sterile filtered, and cryopreserved at-80 ℃ until use.

TABLE 1

Note that: "-" means not shown. The mRNA sequences not shown differ from the mRNA sequences of SEQ ID NOS 34-54 in that the RNA ORF sequences in the mRNA sequences not shown are the RNA ORF sequences of SEQ ID NOS 10, 16, 21 and 29, respectively.

EXAMPLE 2 preparation of mRNA vaccine

Experimental materials

Cationic lipid M5 was synthesized by stoneley microorganisms.

DOPE and DSPC were purchased from CordenPharma; cholesterol was purchased from Sigma-Aldrich; mPEG2000-DMG (i.e., DMG-PEG 2000) was purchased at Avanti Polar Lipids, inc; PBS was purchased from Invitrogen; protamine sulfate was purchased from beijing-s-li-an pharmaceutical industry limited.

2.1 Preparation of mRNA-lipid nanoparticle (mRNA-LNP) formulation:

preparation of an aqueous mRNA solution: each mRNA prepared as in example 1 was diluted to 0.25mg/mL aqueous mRNA with 10mM citric acid-sodium citrate buffer (pH 4.0).

Preparation of lipid solution: m5: DSPC: cholesterol: DMG-PEG 2000 was dissolved in an alcohol solution at a molar ratio of 50:10:38.5:1.5 to prepare a lipid solution of 10 mg/mL.

Preparation of LNP: using microfluidic technology (Michain technologies Co., ltd., model: inano D), lipid solution and mRNA aqueous solution were mixed under the following conditions: volume=4.0 mL; flow rate ratio (Flow rate ratio) =1 (lipid solution): 3 (mRNA aqueous solution), total Flow rate (Total Flow rate) =12 mL/min, mRNA-LNP solution was obtained.

Centrifugal ultrafiltration: the mRNA-LNP solution was added to an ultrafilter tube and subjected to centrifugal ultrafiltration concentration (rotation speed 3000rpm, centrifugation time 60min, temperature 4 ℃ C.) to obtain an mRNA-LNP preparation.

2.2 Preparation of mRNA-lipid multimeric complex (mRNA-LPP) preparation:

preparation of an aqueous mRNA solution: each mRNA prepared as in example 1 was diluted to 0.2mg/mL aqueous mRNA with 10mM citric acid-sodium citrate buffer (pH 4.0).

Preparation of lipid solution: m5: DOPE: cholesterol: DMG-PEG 2000 was dissolved in absolute ethanol at a molar ratio of 40:15:43.5:1.5 to prepare a 10mg/mL lipid solution.

Preparing a protamine sulfate solution: the protamine sulfate is dissolved in water without the nucleotidase to prepare the protamine sulfate solution with the working concentration of 0.25 mg/mL.

Preparation of core nanoparticle (core nanoparticle) solution: using microfluidic technology, a solution of protamine sulfate was mixed with a solution of mRNA under the following conditions to obtain a solution of nuclear nanoparticles formed from protamine and mRNA: volume=4.0 mL; flow rate ratio=5 (mRNA): 1 (protamine solution), total Flow rate=12 mL/min, front waste (start waste) =0.35 mL, rear waste (end waste) =0.1 mL, room temperature.

Preparation of LPP: the core nanoparticle solution was secondarily mixed with the lipid solution under the following conditions: volume= 4.0mL,Flow rate ratio =1 (lipid solution) 3 (core nanoparticle solution), total flow rate=12 mL/min, front waste=0.35 mL, back waste=0.1 mL, room temperature, diluted with PBS solution to obtain mRNA-LPP solution.

Centrifugal ultrafiltration: the mRNA-LPP solution was subjected to ultrafiltration centrifugation to remove ethanol (rotation speed 3000rpm, centrifugation time 60min, temperature 4 ℃) and obtain mRNA-LPP preparation.

Example 3 in vitro characterization of candidate mRNA-LPP vaccine

Day before transfection HEK293 cells were grown at 1.0X10 ⁶ Cells/well were seeded into 6-well plates. The next day, HA mRNA-LPP (2.5. Mu.g mRNA) prepared as in example 2.2 was added to the cells and incubated Incubation was carried out for 24 hours. Subsequently, cells transfected with mRNA-LPP were lysed with 1 XSDS-PAGE loading buffer (Beyotime) followed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot analysis. GAPDH was detected as a loading control using a mouse anti-GAPDH monoclonal antibody (Cell Signaling Technology). After development using High-sig ECL western blotting substrate (tan), scanning was performed on ECL imager (Azure) and analysis was performed using Image Lab software 6.0.

As shown in FIG. 1B, mRNA-LPP was able to successfully express the corresponding HA antigen. Compared with the non-optimized mRNA-LPP, the protein expression level of the optimized mRNA-LPP is obviously improved.

Example 4 in vivo screening of candidate mRNA-LPP vaccines

BALB/c mice (n=5) were vaccinated by intramuscular (i.m.) injection of one dose of mRNA-LPP vaccine (5 μg mRNA/dose) or Benchmark vaccine (0.1 dose) on day 0 (D0, priming) and day 14 (D14, boosting), respectively, by a "prime-boost" strategy (fig. 2A). Immune sera from mice were collected on day 14 (D14) and day 28 (D28) and assayed for HA-specific binding antibody titers (binding IgG titers) by ELISA assay, the results are shown in figure 2B.

As shown in fig. 2B, the optimized mRNA-LPP vaccine resulted in higher levels of bound antibodies than the wild-type mRNA-LPP vaccine as a whole. On day 14, primary immunization of the mRNA-LPP vaccine induced detectable HA-specific binding to IgG antibodies. On day 28, booster immunization further enhanced IgG titers. Wherein, on day 28, the Opti 1-LPP (H1N 1), opti 2-LPP (H3N 2), opti 1-LPP (B/Victoria) and Opti 5-LPP (B/Yamagata) groups induced significantly higher levels of bound antibodies than the other groups, the Geometric Mean Titers (GMT) reached 194012, 97006, 222861 and 168897, respectively.

In summary, opti 1-LPP (H1N 1), opti 2-LPP (H3N 2), opti 1-LPP (B/Victoria) and Opti 5-LPP (B/Yamagata) were selected as candidate vaccines for each influenza strain, respectively.

EXAMPLE 5 immunogenicity evaluation of candidate mRNA-LPP vaccine

Further, candidate mRNA-LPP vaccines were evaluated for immunogenicity in vivo. BALB/c mice (n=6) were vaccinated by intramuscular (i.m.) injection of one dose of mRNA-LPP vaccine (0.5 μg mRNA/dose) or Benchmark vaccine (0.1 dose) on day 0 (D0, priming) and day 14 (D14, boosting), respectively, by a "prime-boost" strategy (fig. 3A). Immune sera from mice were collected on day 28 (D28), assayed for HA-specific binding antibody titer (binding IgG titer) by ELISA assay and for neutralizing antibody titer by and HAI assay, the results are shown in fig. 3B and 3C, respectively. Spleen cells from mice were collected on day 35 (D35) and analyzed for frequency of IFN-gamma secreting T cells by ELISPot assay, the results are shown in FIG. 3D.

As shown in FIG. 3B, on day 28, the Opti 1-LPP (H1N 1), opti 2-LPP (H3N 2), opti 1-LPP (B/Victoria) and Opti 5-LPP (B/Yamagata) induced conjugated IgG GMTs were 51200, 45614, 22807 and 10159, respectively. The fold increases in the levels of Opti 1-LPP (H1N 1), opti 2-LPP (H3N 2), opti 1-LPP (B/Victoria) and Opti 5-LPP (B/Yamagata) induced binding antibodies against the corresponding HA proteins (H1N 1HA, H3N2HA, B/Victoria HA or B/Yamagata HA) were 9.0, 8.0, 7.1 and 2.2, respectively, as opposed to binding antibodies induced by the Benchmark vaccine.

As shown in FIG. 3C, on day 28, the Opti 1-LPP (H1N 1), opti 2-LPP (H3N 2), opti 1-LPP (B/Victoria) and Opti 5-LPP (B/Yamagata) induced HAI titers were 101, 718, 101 and 285, respectively. The doubling numbers of the Opti 1-LPP (H1N 1), opti 2-LPP (H3N 2), opti 1-LPP (B/Victoria) and Opti 5-LPP (B/Yamagata) induced HAI titers compared to the corresponding inactivated influenza virus strains (H1N 1, H3N2, B/Victoria or B/Yamagata) induced by the Benchmark vaccine were 3.9, 9.0, 1.0 and 2.7, respectively.

Further, the cellular immune response induced by the four candidate mRNA-LPP vaccines was characterized by ELISpot assay. On day 35, spleen cells of immunized mice were stimulated with the corresponding HA protein (H1N 1HA, H3N2HA, B/Victoria HA or B/Yamagata HA) of each mRNA-LPP vaccine and examined for IFN-gamma secreting T cells. As shown in FIG. 3D, the frequency of IFN-gamma secreting T cells induced by Opti 1-LPP (H1N 1), opti 2-LPP (H3N 2), opti 1-LPP (B/Victoria) and Opti 5-LPP (B/Yamagata) vaccines (per 10) ⁶ 269, 104, 204 and 348 out of individual splenocytesSpot Forming Cells (SFC)) were significantly higher than the Benchmark seedlings (every 10 in response to stimulation with H1N1HA, H3N2HA, B/Victoria HA and B/Yamagata HA ⁶ There were 28, 4, 12 and 38 SFCs in each spleen cell).

Taken together, all four candidate mRNA-LPP vaccines induced significant humoral and cellular responses in mice.

Example 6 characterization of antibody persistence

The persistence of antibodies induced by the mRNA-LPP vaccine was studied, as represented by the Opti 1-LPP (H1N 1) vaccine. BALB/c mice (n=5) were vaccinated by intramuscular (i.m.) injection of one dose of Opti 1-LPP (H1N 1) vaccine (5 μg mRNA/dose) or Benchmark vaccine (0.1 dose) on day 0 (D0, priming) and day 14 (D14, boosting), respectively, by a "prime-boost" strategy (fig. 4A). Immune sera from mice were collected on days 14 (D14), 28 (D28), 49 (D49), 90 (D90) and 120 (D120), and HA-specific binding antibody titers (binding IgG titers) were analyzed by ELISA assays, and the results are shown in fig. 4B.

As shown in fig. 4B, opti 1-LPP (H1N 1) vaccine induced binding antibody titers reaching 2111, 222861, 97006, 111430 and 128000 on days 14, 28, 49, 90 and 120, respectively. In contrast, the Benchmark vaccine induced binding antibody titers reached 185, 3715, 5443, 8000 and 8574 on days 14, 28, 49, 90 and 120, respectively. The results show that the antibody levels induced by the Opti 1-LPP (H1N 1) vaccine were significantly higher at each time point than the Benchmark vaccine. Overall, the levels of antibodies induced by Opti 1-LPP (H1N 1) vaccine were maintained in mice for at least 3 months. Although the antibody levels were slightly decreased at day 120, the Opti 1-LPP (H1N 1) vaccine induced antibody titers were still more than 10-fold higher than the Benchmark vaccine.

EXAMPLE 7 immunogenicity evaluation of tetravalent mRNA-LPP influenza vaccine

mRNA Opti 1 (H1N 1), opti 2 (H3N 2), opti 1 (B/Victoria) and Opti 5 (B/Yamagata) were pre-mixed in a ratio of 1:1:1:1, 1:1:2:2 or 1:1:4:4 (mass ratio of mRNA) and encapsulated into LPP nanoparticles to form tetravalent mRNA-LPP vaccine. See example 2 for specific methods.

BALB/c mice (n=8) were immunized by intramuscular (i.m.) injection of a dose of tetravalent mRNA-LPP vaccine or Benchmark vaccine (0.1 dose) on day 0 (D0, priming) and day 14 (D14, boosting), respectively, by a "prime-boost" strategy (fig. 5A). For a 1:1:1:1 tetravalent mRNA-LPP vaccine, each dose contained 2 μg total mRNA. For a tetravalent mRNA-LPP vaccine of 1:1:2:2, each dose contained 3 μg of total mRNA. For a 1:1:4:4 tetravalent mRNA-LPP vaccine, each dose contained 5 μg total mRNA. The immune serum of the mice was collected on day 28 (D28), and HA-specific binding antibody titer (binding IgG titer) was analyzed by ELISA assay, and the results are shown in fig. 5B. Spleen cells from mice were collected on day 35 (D35), and analyzed for frequency of IFN-gamma secreting T cells by ELISPot assay, the results are shown in FIG. 5C.

As shown in fig. 5B, on day 28, all tetravalent mRNA-LPP vaccines induced HA-specific binding antibody titers that were higher than the Benchmark vaccine. In general, with increasing proportion of hemagglutinin mRNA of strain b in tetravalent mRNA-LPP vaccine, the bound antibody titer against hemagglutinin of strain b showed a tendency to increase, whereas the bound antibody titer against hemagglutinin of strain a showed a tendency to decrease.

On day 35, the cellular immune response induced by tetravalent mRNA-LPP influenza vaccine was further characterized by ELISpot assay. Spleen cells of immunized mice were stimulated with the corresponding HA protein of each mRNA-LPP vaccine and T cells secreting IFN- γ were detected. As shown in fig. 5C, all tetravalent mRNA-LPP vaccines induced significantly stronger HA-specific T cell responses than the Benchmark vaccine. Wherein, the tetravalent mRNA-LPP vaccine of 1:1:2:2 is superior to other tetravalent mRNA-LPP vaccines in terms of T cell response.

The above data indicate that tetravalent mRNA-LPP influenza vaccine induces strong immunogenicity in mice. And the tetravalent mRNA-LPP influenza vaccine with the mass ratio of mRNA of Opti 1 (H1N 1), opti 2 (H3N 2), opti 1 (B/Victoria) and Opti 5 (B/Yamagata) of 1:1:2:2 induces relatively better immune response.

While the invention has been described with respect to the preferred embodiments, it will be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention, and it is intended that the scope of the invention be limited only by the claims.

Sequence listing

/>

Sequence listing

<110> Siro (Shanghai) Biotech Co., ltd

<120> influenza vaccine

<130> I2022TC6909CS

<160> 79

<170> PatentIn version 3.5

<210> 1

<211> 566

<212> PRT

<213> Influenza A virus

<400> 1

Met Lys Ala Ile Leu Val Val Met Leu Tyr Thr Phe Thr Thr Ala Asn

1 5 10 15

Ala Asp Thr Leu Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Asp Thr

20 25 30

Val Asp Thr Val Leu Glu Lys Asn Val Thr Val Thr His Ser Val Asn

35 40 45

Leu Leu Glu Asp Lys His Asn Gly Lys Leu Cys Lys Leu Arg Gly Val

50 55 60

Ala Pro Leu His Leu Gly Lys Cys Asn Ile Ala Gly Trp Ile Leu Gly

65 70 75 80

Asn Pro Glu Cys Glu Ser Leu Ser Thr Ala Arg Ser Trp Ser Tyr Ile

85 90 95

Val Glu Thr Ser Asn Ser Asp Asn Gly Thr Cys Tyr Pro Gly Asp Phe

100 105 110

Ile Asn Tyr Glu Glu Leu Arg Glu Gln Leu Ser Ser Val Ser Ser Phe

115 120 125

Glu Arg Phe Glu Ile Phe Pro Lys Thr Ser Ser Trp Pro Asn His Asp

130 135 140

Ser Asp Asn Gly Val Thr Ala Ala Cys Pro His Ala Gly Ala Lys Ser

145 150 155 160

Phe Tyr Lys Asn Leu Ile Trp Leu Val Lys Lys Gly Lys Ser Tyr Pro

165 170 175

Lys Ile Asn Gln Thr Tyr Ile Asn Asp Lys Gly Lys Glu Val Leu Val

180 185 190

Leu Trp Gly Ile His His Pro Pro Thr Ile Ala Asp Gln Gln Ser Leu

195 200 205

Tyr Gln Asn Ala Asp Ala Tyr Val Phe Val Gly Thr Ser Arg Tyr Ser

210 215 220

Lys Lys Phe Lys Pro Glu Ile Ala Thr Arg Pro Lys Val Arg Asp Arg

225 230 235 240

Glu Gly Arg Met Asn Tyr Tyr Trp Thr Leu Val Glu Pro Gly Asp Lys

245 250 255

Ile Thr Phe Glu Ala Thr Gly Asn Leu Val Ala Pro Arg Tyr Ala Phe

260 265 270

Thr Met Glu Arg Asp Ala Gly Ser Gly Ile Ile Ile Ser Asp Thr Pro

275 280 285

Val His Asp Cys Asn Thr Thr Cys Gln Thr Pro Glu Gly Ala Ile Asn

290 295 300

Thr Ser Leu Pro Phe Gln Asn Val His Pro Ile Thr Ile Gly Lys Cys

305 310 315 320

Pro Lys Tyr Val Lys Ser Thr Lys Leu Arg Leu Ala Thr Gly Leu Arg

325 330 335

Asn Val Pro Ser Ile Gln Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly

340 345 350

Phe Ile Glu Gly Gly Trp Thr Gly Met Val Asp Gly Trp Tyr Gly Tyr

355 360 365

His His Gln Asn Glu Gln Gly Ser Gly Tyr Ala Ala Asp Leu Lys Ser

370 375 380

Thr Gln Asn Ala Ile Asp Lys Ile Thr Asn Lys Val Asn Ser Val Ile

385 390 395 400

Glu Lys Met Asn Thr Gln Phe Thr Ala Val Gly Lys Glu Phe Asn His

405 410 415

Leu Glu Lys Arg Ile Glu Asn Leu Asn Lys Lys Val Asp Asp Gly Phe

420 425 430

Leu Asp Ile Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Leu Glu Asn

435 440 445

Glu Arg Thr Leu Asp Tyr His Asp Ser Asn Val Lys Asn Leu Tyr Glu

450 455 460

Lys Val Arg Asn Gln Leu Lys Asn Asn Ala Lys Glu Ile Gly Asn Gly

465 470 475 480

Cys Phe Glu Phe Tyr His Lys Cys Asp Asn Thr Cys Met Glu Ser Val

485 490 495

Lys Asn Gly Thr Tyr Asp Tyr Pro Lys Tyr Ser Glu Glu Ala Lys Leu

500 505 510

Asn Arg Glu Lys Ile Asp Gly Val Lys Leu Asp Ser Thr Arg Ile Tyr

515 520 525

Gln Ile Leu Ala Ile Tyr Ser Thr Val Ala Ser Ser Leu Val Leu Val

530 535 540

Val Ser Leu Gly Ala Ile Ser Phe Trp Met Cys Ser Asn Gly Ser Leu

545 550 555 560

Gln Cys Arg Ile Cys Ile

565

<210> 2

<211> 566

<212> PRT

<213> Influenza A virus

<400> 2

Met Lys Thr Ile Ile Ala Leu Ser Tyr Ile Leu Cys Leu Val Phe Ala

1 5 10 15

Gln Lys Ile Pro Gly Asn Asp Asn Ser Thr Ala Thr Leu Cys Leu Gly

20 25 30

His His Ala Val Pro Asn Gly Thr Ile Val Lys Thr Ile Thr Asn Asp

35 40 45

Arg Ile Glu Val Thr Asn Ala Thr Glu Leu Val Gln Asn Ser Ser Ile

50 55 60

Gly Glu Ile Cys Asp Ser Pro His Gln Ile Leu Asp Gly Gly Asn Cys

65 70 75 80

Thr Leu Ile Asp Ala Leu Leu Gly Asp Pro Gln Cys Asp Gly Phe Gln

85 90 95

Asn Lys Glu Trp Asp Leu Phe Val Glu Arg Ser Arg Ala Asn Ser Asn

100 105 110

Cys Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Ser Leu Arg Ser Leu Val

115 120 125

Ala Ser Ser Gly Thr Leu Glu Phe Lys Asn Glu Ser Phe Asn Trp Thr

130 135 140

Gly Val Lys Gln Asn Gly Thr Ser Ser Ala Cys Ile Arg Gly Ser Ser

145 150 155 160

Ser Ser Phe Phe Ser Arg Leu Asn Trp Leu Thr His Leu Asn Tyr Lys

165 170 175

Tyr Pro Ala Leu Asn Val Thr Met Pro Asn Asn Glu Gln Phe Asp Lys

180 185 190

Leu Tyr Ile Trp Gly Val His His Pro Arg Thr Asp Lys Asp Gln Ile

195 200 205

Ser Leu Phe Ala Gln Pro Ser Gly Arg Ile Thr Val Ser Thr Lys Arg

210 215 220

Ser Gln Gln Ala Val Ile Pro Asn Ile Gly Ser Arg Pro Arg Ile Arg

225 230 235 240

Asp Ile Pro Ser Arg Ile Ser Ile Tyr Trp Thr Ile Val Lys Pro Gly

245 250 255

Asp Ile Leu Leu Ile Asn Ser Thr Gly Asn Leu Ile Ala Pro Arg Gly

260 265 270

Tyr Phe Lys Ile Arg Ser Gly Lys Ser Ser Ile Met Arg Ser Asp Ala

275 280 285

Pro Ile Gly Lys Cys Lys Ser Glu Cys Ile Thr Pro Asn Gly Ser Ile

290 295 300

Pro Asn Asp Lys Pro Phe Gln Asn Val Asn Arg Ile Thr Tyr Gly Ala

305 310 315 320

Cys Pro Arg Tyr Val Lys Gln Ser Thr Leu Lys Leu Ala Thr Gly Met

325 330 335

Arg Asn Val Pro Glu Lys Gln Thr Arg Gly Ile Phe Gly Ala Ile Ala

340 345 350

Gly Phe Ile Glu Asn Gly Trp Glu Gly Met Val Asp Gly Trp Tyr Gly

355 360 365

Phe Arg His Gln Asn Ser Glu Gly Arg Gly Gln Ala Ala Asp Leu Lys

370 375 380

Ser Thr Gln Ala Ala Ile Asp Gln Ile Asn Gly Lys Leu Asn Arg Leu

385 390 395 400

Ile Gly Lys Thr Asn Glu Lys Phe His Gln Ile Glu Lys Glu Phe Ser

405 410 415

Glu Val Glu Gly Arg Val Gln Asp Leu Glu Lys Tyr Val Glu Asp Thr

420 425 430

Lys Ile Asp Leu Trp Ser Tyr Asn Ala Glu Leu Leu Val Ala Leu Glu

435 440 445

Asn Gln His Thr Ile Asp Leu Thr Asp Ser Glu Met Asn Lys Leu Phe

450 455 460

Glu Lys Thr Lys Lys Gln Leu Arg Glu Asn Ala Glu Asp Met Gly Asn

465 470 475 480

Gly Cys Phe Lys Ile Tyr His Lys Cys Asp Asn Ala Cys Ile Gly Ser

485 490 495

Ile Arg Asn Glu Thr Tyr Asp His Asn Val Tyr Arg Asp Glu Ala Leu

500 505 510

Asn Asn Arg Phe Gln Ile Lys Gly Val Glu Leu Lys Ser Gly Tyr Lys

515 520 525

Asp Trp Ile Leu Trp Ile Ser Phe Ala Met Ser Cys Phe Leu Leu Cys

530 535 540

Ile Ala Leu Leu Gly Phe Ile Met Trp Ala Cys Gln Lys Gly Asn Ile

545 550 555 560

Arg Cys Asn Ile Cys Ile

565

<210> 3

<211> 582

<212> PRT

<213> Influenza B virus

<400> 3

Met Lys Ala Ile Ile Val Leu Leu Met Val Val Thr Ser Asn Ala Asp

1 5 10 15

Arg Ile Cys Thr Gly Ile Thr Ser Ser Asn Ser Pro His Val Val Lys

20 25 30

Thr Ala Thr Gln Gly Glu Val Asn Val Thr Gly Val Ile Pro Leu Thr

35 40 45

Thr Thr Pro Thr Lys Ser His Phe Ala Asn Leu Lys Gly Thr Glu Thr

50 55 60

Arg Gly Lys Leu Cys Pro Lys Cys Leu Asn Cys Thr Asp Leu Asp Val

65 70 75 80

Ala Leu Gly Arg Pro Lys Cys Thr Gly Lys Ile Pro Ser Ala Arg Val

85 90 95

Ser Ile Leu His Glu Val Arg Pro Val Thr Ser Gly Cys Phe Pro Ile

100 105 110

Met His Asp Arg Thr Lys Ile Arg Gln Leu Pro Asn Leu Leu Arg Gly

115 120 125

Tyr Glu His Val Arg Leu Ser Thr His Asn Val Ile Asn Ala Glu Asp

130 135 140

Ala Pro Gly Arg Pro Tyr Glu Ile Gly Thr Ser Gly Ser Cys Pro Asn

145 150 155 160

Ile Thr Asn Gly Asn Gly Phe Phe Ala Thr Met Ala Trp Ala Val Pro

165 170 175

Lys Asn Lys Thr Ala Thr Asn Pro Leu Thr Ile Glu Val Pro Tyr Ile

180 185 190

Cys Thr Glu Gly Glu Asp Gln Ile Thr Val Trp Gly Phe His Ser Asp

195 200 205

Ser Glu Thr Gln Met Ala Lys Leu Tyr Gly Asp Ser Lys Pro Gln Lys

210 215 220

Phe Thr Ser Ser Ala Asn Gly Val Thr Thr His Tyr Val Ser Gln Ile

225 230 235 240

Gly Gly Phe Pro Asn Gln Thr Glu Asp Gly Gly Leu Pro Gln Ser Gly

245 250 255

Arg Ile Val Val Asp Tyr Met Val Gln Lys Ser Gly Lys Thr Gly Thr

260 265 270

Ile Thr Tyr Gln Arg Gly Ile Leu Leu Pro Gln Lys Val Trp Cys Ala

275 280 285

Ser Gly Arg Ser Lys Val Ile Lys Gly Ser Leu Pro Leu Ile Gly Glu

290 295 300

Ala Asp Cys Leu His Glu Lys Tyr Gly Gly Leu Asn Lys Ser Lys Pro

305 310 315 320

Tyr Tyr Thr Gly Glu His Ala Lys Ala Ile Gly Asn Cys Pro Ile Trp

325 330 335

Val Lys Thr Pro Leu Lys Leu Ala Asn Gly Thr Lys Tyr Arg Pro Pro

340 345 350

Ala Lys Leu Leu Lys Glu Arg Gly Phe Phe Gly Ala Ile Ala Gly Phe

355 360 365

Leu Glu Gly Gly Trp Glu Gly Met Ile Ala Gly Trp His Gly Tyr Thr

370 375 380

Ser His Gly Ala His Gly Val Ala Val Ala Ala Asp Leu Lys Ser Thr

385 390 395 400

Gln Glu Ala Ile Asn Lys Ile Thr Lys Asn Leu Asn Ser Leu Ser Glu

405 410 415

Leu Glu Val Lys Asn Leu Gln Arg Leu Ser Gly Ala Met Asp Glu Leu

420 425 430

His Asn Glu Ile Leu Glu Leu Asp Glu Lys Val Asp Asp Leu Arg Ala

435 440 445

Asp Thr Ile Ser Ser Gln Ile Glu Leu Ala Val Leu Leu Ser Asn Glu

450 455 460

Gly Ile Ile Asn Ser Glu Asp Glu His Leu Leu Ala Leu Glu Arg Lys

465 470 475 480

Leu Lys Lys Met Leu Gly Pro Ser Ala Val Glu Ile Gly Asn Gly Cys

485 490 495

Phe Glu Thr Lys His Lys Cys Asn Gln Thr Cys Leu Asp Arg Ile Ala

500 505 510

Ala Gly Thr Phe Asp Ala Gly Glu Phe Ser Leu Pro Thr Phe Asp Ser

515 520 525

Leu Asn Ile Thr Ala Ala Ser Leu Asn Asp Asp Gly Leu Asp Asn His

530 535 540

Thr Ile Leu Leu Tyr Tyr Ser Thr Ala Ala Ser Ser Leu Ala Val Thr

545 550 555 560

Leu Met Ile Ala Ile Phe Val Val Tyr Met Val Ser Arg Asp Asn Val

565 570 575

Ser Cys Ser Ile Cys Leu

580

<210> 4

<211> 584

<212> PRT

<213> Influenza B virus

<400> 4

Met Lys Ala Ile Ile Val Leu Leu Met Val Val Thr Ser Asn Ala Asp

1 5 10 15

Arg Ile Cys Thr Gly Ile Thr Ser Ser Asn Ser Pro His Val Val Lys

20 25 30

Thr Ala Thr Gln Gly Glu Val Asn Val Thr Gly Val Ile Pro Leu Thr

35 40 45

Thr Thr Pro Thr Lys Ser Tyr Phe Ala Asn Leu Lys Gly Thr Arg Thr

50 55 60

Arg Gly Lys Leu Cys Pro Asp Cys Leu Asn Cys Thr Asp Leu Asp Val

65 70 75 80

Ala Leu Gly Arg Pro Met Cys Val Gly Thr Thr Pro Ser Ala Lys Ala

85 90 95

Ser Ile Leu His Glu Val Arg Pro Val Thr Ser Gly Cys Phe Pro Ile

100 105 110

Met His Asp Arg Thr Lys Ile Arg Gln Leu Pro Asn Leu Leu Arg Gly

115 120 125

Tyr Glu Lys Ile Arg Leu Ser Thr Gln Asn Val Ile Asp Ala Glu Lys

130 135 140

Ala Pro Gly Gly Pro Tyr Arg Leu Gly Thr Ser Gly Ser Cys Pro Asn

145 150 155 160

Ala Thr Ser Lys Ile Gly Phe Phe Ala Thr Met Ala Trp Ala Val Pro

165 170 175

Lys Asp Asn Tyr Lys Asn Ala Thr Asn Pro Leu Thr Val Glu Val Pro

180 185 190

Tyr Ile Cys Thr Glu Gly Glu Asp Gln Ile Thr Val Trp Gly Phe His

195 200 205

Ser Asp Asp Lys Thr Gln Met Lys Ser Leu Tyr Gly Asp Ser Asn Pro

210 215 220

Gln Lys Phe Thr Ser Ser Ala Asn Gly Val Thr Thr His Tyr Val Ser

225 230 235 240

Gln Ile Gly Asp Phe Pro Asp Gln Thr Glu Asp Gly Gly Leu Pro Gln

245 250 255

Ser Gly Arg Ile Val Val Asp Tyr Met Met Gln Lys Pro Gly Lys Thr

260 265 270

Gly Thr Ile Val Tyr Gln Arg Gly Val Leu Leu Pro Gln Lys Val Trp

275 280 285

Cys Ala Ser Gly Arg Ser Lys Val Ile Lys Gly Ser Leu Pro Leu Ile

290 295 300

Gly Glu Ala Asp Cys Leu His Glu Glu Tyr Gly Gly Leu Asn Lys Ser

305 310 315 320

Lys Pro Tyr Tyr Thr Gly Lys His Ala Lys Ala Ile Gly Asn Cys Pro

325 330 335

Ile Trp Val Lys Thr Pro Leu Lys Leu Ala Asn Gly Thr Lys Tyr Arg

340 345 350

Pro Pro Ala Lys Leu Leu Lys Glu Arg Gly Phe Phe Gly Ala Ile Ala

355 360 365

Gly Phe Leu Glu Gly Gly Trp Glu Gly Met Ile Ala Gly Trp His Gly

370 375 380

Tyr Thr Ser His Gly Ala His Gly Val Ala Val Ala Ala Asp Leu Lys

385 390 395 400

Ser Thr Gln Glu Ala Ile Asn Lys Ile Thr Lys Asn Leu Asn Ser Leu

405 410 415

Ser Glu Leu Glu Val Lys Asn Leu Gln Arg Leu Ser Gly Ala Met Asp

420 425 430

Glu Leu His Asn Glu Ile Leu Glu Leu Asp Glu Lys Val Asp Asp Leu

435 440 445

Arg Ala Asp Thr Ile Ser Ser Gln Ile Glu Leu Ala Val Leu Leu Ser

450 455 460

Asn Glu Gly Ile Ile Asn Ser Glu Asp Glu His Leu Leu Ala Leu Glu

465 470 475 480

Arg Lys Leu Lys Lys Met Leu Gly Pro Ser Ala Val Asp Ile Gly Asn

485 490 495

Gly Cys Phe Glu Thr Lys His Lys Cys Asn Gln Thr Cys Leu Asp Arg

500 505 510

Ile Ala Ala Gly Thr Phe Asn Ala Gly Glu Phe Ser Leu Pro Thr Phe

515 520 525

Asp Ser Leu Asn Ile Thr Ala Ala Ser Leu Asn Asp Asp Gly Leu Asp

530 535 540

Asn His Thr Ile Leu Leu Tyr Tyr Ser Thr Ala Ala Ser Ser Leu Ala

545 550 555 560

Val Thr Leu Met Leu Ala Ile Phe Ile Val Tyr Met Val Ser Arg Asp

565 570 575

Asn Val Ser Cys Ser Ile Cys Leu

580

<210> 5

<211> 1701

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 1 (H1N1) RNA ORF

<400> 5

augaaagcaa uauuaguggu gaugcuguac accuucacca cagccaaugc cgacacccug 60

ugcauuggcu accacgccaa caacagcacc gacacugugg acaccgugcu ggagaagaau 120

gugaccguga cccacagcgu gaaccugcug gaggacaagc acaauggcaa gcugugcaag 180

cugcgggggg uggccccacu gcaccugggc aagugcaaca ucgccggcug gauucugggc 240

aacccagagu gcgagagccu gagcacugcc cggagcuggu ccuacaucgu ggagaccagc 300

aacagcgaca acggcaccug cuaccccggg gacuucauca acuacgagga gcugagggag 360

cagcugagcu ccgugagcuc cuucgagagg uucgagaucu uccccaagac cagcucuugg 420

cccaaccacg acagcgacaa cggcgugacc gccgccugcc cucacgccgg ggccaagagc 480

uucuacaaga accugaucug gcuggugaag aaggggaaaa gcuaccccaa gaucaaccag 540

accuacauca acgacaaagg aaaagaagug uuagugcugu ggggcauaca ccacccuccc 600

accaucgccg accagcaguc ccuguaccag aaugcugaug ccuacguguu cgugggcacc 660

agcagguaca gcaagaaguu caagcccgag aucgccaccc ggcccaaggu gcgggaccgg 720

gagggccgga ugaacuacua cuggacccug guggagcccg gggacaagau caccuucgag 780

gccaccggca accugguggc cccccgguac gccuucacca uggagagaga ugccggcagc 840

ggcaucauca ucuccgacac ccccgugcac gacugcaaca ccacuugcca gaccccugag 900

ggggccauca acaccucucu gcccuuccag aaugugcacc ccaucaccau cggcaagugc 960

cccaaguacg ugaaguccac caagcugagg cuggccaccg gccugcggaa cgugcccagc 1020

auccagagcc ggggccuguu cggcgccauc gccggcuuca ucgagggcgg cuggaccggc 1080

augguggacg gcugguacgg cuaccaccac cagaaugagc agggguccgg cuacgccgcc 1140

gaucugaagu ccacccagaa cgccaucgac aagaucacca acaaggugaa cuccgugauc 1200

gagaagauga acacccaguu caccgccgug ggcaaggagu ucaaucaucu ggagaagcgg 1260

aucgagaacc ugaacaagaa gguggacgau ggcuuucugg acaucuggac uuacaaugcc 1320

gagcugcugg ugcugcugga gaacgagcgg acacuggacu aucacgacag caacgugaag 1380

aaucuguacg agaaggugcg gaaccagcug aagaacaaug ccaaggagau uggcaacggc 1440

ugcuucgagu ucuaccacaa gugugacaac acuugcaugg agagcgugaa gaacggcacc 1500

uacgacuacc ccaaguacag cgaggaggcc aagcugaacc gggagaagau cgacggcgug 1560

aagcuggacu ccaccaggau cuaccagauc cuggccaucu acagcaccgu ggccagcagc 1620

cuggugcugg uggugucccu gggcgccauc ucauucugga ugugcagcaa cgggucccug 1680

cagugucgga ucuguaucug a 1701

<210> 6

<211> 1701

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 2 (H1N1) RNA ORF

<400> 6

augaaagcaa uacucguggu gaugcuguac accuucacca cugcaaaugc cgacacucug 60

ugcauuggcu accacgccaa uaacagcaca gacacugugg acacgguccu ggagaagaac 120

gugaccguga cccacagugu gaaccugcug gaggacaagc acaacggaaa gcugugcaag 180

cugagaggag uugccccccu ccaccugggg aagugcaaca ucgccgggug gauccugggc 240

aaccccgagu gugagagccu gagcaccgcc aggagcuggu ccuacaucgu ggagaccagc 300

aauucugaua augggaccug cuaccccggc gauuucauca acuacgagga gcugagggag 360

cagcugagcu ccgucagcuc cuucgagcgc uucgagaucu uccccaagac cagcucuugg 420

cccaaccaug acagcgacaa cggcgugacc gccgcuuguc cucaugccgg ggccaagagc 480

uucuacaaga accugaucug gcuggugaag aaggggaaaa gcuaccccaa gaucaaccag 540

accuacauca acgacaaggg gaaggaggug cucgugcugu gggggauaca ccacccuccc 600

acaaucgccg accagcaguc ccuguaucag aaugcugaug ccuacguguu cgugggcacc 660

agcagguaca guaagaaguu caagccugag aucgcgaccc gccccaaggu gcgggaucgc 720

gagggcagga ugaacuauua cuggacccug guggagccag gcgacaagau cacauucgag 780

gccaccggca accugguggc cccccgguac gccuucacca uggagcgcga ugccgggucu 840

gggaucauca ucucagacac acccgugcac gacuguaaca ccaccugcca gaccccugag 900

ggggcaauca acaccagccu gcccuuucag aaugugcauc ccaucaccau ugggaagugu 960

cccaaguacg ugaaaagcac aaagcucagg cuggccaccg gccugaggaa cgugcccuca 1020

auccagagcc ggggccuguu cggggccauc gccggcuuca uugagggcgg guggacuggc 1080

augguggacg guugguacgg guaccaccac cagaacgagc agggcagcgg cuacgccgcu 1140

gaccugaagu ccacccagaa cgccaucgac aagaucacca acaaggugaa cuccgugauc 1200

gagaagauga acacccaguu caccgccgug ggcaaggagu ucaaucaucu cgagaagcgg 1260

aucgagaacc ugaacaagaa gguggacgau ggcuuucugg acaucuggac uuacaacgca 1320

gagcugcugg ugcugcucga gaacgagcgg acacuggacu accacgacag caaugugaag 1380

aaucuguacg agaaggugcg gaaccagcug aagaacaaug ccaaggagau uggcaacggc 1440

ugcuucgagu ucuaccacaa gugugacaac acuuguaugg agagcgugaa gaaugggacc 1500

uacgacuauc ccaaguacag cgaggaggcc aagcugaaca gggagaagau cgauggaguc 1560

aagcuggacu ccaccaggau cuaccagauc cuggcgaucu acuccacugu ggccuccucg 1620

cugguucugg uggugucccu cggcgccauc agcuucugga ugugcuccaa cggcagccug 1680

cagugucgga uuugcaucug a 1701

<210> 7

<211> 1701

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 3 (H1N1) RNA ORF

<400> 7

augaaagcaa uacucguggu gaugcuguac accuucacca cugcaaaugc cgacacccug 60

ugcaucgggu accaugccaa uaauucuacc gacaccgugg acacgguguu ggagaagaau 120

gugacgguga cacauucugu gaaccuccug gaggacaagc acaacggcaa guugugcaag 180

cuccgggggg uggccccccu gcaucugggc aagugcaaca ucgccggcug gaucuugggg 240

aauccagagu gcgagucccu gagcacggcc cggucuugga guuacaucgu ggagacgagu 300

aacuccgaca acgggacgug cuaccccggg gacuucauca acuacgagga gcugagagag 360

cagcugagcu ccgucagcuc cuucgagcgc uuugagaucu uccccaagac cuccagcugg 420

cccaaccaug acuccgacaa cggagucacg gccgcuugcc cacaugcggg ggccaaguca 480

uuuuauaaga accugaucug guuggucaag aaggguaaga gcuacccuaa gaucaaccag 540

acuuauauca augacaaggg caaggaggug uuggugcugu gggggauaca ccacccacca 600

acaaucgcag accagcaguc ccuguaccag aaugcugaug ccuacguguu cgugggcacc 660

agcagguaca gcaagaaguu caagccugag aucgcgaccc gccccaaggu gcgggaucgc 720

gagggcagga ugaacuacua cuggacucug gucgagccug gugacaagau caccuucgag 780

gccaccggaa accugguggc cccaagguac gcuuucacca uggagagaga ugccggcagc 840

ggcaucauca ucuccgacac uccggugcau gacuguaaca cuacauguca gacaccggag 900

ggcgccauca acaccuccuu gcccuuccag aaugugcacc ccaucacaau uggcaagugc 960

ccgaaguacg ugaaaagcac aaagcucagg cuggccaccg gccugaggaa ugugccuuca 1020

auccaguccc gcggccucuu uggagccauc gccggcuuca uugagggcgg guggacugga 1080

augguggaug gcugguacgg cuaccaccac cagaaugagc agggcagcgg cuacgccgcu 1140

gaccugaaaa gcacccagaa cgccaucgau aagauuacca acaaggugaa cagcgugauc 1200

gagaagauga acacgcaguu caccgcuguu gguaaggagu ucaaucaucu ggagaagaga 1260

aucgagaacc ugaacaagaa gguugacgau ggcuuccugg auauuuggac uuacaaugcc 1320

gagcuccugg ugcugcucga gaacgagcgc acccuggauu aucacgacag caacgugaag 1380

aaccuguacg agaagguucg gaaccagcug aagaauaaug ccaaggagau cggcaauggg 1440

ugcuucgagu ucuaccacaa gugugacaac acuuguaugg agagcgugaa gaacggcacc 1500

uaugacuacc cuaaguacag cgaggaggcc aagcugaaca gggagaagau cgauggcgug 1560

aagcuggaca gcaccaggau cuaccagauu cuggcaaucu acagcacggu ggccagcagu 1620

cugguccugg uggugucccu gggugcuauc ucauucugga ugugcuccaa cgggagccug 1680

cagugucgga uuugcaucug a 1701

<210> 8

<211> 1701

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 4 (H1N1) RNA ORF

<400> 8

augaaagcaa uauuaguggu gauguuguau acauucacca ccgccaaugc cgacacccug 60

ugcaucggcu accaugcgaa caauuccacu gacacugugg acacgguccu ggagaagaac 120

gugaccguga cccacagugu caaccuccug gaggacaagc acaacggcaa guugugcaag 180

cuccgggggg uggcgccguu gcacuuggga aagugcaaca ucgccggcug gaucuugggg 240

aauccggagu gcgagucccu gagcacggcc cggucuugga guuacaucgu ggagacgagu 300

aacuccgaca acgggacgug cuaccccggg gacuucauca acuacgagga gcugagagag 360

cagcugagcu ccgucagcuc cuucgagcgc uucgagauuu uccccaagac cagcucgugg 420

ccgaaccaug acuccgacaa cggagucacg gccgcgugcc cccacgcggg ggcaaagucg 480

uuuuauaaga accugaucug guuggucaag aaggguaagu cuuacccuaa gaucaaccag 540

acuuauauaa acgacaaggg caaggaggug cugguccugu gggggauaca ccacccacca 600

acaaucgcag accagcaguc gcuguaccag aaugcugaug ccuacguguu cgugggcacc 660

agcagguaca gcaagaaguu caagccggag aucgcgaccc gccccaaggu gcgggaucgc 720

gagggccgga ugaacuacua uuggacccug guggagccag gggacaagau uaccuuugag 780

gccacaggua aucugguggc cccccgguac gcguucacca uggagcgcga ugccgggucc 840

gggauuauua ucucggacac uccggugcau gacuguaaca cuacauguca gacaccggag 900

ggggccauca acaccuccuu gcccuuccag aacguccacc cuauaaccau cggcaagugc 960

cccaaguaug ugaaaagcac gaagcucagg cuggccaccg gccugaggaa cgugccuucc 1020

auacagagca gaggacucuu uggagcaauu gcaggauuua ucgagggugg auggacugga 1080

augguugaug gcugguacgg guaccaccac cagaacgagc agggcagcgg cuacgccgcu 1140

gaccugaagu cgacgcagaa ugcgaucgac aagauuacca acaaggugaa cagcgugauc 1200

gagaagauga acacgcaguu caccgcuguu gguaaggagu ucaaucaccu cgagaagcgc 1260

aucgagaacc ugaacaagaa gguugacgau ggguuucucg auauuuggac uuacaacgcu 1320

gagcugcugg uccuucucga gaacgagcgc acguuggauu accacgauuc caacgugaag 1380

aacuuguacg agaagguccg gaaccagcuc aagaacaaug ccaaggagau uggcaacggg 1440

ugcuucgagu ucuaucauaa gugcgauaau acaugcaugg agagcgugaa gaauggcacu 1500

uaugauuacc cgaaguacuc ggaggaggcc aagcugaacc gggagaagau cgauggaguc 1560

aagcuugacu ccaccaggau cuaccagauc cuggcgaucu acuccacggu ggccuccucc 1620

cucguucugg uggugagccu gggagccauc agcuuuugga uguguucgaa ugguagccug 1680

cagugucgga uuugcaucug a 1701

<210> 9

<211> 1701

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 5 (H1N1) RNA ORF

<400> 9

augaaggcca uccugguggu gaugcuguac accuucacca ccgccaacgc cgacacccug 60

ugcaucggcu accacgccaa caacagcacc gacaccgugg acaccgugcu ggagaagaac 120

gugaccguga cccacagcgu gaaccugcug gaggacaagc acaacggcaa gcugugcaag 180

cugagaggcg uggccccccu gcaccugggc aagugcaaca ucgccggcug gauccugggc 240

aaccccgagu gcgagagccu gagcaccgcc agaagcugga gcuacaucgu ggagaccagc 300

aacagcgaca acggcaccug cuaccccggc gacuucauca acuacgagga gcugagagag 360

cagcugagca gcgugagcag cuucgagagg uucgagaucu uccccaagac cagcagcugg 420

cccaaccacg acagcgacaa cggcgugacc gccgccugcc cccacgccgg cgccaagagc 480

uucuacaaga accugaucug gcuggugaag aagggcaaga gcuaccccaa gaucaaccag 540

accuacauca acgacaaggg caaggaggug cuggugcugu ggggcaucca ccaccccccc 600

accaucgccg accagcagag ccuguaccag aacgccgacg ccuacguguu cgugggcacc 660

agcagauaca gcaagaaguu caagcccgag aucgccacca gacccaaggu gagggacagg 720

gagggcagaa ugaacuacua cuggacccug guggagcccg gcgacaagau caccuucgag 780

gccaccggca accugguggc ccccagauac gccuucacca uggagagaga ugccggcagc 840

ggcaucauca ucagcgacac ccccgugcac gacugcaaca ccaccugcca gacccccgag 900

ggcgccauca acaccagccu gcccuuccag aacgugcacc ccaucaccau cggcaagugc 960

cccaaguacg ucaagagcac caagcugagg cuggccaccg gccugaggaa cgugcccagc 1020

auccagagca gaggccuguu cggcgccauc gccggcuuca ucgagggcgg cuggaccggc 1080

augguggacg gcugguacgg cuaccaccac cagaacgagc agggcagcgg cuacgccgcc 1140

gaccugaagu ccacccagaa cgccaucgac aagaucacca acaaggugaa cagcgugauc 1200

gagaagauga acacccaguu caccgccgug ggcaaggagu ucaaccaccu ggagaagagg 1260

aucgagaacc ugaacaagaa gguggacgac ggcuuccugg acaucuggac cuacaacgcc 1320

gagcugcugg ugcugcugga gaacgagaga acccuggacu accacgacag caacgugaag 1380

aaccuguacg agaaggugag gaaccagcug aagaacaacg ccaaggagau cggcaacggc 1440

ugcuucgagu ucuaccacaa gugcgacaac accugcaugg agagcgugaa gaacggcacc 1500

uacgacuacc ccaaguacag cgaggaggcc aagcugaaca gggagaagau cgacggcgug 1560

aagcuggaca gcaccaggau cuaccagauc cuggccaucu acagcaccgu ggccagcagc 1620

cuggugcugg uggugagccu gggcgccauc agcuucugga ugugcagcaa cggcagccug 1680

cagugcagaa ucugcaucug a 1701

<210> 10

<211> 1701

<212> RNA

<213> Artificial Sequence

<220>

<223> Ori (H1N1) RNA ORF

<400> 10

augaaggcaa uacuaguagu uaugcuguau acauuuacaa ccgcaaaugc agacacauua 60

uguauagguu aucaugcgaa caauucaaca gacacugugg acacaguacu agaaaagaau 120

guaacaguaa cacacucugu caaucuucug gaagacaagc auaacggaaa acuaugcaaa 180

cuaagagggg uagccccauu gcauuugggu aaauguaaca uugcuggcug gauccuggga 240

aauccagagu gugaaucacu cuccacagca agaucauggu ccuacauugu ggaaacaucu 300

aauucagaca auggaacgug uuacccagga gauuucauca auuaugagga gcuaagagag 360

caauugagcu cagugucauc auuugaaagg uuugaaauau uccccaagac aaguucaugg 420

ccuaaucaug acucggacaa ugguguaacg gcagcauguc cucacgcugg agcaaaaagc 480

uucuacaaaa acuugauaug gcugguuaaa aaaggaaaau cauacccaaa gaucaaccaa 540

accuacauua augauaaagg gaaagaaguc cucgugcugu ggggcauuca ccauccaccu 600

acuauugcug accaacaaag ucucuaucag aaugcagaug cauauguuuu uguggggaca 660

ucaagauaca gcaagaaguu caagccggaa auagcaacaa gacccaaagu gagggaucga 720

gaagggagaa ugaacuauua cuggacacua guagaaccgg gagacaaaau aacauucgaa 780

gcaacuggua aucuaguggc accgagauau gcauucacaa uggaaagaga ugcuggaucu 840

gguauuauca uuucagauac accaguccac gauugcaaua caacuuguca gacacccgag 900

ggugcuauaa acaccagccu cccauuucag aauguacauc cgaucacaau ugggaaaugu 960

ccaaaguaug uaaaaagcac aaaauugaga cuggccacag gauugaggaa ugucccgucu 1020

auucaaucua gaggccuauu cggggccauu gcuggcuuca ucgaaggggg guggacaggg 1080

augguagaug gaugguacgg uuaucaccau caaaaugagc aggggucagg auaugcagcc 1140

gaucugaaaa gcacacaaaa ugccauugau aagauuacua acaaaguaaa uucuguuauu 1200

gaaaagauga auacacaguu cacagcaguu gguaaagagu ucaaccaccu ugaaaaaaga 1260

auagagaauc uaaauaaaaa gguugaugau gguuuccugg acauuuggac uuacaaugcc 1320

gaacuguugg uucuacugga aaacgaaaga acuuuggacu aucacgauuc aaaugugaag 1380

aacuuguaug aaaaaguaag aaaccaguua aaaaacaaug ccaaggaaau uggaaacggc 1440

ugcuuugaau uuuaccacaa augcgacaac acaugcaugg aaagugucaa gaaugggacu 1500

uaugacuacc caaaauacuc agaggaagca aaauuaaaca gagaaaaaau agauggagua 1560

aagcuggacu caacaaggau cuaccagauu uuggcgaucu auucaacugu ugccaguuca 1620

uugguacugg uagucucccu gggggcaauc agcuucugga ugugcucuaa ugggucucua 1680

caguguagaa uauguauuua a 1701

<210> 11

<211> 1701

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 1 (H3N2) RNA ORF

<400> 11

augaaaacaa uaaucgcccu gagcuacauc cugugccugg uguucgccca gaagaucccc 60

ggcaacgaua acagcacagc cacccugugc cuggggcacc acgccgugcc caacggcacc 120

aucgugaaga ccaucaccaa cgaucggauc gaggugacca acgccaccga gcuggugcag 180

aacuccucca ucggggagau cugcgacagc ccccaccaga uccuggaugg gggcaacugc 240

acacugaucg acgcccugcu gggcgacccu cagugugacg gguuccagaa caaggagugg 300

gaccuguucg uggagcggag cagggccaac agcaacugcu accccuacga cgugccugac 360

uaugccagcc ugcggagccu gguggccagc agcggcaccc uggaguucaa gaacgagagc 420

uucaacugga ccggggugaa gcagaauggc accagcuccg ccugcauucg gggcagcagc 480

uccagcuucu ucagccggcu gaacuggcug acccaccuga acuacaagua cccugcccug 540

aaugugacca ugcccaacaa ugagcaguuc gacaagcugu acaucugggg cgugcaccac 600

ccccggaccg acaaggacca gaucucacug uucgcccagc ccucugggcg gaucacagug 660

agcaccaagc gcucccagca ggccgugauc cccaacaucg gaucacggcc ucggauccgg 720

gacauccccu cccggaucuc caucuacugg accaucguga agcccggcga cauccugcug 780

aucaacagca ccggcaaccu gaucgccccc cggggcuacu ucaagaucag guccggcaag 840

agcuccauca ugcggagcga ugcucccauu gggaagugca agagcgagug caucaccccc 900

aaugggagca uccccaacga caagcccuuc cagaacguga accggaucac cuacggcgcc 960

ugcccccggu acgugaagca gagcacccug aagcuggcca ccggcaugag gaacgugccu 1020

gagaagcaga cccggggcau cuucggcgcc aucgccggcu ucaucgagaa cggcugggag 1080

ggcauggugg acggcuggua uggcuucagg caccagaacu ccgagggccg cggccaggcc 1140

gccgaucuga agucuaccca ggccgccauu gaccagauca auggcaagcu gaauagacug 1200

aucggcaaga ccaacgagaa guuccaccag aucgagaagg aauucuccga gguggagggc 1260

cggguacagg accuggagaa guacguggag gacaccaaga ucgaucugug gagcuacaac 1320

gccgagcugc ugguggcccu ggagaaccag cacaccaucg aucugaccga cagcgagaug 1380

aacaagcugu ucgagaagac caagaagcag cugcgggaga augccgagga caugggcaac 1440

ggcugcuuca agaucuacca caagugugac aacgcuugua ucggcuccau ccgcaaugag 1500

accuacgacc acaacgugua cagggacgag gcccugaaca acagguuuca gaucaagggg 1560

guggagcuga agucaggcua caaggacugg auccugugga ucuccuucgc caugagcugc 1620

uuccugcugu gcaucgcccu gcugggguuc aucauguggg ccugccagaa gggcaacauc 1680

aggugcaaca ucugcaucug a 1701

<210> 12

<211> 1701

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 2 (H3N2) RNA ORF

<400> 12

augaaaacaa uaauagcccu gagcuauauu cugugccugg ucuucgccca gaagauccca 60

ggcaaugaca auagcaccgc caccuugugc cugggucauc acgccgugcc uaauggcacc 120

aucgugaaga ccaucaccaa cgacaggauc gaggugacca augcuacuga gcuggugcag 180

aacaguagca uuggggagau cugcgauucc ccacaucaga uccuggaugg ggggaauugc 240

acacugaucg acgcccugcu gggcgauccc cagugugacg gguuccagaa caaggagugg 300

gaccuguucg uggagcggag uagggcuaac agcaacuguu accccuacga cguucccgac 360

uacgccuccc ugaggucucu gguggccagc aguggcacac uggaguucaa gaacgagagc 420

uucaacugga caggcgugaa gcagaacggc accucuuccg ccuguauccg gggaagcucu 480

aguucuuucu ucagccggcu gaacuggcug acccaccuga acuacaagua uccagcucug 540

aacgugacca ugcccaacaa ugagcaguuc gacaagcugu auauuugggg ggugcaccac 600

ccccggaccg acaaggacca gaucucccug uucgcccagc ccucugggcg gaucaccgug 660

agcaccaagc ggucucagca ggccgugauc cccaacaucg gaucacggcc ucggaucagg 720

gauaucccca gcaggaucuc caucuauugg accaucguga agccugggga uauccugcug 780

aucaacucua cgggcaaucu gauugccccu agaggguacu ucaagaucag gagcggcaag 840

agcucuauca ugaggucuga cgcuccuauc gggaagugca agagugagug caucaccccu 900

aacggaagca uccccaacga caagccauuu cagaacguga acaggaucac cuacggggcc 960

ugcccccguu acgugaagca guccacucug aagcuggcga cuggcaugag gaaugucccc 1020

gagaagcaga cucggggcau cuucggcgcc aucgccggcu ucaucgagaa cggcugggaa 1080

ggaaugguag acggcuggua cggcuuccgc caucagaacu cugagggucg gggccaggcc 1140

gccgaccuga agaguaccca ggccgccauc gaucagauca auggcaagcu gaaucggcug 1200

aucggcaaga ccaaugagaa guuccaccag auugagaagg aguucucaga gguggagggc 1260

cgggugcagg accuggagaa guacguugag gacaccaaga ucgaccugug guccuacaac 1320

gccgagcucc uggucgcccu ggagaaucag cacacuaucg accugaccga uagugagaug 1380

aacaagcugu uugagaagac caagaagcag cugcgggaga acgccgagga caugggcaac 1440

ggaugcuuca agaucuacca caagugugac aacgcuugua ucggaagcau ccggaacgag 1500

accuacgacc acaacgugua cagggacgag gcccugaaca acagauucca gaucaagggc 1560

guagagcuga agucuggcua caaagauugg auccugugga ucagcuucgc cauguccugc 1620

uuucugcugu guauugcccu ucugggguuc aucauguggg ccugccagaa gggcaauauc 1680

aggugcaaca ucugcaucug a 1701

<210> 13

<211> 1701

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 3 (H3N2) RNA ORF

<400> 13

augaaaacaa uaauagcccu gagcuauauu cugugccugg ucuucgccca gaagauccca 60

ggcaaugaca auagcacagc cacgcugugu cugggccacc acgccgugcc aaacggcacc 120

aucgugaaga cuaucaccaa cgaccggauc gaggugacca acgccacaga gcuggugcag 180

aacuccucca ucggggagau cugcgauucc ccccaccaga uccuggaugg ggggaauugc 240

acacugaucg acgcccugcu gggcgauccu cagugugacg gguuccagaa caaggagugg 300

gaccuguucg uggagcggag uagggcuaac agcaacuguu accccuacga cguucccgau 360

uacgccaguc ugagaagccu cguggccagc uccgggacac uggaguucaa gaacgagagc 420

uucaauugga cuggcgugaa gcagaauggg accaguucag ccugcaucag agggagcagc 480

agcuccuucu ucagcaggcu gaacuggcug acccaucuga acuacaagua cccagcucug 540

aacgugacca ugcccaacaa ugagcaguuc gacaagcugu acaucugggg cgugcaccac 600

ccccggaccg acaaggauca gauuagccug uucgcccagc ccucugggcg gaucacugug 660

agcaccaagc gcucacagca ggccgugauc cccaacaucg gaucacggcc ucggaucagg 720

gauaucccca gcaggaucuc caucuauugg acgaucguga agccugggga uauccugcug 780

aucaacagca caggcaaucu gaucgcuccc cggggguacu ucaagauccg gucugggaag 840

ucuucuauca ugaggagcga ugcucccauu gggaagugca agagcgagug cauuacuccc 900

aaugggagca uuccuaauga uaagcccuuc cagaacguga aucggaucac cuacggugcc 960

ugcccacggu acgugaagca gagcacccug aagcuggcaa caggcaugcg gaaugugccc 1020

gagaagcaga cucggggcau auucggcgcc aucgccggcu ucaucgagaa cggcugggag 1080

ggcauggugg acggcuggua cggcuuccgg caccagaaca gcgagggcag ggggcaggcu 1140

gccgaucuga agucuacuca ggcugccauu gaucagauca auggcaagcu gaauagacug 1200

aucggcaaga ccaacgagaa guuccaccag aucgagaagg aauucuccga gguggagggc 1260

cggguacagg accuggagaa guacguggag gacaccaaga ucgaucugug gagcuacaac 1320

gcggagcugc ugguggcucu cgaaaaccag cacaccaucg acuuaaccga cagcgagaug 1380

aacaagcugu ucgagaagac caagaagcag cuccgcgaga acgccgagga cauggggaau 1440

gggugcuuca agaucuacca caagugugac aacgcuugua ucggcuccau ccgcaaugag 1500

accuaugacc acaacgugua cagggacgag gcccugaaca auagguuuca gaucaagggg 1560

guggagcuga aguccggcua caaggacugg aucuugugga ucucauucgc cauguccugc 1620

uuccugcucu guauugcccu ucugggguuc aucauguggg ccugccagaa gggcaauauc 1680

agaugcaaca ucugcaucug a 1701

<210> 14

<211> 1701

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 4 (H3N2) RNA ORF

<400> 14

augaaaacaa uaauagcccu gagcuacaua cuuuguuuag ucuuugccca gaagauuccg 60

ggcaaugaca acucgacugc cacacugugc cuggggcauc acgcggugcc uaauggcacc 120

aucgugaaga cgauuaccaa ugaccggauc gaggugacca acgcgacaga gcuggugcag 180

aacuccucua uuggggagau cugcgauucc ccccaccaga uccuggaugg ggggaauugc 240

acacugaucg acgcccugcu gggcgauccu cagugugacg gguuccagaa caaggagugg 300

gaccuguucg uggagcggag uagggcuaac agcaacuguu accccuacga cguucccgau 360

uacgccaguc ugagaagccu cguggcgagc uccgggacac uggaguucaa gaacgagagc 420

uucaauugga cuggcgugaa gcagaauggg accaguucag ccugcauaag agggagcagc 480

agcuccuucu ucagcaggcu gaacugguug acccaucuga acuacaagua cccagcucug 540

aacgugacca ugcccaauaa ugagcaguuu gacaagcugu acauuugggg cgugcaccac 600

ccccggacgg acaaggauca gaucucccug uucgcccagc ccucugggcg gaucacugug 660

agcaccaagc gcucacagca ggccgugauc cccaacaucg gaucacggcc ucggaucagg 720

gauaucccca gcaggaucuc caucuauugg acgaucguga agccugggga uauccugcug 780

aucaacagca cagggaaucu gaucgcuccc cggggguacu ucaagauccg gucagggaag 840

ucgucuauca ugaggagcga ugcucccauu gggaagugca agagcgagug cauuaccccc 900

aaugggagca ucccuaauga uaagcccuuc cagaacguga accggaucac guacggggcu 960

ugccccaggu acgugaagca gucgacucug aagcuggcga cgggcaugcg gaaugugccc 1020

gagaagcaga cucggggcau auucggcgcc aucgccggcu ucaucgagaa ugggugggag 1080

ggcauggucg acggcuggua cggcuuucgc caccagaaca gcgagggccg gggccaggcc 1140

gccgaccuga aguccaccca ggcugccauu gaucagauca auggcaagcu gaaccgucuc 1200

auugggaaga ccaaugagaa guuccaucag aucgagaagg aguucagcga ggucgagggg 1260

cggguccagg accucgagaa guacgucgag gacaccaaga ucgaccucug gagcuacaac 1320

gcugagcucc ugguggcgcu ggagaaccag cacaccaucg aucugacgga cagcgagaug 1380

aacaagcugu ucgagaagac aaagaagcag cucagggaga augcagagga cauggggaac 1440

gggugcuuca agaucuacca caagugugac aacgcuugua ucggcuccau ccgcaaugag 1500

accuaugacc acaacgugua cagggacgag gcccugaaca auagguuuca gaucaagggg 1560

guggagcuga aguccggcua caaggacugg aucuugugga ucucguucgc cauguccugc 1620

uuccugcugu guauugcccu ucugggguuc aucauguggg ccugccagaa gggcaauauc 1680

aggugcaaua ucugcauuug a 1701

<210> 15

<211> 1701

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 5 (H3N2) RNA ORF

<400> 15

augaaaacaa uaauagcgcu gagcuacauu cucugucugg uguuugccca gaagauuccg 60

ggcaacgaca acagcacagc cacgcugugc cuugggcacc acgcggugcc caacgguacg 120

aucgugaaga ccaucacgaa cgaccgcaua gaggucacca augcuacuga gcuggugcag 180

aacaguagca uuggugagau cugugauucc ccccaccaga uccuggaugg ggggaauugu 240

acucuuauug augcgcuguu aggcgauccg cagugcgacg gguuccagaa caaggagugg 300

gaccuguucg uagagcggag ucgugcgaau agcaacugcu auccguacga cgugccagac 360

uacgcauccu ugcguagucu gguugcuucc uccgggacgu uggaguucaa gaacgagagc 420

uucaacugga ccggagugaa gcagaauggg accaguucag ccugcauaag agggagcagc 480

agcuccuucu ucagcaggcu gaacugguug acccauuuga acuacaagua cccggcccuc 540

aauguuacga ugccgaacaa cgagcaguuu gauaaauugu acaucugggg ggugcaccac 600

ccccggacug acaaggauca gauuagcuug uucgcucagc cgagcggccg uaucaccgua 660

uccaccaaac gcucccagca agccgugauc ccgaacaucg ggucacggcc ucggauccgg 720

gacaucccgu cccggaucuc gauuuacugg acuauuguua agccaggaga cauucuccug 780

auuaacagua ccgguaacuu gaucgccccg aggggauacu ucaagauccg cucggggaag 840

ucaaguauca ugcggagcga ugcucccauu gggaagugca agagcgagug cauuaccccc 900

aaugggagca ucccgaauga uaagccguuc cagaauguga accgcaucac guacggggcc 960

ugcccccggu acgugaagca gucgacccug aagcuugcca cggggaugcg gaacgugccc 1020

gagaagcaga cccguggcau cuucggggcg auugcggggu ucauagagaa cggcugggaa 1080

ggcaugguag acggauggua cggcuuucgg caucagaaca gugagggccg gggccaggca 1140

gcggaucuga agaguacaca ggcugccauu gaucagauca auggcaagcu gaaccgucuc 1200

auugggaaga ccaaugagaa guuccaccag auagagaagg aguucagcga ggucgagggu 1260

cguguccagg accuggagaa guacgucgag gacacgaaga ucgaccugug gaguuacaac 1320

gccgaguugc ugguggcgcu ggagaaccag cacaccaucg acuugacgga cagcgagaug 1380

aacaagcugu ucgagaagac caagaagcag cuccgcgaga acgcggagga cauggggaac 1440

gggugcuuca agaucuacca caagugugac aacgcuugua ucggcuccau ccgcaaugag 1500

accuaugacc acaacgucua cagagaugag gcguugaaca auagguuuca gaucaagggg 1560

guggagcuga aguccggcua caaggacugg aucuugugga ucucguucgc cauguccugc 1620

uucuugcuuu guauugcccu ucugggguuc aucauguggg ccugccagaa gggcaauauc 1680

cguuguaaca ucugcaucug a 1701

<210> 16

<211> 1701

<212> RNA

<213> Artificial Sequence

<220>

<223> Ori (H3N2) RNA ORF

<400> 16

augaagacua ucauugcuuu gagcuacauu cuaugucuug uuuucgcuca aaaaaucccu 60

ggaaaugaca auagcacggc aacgcugugc cuugggcacc augcaguacc aaacggaacg 120

auagugaaaa caaucacaaa ugaccgaauu gaaguuacua augcuacuga guugguucag 180

aauuccucaa uaggugaaau augcgacagu ccucaucaga uccuugaugg agggaacugc 240

acacuaauag augcucuauu gggggacccu cagugugacg gcuuucaaaa uaaggaaugg 300

gaccuuuuug uugaacgaag cagagccaac agcaacuguu acccuuauga ugugccggau 360

uaugccuccc uuaggucacu aguugccuca uccggcacac uggaguuuaa aaaugaaagc 420

uucaauugga cuggagucaa acaaaacgga acaaguucug cgugcauaag gggaucuagu 480

aguaguuuuu uuaguagauu aaauugguug acccacuuaa acuacaaaua uccagcacug 540

aacgugacua ugccaaacaa ugaacaauuu gacaaauugu acauuugggg gguucaccac 600

ccgagaacgg acaaggacca aaucucccug uuugcucaac caucaggaag aaucacagua 660

ucuaccaaaa gaagccaaca agcuguaauc ccaaauauag gaucuagacc cagaauaagg 720

gauaucccua gcagaauaag caucuauugg acaauaguaa aaccgggaga cauacuuuug 780

auuaacagca cagggaaucu aauugcuccu agggguuacu ucaaaauacg aagugggaaa 840

agcucaauaa ugagaucaga ugcacccauu ggcaaaugca agucugaaug caucacucca 900

aauggaagca uucccaauga caaaccguuc caaaauguaa acaggaucac auacggggcc 960

ugucccagau augucaagca aagcacccug aaauuggcaa caggaaugcg aaauguacca 1020

gagaaacaaa ccagaggcau auuuggcgca auagcggguu ucauagaaaa uggaugggag 1080

ggaauggugg augguuggua cgguuucagg caucaaaauu cugagggaag aggacaagca 1140

gcagaucuca aaagcacuca agcagcaauc gaucaaauca augggaagcu gaaucgauug 1200

aucggaaaaa ccaacgagaa auuccaucag auugaaaaag aauucucaga aguagaagga 1260

agaguucaag accuugagaa auauguugag gacacuaaaa uagaucucug gucauacaac 1320

gcugagcuuc uuguugcccu ggagaaccaa cauacaauug accuaacuga cucagaaaug 1380

aacaaacugu uugaaaaaac aaagaagcaa cugagggaaa augcugagga uaugggaaau 1440

gguuguuuca aaauauacca caaaugugac aaugccugca uaggaucaau aagaaaugaa 1500

acuuaugacc acaaugugua cagggaugaa gcauuaaaca accgguucca gaucaaggga 1560

guugagcuga agucagggua caaagauugg auccuaugga uuuccuuugc caugucaugu 1620

uuuuugcuuu guauugcuuu guugggguuc aucauguggg ccugccaaaa gggcaacauu 1680

agaugcaaca uuugcauuug a 1701

<210> 17

<211> 1749

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 1 (B/Victoria) RNA ORF

<400> 17

augaaagcaa uaauagugcu gcugauggug gugaccagca acgccgacag gaucugcacc 60

ggcaucacca gcagcaacag cccucacgug gugaagaccg ccacccaggg cgaggugaac 120

gugaccggag ugauaccacu gacaacaaca ccaacaaagu cucacuucgc caaccugaag 180

ggcaccgaga ccagggggaa gcugugcccc aagugccuga acugcacaga ccuggacgug 240

gcccugggcc ggccaaagug caccggcaag auccccagcg cccgggugag cauccugcac 300

gaggugcggc cugugacauc cgggugcuuu ccuaucaugc acgauaggac caagauuagg 360

cagcugccua aucugcugcg gggguacgag cacgugaggc uguccaccca caacgugauc 420

aacgccgagg acgccccugg acggccuuac gagaucggca ccuccggcag cugccccaac 480

aucaccaacg gcaacggguu cuucgccacc auggcuuggg ccgugcccaa gaacaagacc 540

gccaccaacc cccugaccau cgaggugccc uacaucugca ccgaggggga ggaccagauc 600

accguauggg gcuuccacuc cgacagcgag acccagaugg ccaagcugua cggagacagc 660

aagccccaga aguucaccuc cuccgccaac ggcgugacca cccacuacgu gagccagauu 720

ggcggcuucc ccaaccagac cgaggauggg ggccugcccc agucuggccg caucguggug 780

gacuacaugg ugcagaaaag cggcaagacc ggcaccauca ccuaccagcg gggcauccug 840

cugccccaga agguguggug cgccucuggc cgcucuaagg ugaucaaggg cagccugccc 900

cugaucggcg aggccgacug ccugcacgag aaguacggcg ggcugaacaa gagcaagccc 960

uacuacaccg gcgagcacgc caaggccauu ggcaacugcc ccaucugggu gaagaccccc 1020

cugaagcugg ccaauggcac caaguaccgg ccccccgcca agcugcugaa ggagcggggc 1080

uucuucggcg ccaucgccgg cuucuuagaa ggaggcuggg aaggcaugau ugcaggcugg 1140

cacggcuaca ccagccacgg cgcccacggc guggccgugg ccgccgaccu uaagagcacc 1200

caggaggcaa ucaacaagau caccaagaac cugaacagcc ugagcgagcu ggaggugaag 1260

aaccuccagc ggcuguccgg ggccauggau gagcugcaca acgagauccu ggagcuggac 1320

gagaaggugg acgaucugag agcugacacc aucagcucuc agaucgagcu ggccgugcug 1380

cugagcaacg agggcaucau caacagcgag gaugagcacc ugcuggcccu ggagcggaag 1440

cugaagaaga ugcugggccc cagcgccgug gagaucggca acggcugcuu cgagaccaag 1500

cacaagugca aucagaccug ucuggacagg aucgccgccg gcaccuucga cgccggcgag 1560

uucucccugc ccaccuucga cagccugaac aucaccgccg ccagccugaa cgacgacggg 1620

cuggacaacc acaccauccu gcuguacuac uccaccgccg ccagcagccu ggccgugaca 1680

cugaugaucg ccaucuucgu gguguacaug gugucccgcg acaacguguc cugcuccauc 1740

ugucuguga 1749

<210> 18

<211> 1749

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 2 (B/Victoria) RNA ORF

<400> 18

augaaagcaa uaauagugcu gcugauggug gugaccagca augcagaucg gaucugcacu 60

ggcaucacca gcagcaacag cccucacgug gugaagaccg ccacccaagg agaagugaac 120

gugacaggag ugauaccacu gacaacaaca ccaacaaaga gccacuucgc aaaccugaag 180

gggaccgaga cacggggcaa gcugugcccc aagugucuga acugcaccga ucucgaugua 240

gcccugggcc ggcccaagug cacugggaag auccccagug cacggguguc cauccugcau 300

gaggugcggc cagugaccuc uggcugcuuc cccaucaugc acgaucggac aaagauuagg 360

cagcugccua aucugcugcg cggcuacgag cacgugcggc ugagcaccca caacgugauc 420

aacgcugagg augcucccgg ccggccauac gagaucggca ccucugguuc uugcccuaac 480

aucaccaaug gcaauggguu cuuugccacc auggcuuggg ccgugcccaa gaacaagacg 540

gcaaccaacc cauugaccau ugaggugccc uacaucugca ccgagggcga ggaccagauc 600

accgucuggg gcuuccacuc cgacagcgag acccagaugg ccaagcugua cggagacagc 660

aagccccaga aguucaccuc cuccgccaau ggcgugacua cccacuacgu gagccagauc 720

ggcggguucc ccaaccagac cgaggauggg ggccugcccc agucuggccg gauuguggug 780

gacuacaugg uccagaaguc cggcaagacu ggcaccauca ccuaucagcg gggcauccug 840

cugccccaga agguguggug ugccagcggu cggucuaagg ugaucaaggg cagccugccc 900

uugaucggcg aggccgacug ccugcacgag aaguauggcg gacugaacaa guccaagcca 960

uacuacaccg gggagcacgc uaaggccauu ggcaacugcc ccaucugggu gaagaccccc 1020

cugaagcugg ccaauggcac uaaguaccgg ccccccgcca agcugcucaa ggagcgcggg 1080

uucuucggcg ccaucgccgg cuuccuggag ggaggcuggg agggcaugau cgccggaugg 1140

cacggguaca cuucccacgg cgcccacggc guggccgugg ccgccgaccu gaagaguacc 1200

caggaggcca ucaacaagau caccaagaac cugaacuccu ugagcgagcu ggaggugaag 1260

aaccuccagc ggcuguccgg cgccauggau gagcugcaca acgagauccu ggagcuggac 1320

gagaaggugg acgaucugag agcagauacc aucagcucuc agaucgagcu cgccgugcug 1380

cuguccaacg agggcaucau caacagcgag gacgagcauc uccuggcacu ggagaggaaa 1440

cugaagaaga ugcugggccc cagcgccgug gagaucggca acgggugcuu ugagacaaag 1500

cacaagugca accagaccug ccuggacagg aucgccgccg gcaccuucga ugccggcgag 1560

uucucccugc ccaccuucga cagccugaac aucaccgcug ccagccugaa cgacgacggg 1620

cuggacaacc acaccauccu gcuguacuac agcaccgcug ccagcucacu ggccgugaca 1680

cugaugaucg ccaucuucgu gguguacaug gugucacggg acaacgugag cugcagcauc 1740

ugccuguga 1749

<210> 19

<211> 1749

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 3 (B/Victoria) RNA ORF

<400> 19

augaaagcaa uaauagugcu cuugauggug gugacaucua acgcagaccg caucugcacc 60

gggaucaccu ccagcaauag cccccacgug gugaagacug cgacucaagg agaagugaac 120

gucacaggag ugauaccacu gacgacaaca ccaacaaagu cgcacuucgc caaccucaag 180

gguacagaga cucguggcaa guugugcccc aagugccuca acugcacgga ccuggacgug 240

gcccugggga gacccaagug cacugggaag auucccagug cacgggucuc cauccugcau 300

gaggugcgcc cggugaccuc cgggugcuuc cccaucaugc acgaucgcac gaagauucgg 360

cagcugccga aucuucugcg gggcuacgaa cacgugcggu ugagcacgca caacgugaua 420

aacgcggagg augcucccgg acgucccuac gagauuggga cguccgggag cuguccgaau 480

aucaccaaug ggaacggcuu cuucgccacc auggcguggg ccguucccaa gaauaagacu 540

gccacgaacc cucugaccau ugagguuccg uacaucugua cggaggggga ggaccagauu 600

acaguuuggg gguuucacuc cgacagugag acccagaugg ccaagcugua uggugacucc 660

aagccgcaga aguucacuuc uucggcuaau ggagucacca cccauuacgu cagucagauu 720

gggggcuucc ccaaucagac ugaggauggg ggccuccccc agucuggccg gauuguggug 780

gacuacaugg uccagaaguc cggcaagacu ggcaccauca ccuaccagcg gggaauccuu 840

cucccgcaga agguguggug cgcaagcggu cggucuaagg ugaucaaggg gagccugccc 900

uugaucggcg aggccgacug cuugcacgag aaguacggcg ggcucaacaa gagcaagccg 960

uacuacacag gggagcacgc caaggcgauc gggaacugcc cgaucugggu gaagacuccc 1020

cugaagcugg cgaacgguac caaguaccgu ccgccagcga agcuccucaa ggagaggggc 1080

uucuucgggg cuauugcugg auuccuggag ggcggauggg agggcaugau ugccgggugg 1140

cauggcuaca cuagccaugg cgcccacggc guugcugugg ccgccgaccu caagagcacc 1200

caggaggcca uaaacaagau cacgaagaac cugaacucgc ugagcgagcu ggaggugaag 1260

aaccuccagc ggcucagcgg ggccauggac gagcuccaua acgagaucuu ggagcucgac 1320

gagaaggugg augaucugcg agcugauacc aucagcucgc agaucgagcu ggcggugcuc 1380

cuguccaacg aggggaucau caacucggag gacgagcacc ugcuagcgcu ggagcgcaag 1440

cucaagaaga ugcuugggcc cagcgcgguc gagauaggua augggugcuu cgagacgaag 1500

cacaagugca accagaccug ucucgaccgc aucgccgccg gcacuuuuga ugccggcgag 1560

uucagccugc caacguucga cucgcugaac aucaccgcag cgagucugaa cgacgacggg 1620

cuggacaauc acaccauucu ccucuauuac agcaccgcgg ccaguucucu ggccgugacg 1680

cugaugauag cuaucuucgu ggucuauaug gucucccggg acaacguguc gugcucgaua 1740

uguuuguga 1749

<210> 20

<211> 1749

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 4 (B/Victoria) RNA ORF

<400> 20

augaaggcca ucaucgugcu gcugauggug gugaccagca acgccgacag gaucugcacc 60

ggcaucacca gcagcaacag cccccacgug gugaagaccg ccacccaggg cgaggugaac 120

gugaccggcg ugaucccccu gaccaccacc cccaccaaga gccacuucgc caaccugaag 180

ggcaccgaga ccaggggcaa gcugugcccc aagugccuga acugcaccga ccuggacgug 240

gcccugggca gacccaagug caccggcaag auccccagcg ccagggugag cauccugcac 300

gaggugagac ccgugaccag cggcugcuuc cccaucaugc acgacagaac caagaucaga 360

cagcugccca accugcugag gggcuacgag cacgugaggc ugagcaccca caacgugauc 420

aacgccgagg acgcccccgg cagacccuac gagaucggca ccagcggcag cugccccaac 480

aucaccaacg gcaacggcuu cuucgccacc auggccuggg ccgugcccaa gaacaagacc 540

gccaccaacc cccugaccau cgaggugccc uacaucugca ccgagggcga ggaccagauc 600

accguguggg gcuuccacag cgacagcgag acccagaugg ccaagcugua cggcgacagc 660

aagccccaga aguucaccag cagcgccaac ggcgugacca cccacuacgu gagccagauc 720

ggcggcuucc ccaaccagac cgaggacggc ggccugcccc agagcggcag aaucguggug 780

gacuacaugg ugcagaaguc cggcaagacc ggcaccauca ccuaccagag gggcauccug 840

cugccccaga agguguggug cgccagcggc aggagcaagg ugaucaaggg cagccugccc 900

cugaucggcg aggccgacug ccugcacgag aaguacggcg gccugaacaa gagcaagccc 960

uacuacaccg gcgagcacgc caaggccauc ggcaacugcc ccaucugggu gaagaccccc 1020

cugaagcugg ccaacggcac caaguacaga ccccccgcca agcugcugaa ggagagaggc 1080

uucuucggcg ccaucgccgg cuuccuggag ggcggcuggg agggcaugau cgccggcugg 1140

cacggcuaca ccagccacgg cgcccacggc guggccgugg ccgccgaccu caagagcacc 1200

caggaggcca ucaacaagau caccaagaac cugaacagcc ugagcgagcu ggaggugaag 1260

aaccugcaga gacugagcgg cgccauggac gagcugcaca acgagauccu ggagcuggac 1320

gagaaggugg acgaccugag ggccgacacc aucagcagcc agaucgagcu ggccgugcug 1380

cugagcaacg agggcaucau caacagcgag gacgagcacc ugcuggcccu ggagagaaag 1440

cugaagaaga ugcugggccc cagcgccgug gagaucggca acggcugcuu cgagaccaag 1500

cacaagugca accagaccug ccuggacaga aucgccgccg gcaccuucga cgccggcgag 1560

uucagccugc ccaccuucga cagccugaac aucaccgccg ccagccugaa cgacgacggc 1620

cuggacaacc acaccauccu gcuguacuac agcaccgccg ccagcagccu ggccgugacc 1680

cugaugaucg ccaucuucgu gguguacaug gugagcagag acaacgugag cugcagcauc 1740

ugccuguga 1749

<210> 21

<211> 1749

<212> RNA

<213> Artificial Sequence

<220>

<223> Ori (B/Victoria) RNA ORF

<400> 21

augaaggcaa uaauuguacu acucauggua guaacaucca augcagaucg aaucugcacu 60

gggauaacau cgucaaacuc accacauguc gucaaaacug cuacucaagg ggaggucaac 120

gugaccggug uaauaccacu gacaacaaca cccaccaaau cucauuuugc aaaucucaaa 180

ggaacagaaa ccagggggaa acuaugccca aaaugccuca acugcacaga ucuggaugua 240

gccuugggca gaccaaaaug cacagggaaa auacccucug caaggguuuc aauacuccau 300

gaagucagac cuguuacauc ugggugcuuu ccuauaaugc acgauagaac aaaaauuaga 360

cagcugccua accuucuccg aggauacgaa caugucaggu uaucaacuca caacguuauc 420

aaugcagaag augcaccagg aagacccuac gaaauuggaa ccucaggguc uugcccuaac 480

auuaccaaug gaaacggauu cuucgcaaca auggcuuggg ccgucccaaa aaacaaaaca 540

gcaacaaauc cauuaacaau agaaguacca uacauuugua cagaaggaga agaccaaauu 600

accguuuggg gguuccacuc ugacagcgag acccaaaugg caaagcucua uggggacuca 660

aagccccaga aguucaccuc aucugccaac ggagugacca cacauuacgu uucacagauu 720

gguggcuucc caaaucaaac agaagacgga ggacuaccac aaaguggcag aauuguuguu 780

gauuacaugg ugcagaaauc uggaaaaaca ggaacaauua ccuaucaaag agguauuuua 840

uugccucaaa agguguggug cgcaaguggc aggagcaagg uaauaaaagg auccuugccc 900

uuaauuggag aagcagauug ccuccaugaa aaauacggug gauuaaacaa aagcaagccu 960

uacuacacag gggaacaugc aaaggccaua ggaaauugcc caauaugggu gaaaacaccc 1020

uugaagcugg ccaauggaac caaauauaga cccccugcaa aacuauuaaa ggaaagaggu 1080

uucuucggag ccauugcugg uuucuuagag ggaggauggg aaggaaugau ugcagguugg 1140

cacggauaca caucccaugg ggcacaugga guagcggugg cagcugaccu uaagagcacu 1200

caagaggcca uaaacaagau aacaaaaaau cucaacucuu ugagugagcu ggaaguaaag 1260

aaucuucaaa gacuaagcgg ugccauggau gaacuccaca acgaaauacu agaacuagau 1320

gagaaagugg augaucucag agcugauaca auaagcucac aaauagaacu cgcaguccug 1380

cuuuccaaug aaggaauaau aaacagugaa gaugaacauc ucuuggcgcu ugaaagaaag 1440

cugaagaaaa ugcugggccc cucugcugua gagauaggga auggaugcuu ugaaaccaaa 1500

cacaagugca accagaccug ucucgacaga auagcugcug guaccuuuga ugcaggagaa 1560

uuuucucucc ccaccuuuga uucacugaau auuacugcug caucuuuaaa ugacgacgga 1620

uuggacaauc auacuauacu gcuuuacuac ucaacugcug ccuccaguuu ggcuguaaca 1680

cugaugauag cuaucuuugu uguuuauaug gucuccagag acaauguuuc uugcuccauu 1740

ugucuauaa 1749

<210> 22

<211> 1755

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 1 (B/Yamagata) RNA ORF

<400> 22

augaaagcaa uaauagugcu gcugauggug gugaccagca acgccgacag gaucugcacc 60

ggcaucacca gcagcaacag cccccacgug gugaagacag ccacccaggg cgaggugaac 120

gugaccggag ugauaccacu gacaacaaca ccaacaaagu cuuacuucgc caaccugaag 180

ggcaccagga cccggggcaa gcugugcccc gacugccuga acugcaccga ucuggaugug 240

gcccuggggc ggccuaugug cguggggacc acccccagcg ccaaggccag cauccugcac 300

gaggugcggc cugugaccag cggcugcuuu ccuaucaugc acgauaggac caagaucagg 360

cagcugccca accugcugcg gggcuacgag aagauccggc ugagcaccca gaacgugauc 420

gacgccgaga aggcccccgg cgggcccuac aggcugggca ccuccgggag cugccccaac 480

gccacaucca agaucggcuu cuucgccacc auggccuggg ccgugcccaa ggacaacuac 540

aagaacgcca ccaauccacu gaccguggag gugcccuaca ucuguaccga gggcgaggac 600

cagaucaccg uguggggcuu ccacagcgau gacaagacac agaugaaguc ccuguacggc 660

gacagcaacc cccagaaguu caccagcucc gccaacggcg ugaccaccca cuacgugagc 720

cagauugggg acuuccccga ccagaccgag gacgggggcc ugccccaguc uggccgcauc 780

gugguggacu acaugaugca gaagcccggc aagaccggga ccaucgugua ccagcggggc 840

gugcugcugc cccagaaggu guggugcgcc agcgggcgga gcaaggugau caagggcagu 900

cugccucuga ucggcgaggc agacugccug cacgaggagu auggcggacu gaacaagucc 960

aagccauacu acaccggcaa gcacgccaag gccauuggca acugccccau cugggugaag 1020

accccccuga agcuggccaa uggcaccaag uaccgcccuc cagccaagcu gcugaaggag 1080

cggggcuucu ucggcgccau cgccggcuuc cuggagggcg gcugggaggg caugaucgcc 1140

ggcuggcacg gauacaccag ccacggcgcc cacggcgugg ccguggccgc cgaccugaag 1200

uccacccagg aggccauaaa caagaucacc aagaacuuga acagccugag cgagcuggag 1260

gugaagaacc uccagcggcu guccggcgcc auggacgagc ugcacaacga gauccuggag 1320

cuggacgaga agguggacga ucugagagcu gacaccauca gcucucagau cgagcuggcc 1380

gugcugcuga gcaacgaggg caucaucaac agcgaggaug agcaccugcu ggcccuggag 1440

cggaagcuga agaagaugcu ggggcccagc gccguggaca ucggcaacgg cugcuucgag 1500

accaagcaca agugcaauca gaccugucug gacaggaucg ccgccggcac cuucaacgcc 1560

ggcgaguucu cccugcccac cuucgacagc cugaacauca ccgccgccag ccugaacgac 1620

gacgggcugg acaaccacac cauccugcug uacuacucca ccgccgccag cagccuggcc 1680

gugacccuga ugcuggccau cuucaucgug uacaugguga gcagggacaa ugugucuugc 1740

uccaucugcc uguga 1755

<210> 23

<211> 1755

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 2 (B/Yamagata) RNA ORF

<400> 23

augaaagcaa uaaucgugcu gcugauggug gugaccagca augccgacag gauuugcacc 60

ggcaucacca gcagcaacuc cccccaugug gugaagaccg ccacacaggg ggaggugaau 120

gugacaggcg ugaucccucu gaccaccaca cccaccaagu ccuacuucgc caaccugaag 180

gggacccgga cccggggcaa gcugugucca gacugucuga acugcacaga ucuggacgug 240

gcccugggcc ggcccaugug cguggggacc acccccagcg ccaaggccag cauccugcac 300

gaggugaggc ccgugacuag cggcugcuuu ccuaucaugc acgauaggac caagauuagg 360

cagcugccua aucugcugcg cggcuaugag aagaucaggc uguccaccca gaaugugauc 420

gacgccgaga aggcucccgg cggccccuac cggcugggca ccucuggcuc augcccuaac 480

gccaccucca agauuggguu cuuugccacc auggccuggg ccgugcccaa ggacaacuac 540

aagaacgcca ccaacccccu gacuguggag gugcccuaca ucugcacaga gggggaggau 600

cagaucaccg uguggggcuu ccacucugac gacaagaccc agaugaaguc ccuguacggu 660

gauucuaauc cccagaaguu caccagcucc gccaauggcg ugaccaccca cuacgucucc 720

cagauugggg acuuccccga ccagaccgag gacgggggcc ugccccaguc ugggagaauc 780

gugguggacu acaugaugca gaagcccggg aagaccggga ccaucgugua ccagcggggc 840

gugcugcugc cccagaaggu guggugcgcc agcgggcgga gcaaggugau caagggcagu 900

cugccucuga ucggagaggc agacugccug cacgaggagu auggcggacu gaacaagucc 960

aagccauacu acaccggcaa gcacgccaag gccauuggca acugcccaau cugggugaag 1020

acaccccuga agcuggcgaa cggcaccaag uaccgcccuc cagccaagcu gcugaaggag 1080

cggggcuucu ucggugccau ugccggcuuu cuggagggcg gcugggaggg caugaucgcc 1140

ggcuggcacg gcuacaccag ccauggcgcc cauggcgugg ccguggcagc cgaccugaag 1200

uccacccagg aggcuaucaa caagauuacc aagaaucuga auagccugag cgagcuggag 1260

gugaagaacc uccagcggcu guccggcgcc auggaugagc ugcacaacga gauccuggag 1320

cuggacgaga agguggacga ucugagagcu gauaccauca gcucucagau cgagcuggcc 1380

guguuacugu ccaacgaggg caucaucaac agcgaggaug agcaccugcu ggcgcuggag 1440

cgcaagcuga agaagaugcu gggccccagc gccguggaca ucggcaacgg cugcuucgag 1500

accaagcaca agugcaacca gaccugccug gaccggaucg ccgccgggac cuucaacgca 1560

ggcgaguuca gccugcccac auucgacagc cugaacauca cagccgccag ccugaacgac 1620

gauggccugg acaaccacac cauccugcug uacuacagca cagccgcuag cagccuggcc 1680

gugacccuga ugcuggccau cuucaucgug uacaugguca gcagggacaa cguguccugc 1740

agcauuugcc uguga 1755

<210> 24

<211> 1755

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 3 (B/Yamagata) RNA ORF

<400> 24

augaaagcaa uaauagugcu gcugauggug gugaccagca augcagaucg gaucugcacu 60

ggcaucacca gcagcaacuc cccccaugug gugaagaccg ccacacaggg ggaggugaac 120

gugaccggcg ugauaccacu cacaacaaca ccaacaaaga gcuacuucgc caaccugaag 180

gggacucgga cacggggcaa gcugugcccc gacugucuga acugcacuga ucuggacgug 240

gcccuggggc ggccuaugug cguggggacc acccccagcg caaaggccuc uauccugcau 300

gaggugcggc cagugaccuc uggcugcuuc cccaucaugc acgauagaac caagauuagg 360

cagcugccua aucugcuccg gggcuacgag aagaucaggc uguccaccca gaacgucauc 420

gacgccgaga aggcccccgg ggggccuuac cggcugggga ccagcggaag uugccccaac 480

gcaacuucca agauuggguu cuuugccacc auggccuggg ccgugcccaa ggacaacuac 540

aagaacgcca ccaauccccu gacgguggag gugcccuaca ucugcaccga gggggaggau 600

cagaucaccg uguggggcuu ccacucugac gacaagacuc agaugaaguc ccuguacggu 660

gauucuaauc cccagaaguu caccagcucc gccaauggcg ugaccaccca cuacgucucc 720

cagauugggg acuuccccga ccagaccgag gacgggggcc ugccccaguc ugggagaauc 780

gugguggacu acaugaugca gaagcccggg aagaccggga ccaucgugua ccagcggggc 840

gugcugcugc cccagaaggu guggugcgcc agcgggcgga gcaaggugau caagggcagu 900

cugccucuga ucggagaggc agacugccug cacgaggagu auggcggacu gaacaagucc 960

aagccauacu acaccggcaa gcacgccaag gccauuggca acugcccaau cugggugaag 1020

acaccccuga agcuggccaa cggcaccaag uacaggcccc ccgccaagcu ccugaaggag 1080

cggggcuuuu ucggcgccau cgcuggcuuu uuagaaggag gaugggaagg gaugaucgcc 1140

ggcuggcacg gcuacaccag ccauggcgcc cauggcgugg ccguggcagc cgaccugaag 1200

uccacccagg aggcuaucaa caagauuacc aagaaucuga auagccucag cgagcuggag 1260

gugaagaacc uccagcggcu guccggcgcc auggaugagc ugcacaacga gauccuggag 1320

cuggacgaga agguggacga ucugagagcu gauaccauca gcucucagau cgagcuggcc 1380

gugcugcugu caaaugaagg cauuaucaac agcgaggacg agcaucuucu ggcccuggag 1440

aggaagcuga agaagaugcu cggccccucc gcuguugaua ucggcaacgg gugcuuugag 1500

acaaagcaca agugcaacca gaccugucug gaccggaucg ccgccggcac cuucaaugcc 1560

ggcgaguuuu cccugcccac auuugacagc cugaauauua cagcagccag ccugaacgac 1620

gacgggcugg acaaccacac cauccugcug uauuauucaa ccgcggccag cucccuggcc 1680

gugacacuga ugcuggccau cuucaucgug uacaugguga gccgggacaa cgugagcugc 1740

agcaucugcc uguga 1755

<210> 25

<211> 1755

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 4 (B/Yamagata) RNA ORF

<400> 25

augaaagcga uaauagugcu gcugauggug gugaccagca augccgacag gauuugcacc 60

ggcaucacca gcagcaacag cccacacgug gugaagacag cuacccaagg agaagugaac 120

gucacaggag ugauaccacu gacaacaaca ccaacaaaga gcuacuucgc caaccugaag 180

ggcacucgga cacggggcaa gcugugcccc gacugucuga acugcaccga ucuggacgug 240

gcccugggga ggcccaugug cgugggcaca acccccuccg ccaaggccuc uauccugcau 300

gaggugcggc cagugaccuc uggcugcuuc cccaucaugc acgauagaac caagauccgg 360

cagcugccca accugcugcg cggauacgag aagauucggc ugucaacaca gaacgugauu 420

gacgccgaga aggcccccgg aggucccuac cggcugggga ccuccggguc cugcccaaau 480

gccaccagca agauuggguu cuucgccacc auggccuggg ccgugcccaa ggacaauuau 540

aagaacgcca ccaauccacu gaccguggag gugccuuaua uuuguaccga gggcgaggac 600

cagaucaccg uguggggcuu ccacagugac gacaagacgc agaugaaguc acuguauggg 660

gauagcaauc cccagaaguu cacuucaucu gccaaugggg ugaccaccca cuacgucagu 720

cagaucgggg acuuccccga ucagacugag gauggggguc ugccccaguc cgggcgcauc 780

gugguggacu acaugaugca gaagcccgga aagaccggca ccaucgugua ccagcgcggg 840

gugcugcugc cucagaaggu cuggugcgcc agcggucggu cuaaggugau caaggggagc 900

cugccccuga ucggcgaggc cgacugccug cacgaggagu auggcggacu gaacaagucc 960

aagccauacu acacugggaa gcaugccaag gccauuggca acugcccuau cugggugaag 1020

accccccuga agcuggccaa cgggaccaag uaccggcccc cugccaagcu gcugaaggag 1080

cggggcuucu ucggcgccau cgccggauuc cuggagggcg gcugggaggg caugaucgcc 1140

ggguggcaug gcuacaccag ccauggcgcc cacggcgugg ccgucgcagc cgaccucaag 1200

agcacucagg aggcgaucaa caagaucacc aagaaccuga acucucugag cgagcuggag 1260

gugaagaacc uccagcggcu cagcggcgcc auggacgagc uccacaacga gauccuggag 1320

cuggaugaga agguggacga ccugcgcgcc gacaccauca gcagccagau cgagcuggcu 1380

gugcuccuga gcaacgaggg caucaucaac agcgaggaug agcaccuccu ggcucuggag 1440

cggaagcuga agaagaugcu gggccccagc gccgucgaca ucggcaacgg gugcuucgag 1500

accaagcaca agugcaacca gacgugccug gaccggaucg ccgccggcac guucaacgca 1560

ggcgaguucu cucugcccac cuucgacagc cugaacauca ccgcugccag ccugaacgac 1620

gacgggcugg acaaccacac cauccugcug uacuacagca ccgccgccag cagccuggcg 1680

gugacacuga ugcuggccau cuucaucgug uacauggugu cucgcgacaa cgugagcugc 1740

agcaucugcc uguga 1755

<210> 26

<211> 1755

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 5 (B/Yamagata) RNA ORF

<400> 26

augaaagcaa uaauagugcu gcugauggug gugaccagca augcagaucg gaucugcacu 60

ggcaucacca gcagcaacuc cccccacgug gugaagaccg ccacgcaggg agaagugaau 120

gucacaggag ugauaccacu gacaacaaca ccaacaaaga gcuacuucgc caaccugaag 180

ggcacucgga cucggggcaa gcugugcccc gacugucuga acugcacgga ucuggacgug 240

gcgcugggga ggcccaugug cgugggcacu acccccagcg ccaaggccag cauccugcac 300

gaggugcggc ccgugacuag ugggugcuuu cccauuaugc acgaccgcac caagauuagg 360

cagcugccua aucuccuccg gggguacgag aagauucggc ugucgacaca gaaugugauc 420

gacgccgaga aggcccccgg agggcccuac agguugggga ccaguggcuc uugcccaaau 480

gcuacaucca agaucggguu cuuugccacc auggccuggg ccgugcccaa ggacaauuac 540

aagaaugcca ccaauccccu gacgguggag gugcccuaca ucugcaccga gggggaggau 600

cagaucaccg uguggggcuu ccacucugac gacaagacgc agaugaaguc ccuguacggu 660

gauucuaauc cccagaaguu caccagcucc gccaauggcg ucaccaccca cuacgucucc 720

cagauugggg acuuccccga ucagaccgag gaugggggac ugccccaguc ugggagaauc 780

gugguggacu acaugaugca gaagcccggc aagacuggua caaucgugua ccagcggggc 840

gugcuucugc cucagaaggu guggugcgcc agcgggcgga gcaaggugau caagggcagu 900

cugccgcuca ucggagaggc agacugccug cacgaggagu acggcgggcu caacaagagc 960

aagccguacu acaccggcaa gcacgccaag gccauuggca auugcccgau cugggugaag 1020

accccucuga agcuggccaa cgggacgaag uaucgucccc cggccaagcu ucugaaggag 1080

aggggcuucu ucggggccau cgccggauuc uuagaaggcg gcugggaagg uaugauugcu 1140

ggguggcacg gguacaccag ccacggcgcc cacggggucg ccguggcugc cgaccugaag 1200

uccacccagg aggcgaucaa caagaucacc aagaaccuga acucgcucag cgagcuggag 1260

gugaagaacc uccagcggcu gagcggggcc auggacgagc uccacaacga gauccuggag 1320

cucgacgaga agguggacga ucugagagcu gauaccauca gcucucagau cgagcuggcg 1380

gugcuccugu ccaaugaggg gaucaucaac ucagaggacg agcaccugcu ggcucuggag 1440

agaaagcuga agaagaugcu ggguccaagc gcggucgaca ucggcaacgg gugcuucgag 1500

acgaagcaca agugcaacca gaccugcuug gaccgcaucg ccgccggcac cuucaaugcc 1560

ggcgaguuuu cucuccccac cuucgacagc cugaacauca cggcugccag ccugaacgac 1620

gacgggcugg acaaucauac cauccugcug uacuacagca cagccgccuc cagccuggcg 1680

gugacccuga ugcucgccau auucaucgug uauaugguga gcagggacaa cguguccugu 1740

agcauuugcc uguga 1755

<210> 27

<211> 1755

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 6 (B/Yamagata) RNA ORF

<400> 27

augaaagcaa uaaucgugcu gcugauggug gugaccagca augcagaucg gaucugcacu 60

ggcaucacca gcagcaacuc cccccacgug gugaagaccg ccacgcaggg ggagguaaau 120

guuacaggcg uuaucccguu gaccacgacu cccacgaagu ccuacuucgc caaccugaag 180

gggacuagga cucgugggaa gcugugcccg gacugcuuga auuguaccga ucuugacgug 240

gcccuggggc ggccuaugug cguggggacc accccgagcg caaaggccuc gauccugcau 300

gaggugcgcc cggugaccuc cgggugcuuc cccaucaugc acgaucgaac caagauucgg 360

cagcugccga aucugcuccg gggcuacgag aagauccggc ugucgacaca gaaugugauc 420

gacgccgaga aggccccagg cgggcccuac cgccugggga cuucugggag cugccccaac 480

gccacgucga agaucggcuu cuucgccacg auggcguggg caguucccaa ggacaauuac 540

aagaacgcua cuaacccccu cacgguggag guccccuaca ucugcacaga gggggaggac 600

cagaucaccg uguggggguu ucauagcgac gacaagacgc agaugaaguc acuuuauggg 660

gauagcaauc cccagaaguu cacuucaucu gcgaacgggg ugaccaccca uuacgucagu 720

cagaucgggg acuuccccga ucagacugag gauggggguc ucccccaguc cgggcgcauc 780

guggucgacu acaugaugca gaagccgggc aagaccggca ccaucgugua ccagaggggg 840

gucuugcugc cccagaaggu cuggugugcu agcggucggu cuaaggugau caagggcucc 900

cugcccuuga ucggcgaggc cgacugcuug cacgaggagu acggcgggcu caacaagagc 960

aagccguacu acaccggcaa gcacgccaag gccaucggga acugcccgau cugggucaag 1020

accccccuca agcuggcgaa cgguaccaag uaccguccgc cagcgaagcu ccucaaggag 1080

aggggcuucu ucggggcgau cgcaggauuc uuagaaggag ggugggaagg gaugaucgcc 1140

ggcuggcaug guuacaccag ccacggcgcc cacggggucg ccguggcugc cgaccugaag 1200

uccacacagg aggccaucaa caagaucacc aagaaccuga acucgcucag cgagcuggag 1260

gugaagaacc uccagcggcu gagcggggcc auggacgagc uccauaacga gaucuuggag 1320

cucgacgaga agguggacga ucugcgagca gauaccauca gcucgcagau cgagcuagcg 1380

gugcuccugu ccaacgaggg gaucaucaac ucggaggacg agcaccugcu ggcucuugag 1440

cggaagcuca agaagauguu ggggccuucu gccguggaca ucgggaacgg gugcuucgag 1500

acgaagcaca aguguaacca gacgugccug gaccgcaucg cggccggcac guucaacgcc 1560

ggcgaguuuu cccuucccac cuucgauagu cugaacauca cggccgcguc guugaacgac 1620

gacggccuug auaaucacac uauccugcug uacuacagua cagcagccuc cagccuggcg 1680

gucacccuga ugcucgccau auucaucgug uauaugguga gcagggauaa cguguccugu 1740

agcauuugcc uguga 1755

<210> 28

<211> 1755

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 7 (B/Yamagata) RNA ORF

<400> 28

augaaggcca ucaucgugcu gcugauggug gugaccagca acgccgacag gaucugcacc 60

ggcaucacca gcagcaacag cccccacgug gugaagaccg ccacccaggg cgaggugaac 120

gugaccggcg ugaucccccu gaccaccacc cccaccaaga gcuacuucgc caaccugaag 180

ggcaccagga ccagaggcaa gcugugcccc gacugccuga acugcaccga ccuggacgug 240

gcccugggca ggcccaugug cgugggcacc acccccagcg ccaaggccag cauccugcac 300

gaggugagac ccgugaccag cggcugcuuc cccaucaugc acgacagaac caagaucagg 360

cagcugccca accugcugag gggcuacgag aagaucaggc ugagcaccca gaacgugauc 420

gacgccgaga aggcccccgg cggccccuac agacugggca ccagcggcag cugccccaac 480

gccaccagca agaucggcuu cuucgccacc auggccuggg ccgugcccaa ggacaacuac 540

aagaacgcca ccaacccccu gaccguggag gugcccuaca ucugcaccga gggcgaggac 600

cagaucaccg uguggggcuu ccacagcgac gacaagaccc agaugaaguc ccuguacggc 660

gacagcaacc cccagaaguu caccagcagc gccaacggcg ugaccaccca cuacgugagc 720

cagaucggcg acuuccccga ccagaccgag gacggcggcc ugccccagag cggcagaauc 780

gugguggacu acaugaugca gaagcccggc aagaccggca ccaucgugua ccagaggggc 840

gugcugcugc cccagaaggu guggugcgcc agcggcagga gcaaggugau caagggcagc 900

cugccccuga ucggcgaggc cgacugccug cacgaggagu acggcggccu gaacaagagc 960

aagcccuacu acaccggcaa gcacgccaag gccaucggca acugccccau cugggugaag 1020

accccccuga agcuggccaa cggcaccaag uacaggcccc ccgccaagcu gcugaaggag 1080

aggggcuucu ucggcgccau cgccggcuuc cuggagggcg gcugggaggg caugaucgcc 1140

ggcuggcacg gcuacaccag ccacggcgcc cacggcgugg ccguggccgc cgaccugaag 1200

uccacccagg aggccaucaa caagaucacc aagaaccuga acagccugag cgagcuggag 1260

gugaagaacc ugcagaggcu gagcggcgcc auggacgagc ugcacaacga gauccuggag 1320

cuggacgaga agguggacga ccugagagcc gacaccauca gcagccagau cgagcuggcc 1380

gugcugcuga gcaacgaggg caucaucaac agcgaggacg agcaccugcu ggcccuggag 1440

aggaagcuga agaagaugcu gggccccagc gccguggaca ucggcaacgg cugcuucgag 1500

accaagcaca agugcaacca gaccugccug gacaggaucg ccgccggcac cuucaacgcc 1560

ggcgaguuca gccugcccac cuucgacagc cugaacauca ccgccgccag ccugaacgac 1620

gacggccugg acaaccacac cauccugcug uacuacagca ccgccgccag cagccuggcc 1680

gugacccuga ugcuggccau cuucaucgug uacaugguga gcagggacaa cgugagcugc 1740

agcaucugcc uguga 1755

<210> 29

<211> 1755

<212> RNA

<213> Artificial Sequence

<220>

<223> Ori (B/Yamagata) RNA ORF

<400> 29

augaaggcaa uaauuguacu acucauggua guaacaucca acgcagaucg aaucugcacu 60

gggauaacau cuucaaacuc accucaugug gucaaaacag cuacucaagg ggaggucaau 120

gugacuggcg ugauaccacu gacaacaaca ccaacaaaau cuuauuuugc aaaucucaaa 180

ggaacaagga ccagagggaa acuaugcccg gacugucuca acuguacaga ucuggaugug 240

gccuugggca ggccaaugug uguggggacc acaccuucug cuaaagcuuc aauacuccau 300

gaggucagac cuguuacauc cgggugcuuu ccuauaaugc acgacagaac aaaaaucagg 360

caacuaccca aucuucucag aggauaugaa aagaucaggu uaucaaccca aaacguuauc 420

gaugcagaaa aagcaccagg aggacccuac agacuuggaa ccucaggauc uugcccuaac 480

gcuaccagua aaaucggauu uuuugcaaca auggcuuggg cugucccaaa ggacaacuac 540

aaaaaugcaa cgaacccacu aacaguggaa guaccauaca uuuguacaga aggggaagac 600

caaauuacug uuuggggguu ccauucggau gacaaaaccc aaaugaaaag ccucuaugga 660

gacucaaauc cucaaaaguu caccucaucu gcuaauggag uaaccacgca uuauguuucu 720

cagauuggcg acuucccaga ucaaacagaa gacggaggac uaccacaaag cggcagaauu 780

guuguugauu acaugaugca aaaaccuggg aaaacaggaa caauugucua ucaaaggggu 840

guuuuguugc cucaaaaggu guggugcgcg aguggcagga gcaaaguaau aaaaggguca 900

uugccuuuaa uuggugaagc agauugccuu caugaagaau acgguggauu aaacaaaagc 960

aagccuuacu acacaggaaa acaugcaaaa gccauaggaa auugcccaau auggguaaaa 1020

acaccuuuga agcuugccaa uggaaccaaa uauagaccuc cugcaaaacu auugaaggaa 1080

agggguuucu ucggagcuau ugcugguuuc cuagaaggag gaugggaagg aaugauugca 1140

gguuggcacg gauacacauc ucacggagca cauggagugg caguggcggc agaccuuaag 1200

aguacacaag aagcuauaaa uaagauaaca aaaaaucuca auucuuugag ugaacuagaa 1260

guaaagaacc uucaaagacu aaguggugcc auggaugaac uccacaacga aauacucgag 1320

cuggaugaaa aaguggauga ucucagagcu gacacuauaa gcucacaaau agaacuugca 1380

gucuugcuuu ccaacgaagg aauaauaaac agugaagacg agcaucuauu ggcacuugag 1440

agaaaacuaa agaaaaugcu gggucccucu gcuguagaca uaggaaacgg augcuucgaa 1500

accaaacaca aaugcaacca gaccugcuua gacaggauag cugcuggcac cuuuaaugca 1560

ggagaauuuu cucuccccac uuuugauuca uugaacauua cugcugcauc uuuaaaugau 1620

gauggauugg auaaccauac uauacugcuc uauuacucaa cugcugcuuc uaguuuggcu 1680

guaacauuaa ugcuagcuau uuuuauuguu uauauggucu ccagagacaa cguuucaugc 1740

uccaucuguc uauaa 1755

<210> 30

<211> 17

<212> DNA

<213> Artificial Sequence

<220>

<223> T7 promoter

<400> 30

taatacgact cactata 17

<210> 31

<211> 64

<212> DNA

<213> Artificial Sequence

<220>

<223> 5' UTR

<400> 31

aggaaattcc atttggctgc agcttctgga gggagccgac aggagacgtg gggagacggc 60

cacc 64

<210> 32

<211> 94

<212> DNA

<213> Artificial Sequence

<220>

<223> 3' UTR

<400> 32

gctgccttct gcggggcttg ccttctggcc atgcccttct tctctccctt gcacctgtac 60

ctcttggtct ttgaataaag cctgagtagg aagt 94

<210> 33

<211> 75

<212> DNA

<213> Artificial Sequence

<220>

<223> poly(A)

<400> 33

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 60

aaaaaaaaaa aaaaa 75

<210> 34

<211> 1934

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 1 (H1N1) mRNA

<400> 34

aggaaauucc auuuggcugc agcuucugga gggagccgac aggagacgug gggagacggc 60

caccaugaaa gcaauauuag uggugaugcu guacaccuuc accacagcca augccgacac 120

ccugugcauu ggcuaccacg ccaacaacag caccgacacu guggacaccg ugcuggagaa 180

gaaugugacc gugacccaca gcgugaaccu gcuggaggac aagcacaaug gcaagcugug 240

caagcugcgg gggguggccc cacugcaccu gggcaagugc aacaucgccg gcuggauucu 300

gggcaaccca gagugcgaga gccugagcac ugcccggagc ugguccuaca ucguggagac 360

cagcaacagc gacaacggca ccugcuaccc cggggacuuc aucaacuacg aggagcugag 420

ggagcagcug agcuccguga gcuccuucga gagguucgag aucuucccca agaccagcuc 480

uuggcccaac cacgacagcg acaacggcgu gaccgccgcc ugcccucacg ccggggccaa 540

gagcuucuac aagaaccuga ucuggcuggu gaagaagggg aaaagcuacc ccaagaucaa 600

ccagaccuac aucaacgaca aaggaaaaga aguguuagug cuguggggca uacaccaccc 660

ucccaccauc gccgaccagc agucccugua ccagaaugcu gaugccuacg uguucguggg 720

caccagcagg uacagcaaga aguucaagcc cgagaucgcc acccggccca aggugcggga 780

ccgggagggc cggaugaacu acuacuggac ccugguggag cccggggaca agaucaccuu 840

cgaggccacc ggcaaccugg uggccccccg guacgccuuc accauggaga gagaugccgg 900

cagcggcauc aucaucuccg acacccccgu gcacgacugc aacaccacuu gccagacccc 960

ugagggggcc aucaacaccu cucugcccuu ccagaaugug caccccauca ccaucggcaa 1020

gugccccaag uacgugaagu ccaccaagcu gaggcuggcc accggccugc ggaacgugcc 1080

cagcauccag agccggggcc uguucggcgc caucgccggc uucaucgagg gcggcuggac 1140

cggcauggug gacggcuggu acggcuacca ccaccagaau gagcaggggu ccggcuacgc 1200

cgccgaucug aaguccaccc agaacgccau cgacaagauc accaacaagg ugaacuccgu 1260

gaucgagaag augaacaccc aguucaccgc cgugggcaag gaguucaauc aucuggagaa 1320

gcggaucgag aaccugaaca agaaggugga cgauggcuuu cuggacaucu ggacuuacaa 1380

ugccgagcug cuggugcugc uggagaacga gcggacacug gacuaucacg acagcaacgu 1440

gaagaaucug uacgagaagg ugcggaacca gcugaagaac aaugccaagg agauuggcaa 1500

cggcugcuuc gaguucuacc acaaguguga caacacuugc auggagagcg ugaagaacgg 1560

caccuacgac uaccccaagu acagcgagga ggccaagcug aaccgggaga agaucgacgg 1620

cgugaagcug gacuccacca ggaucuacca gauccuggcc aucuacagca ccguggccag 1680

cagccuggug cugguggugu cccugggcgc caucucauuc uggaugugca gcaacggguc 1740

ccugcagugu cggaucugua ucugagcugc cuucugcggg gcuugccuuc uggccaugcc 1800

cuucuucucu cccuugcacc uguaccucuu ggucuuugaa uaaagccuga guaggaagua 1860

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1920

aaaaaaaaaa aaaa 1934

<210> 35

<211> 1934

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 2 (H1N1) mRNA

<400> 35

aggaaauucc auuuggcugc agcuucugga gggagccgac aggagacgug gggagacggc 60

caccaugaaa gcaauacucg uggugaugcu guacaccuuc accacugcaa augccgacac 120

ucugugcauu ggcuaccacg ccaauaacag cacagacacu guggacacgg uccuggagaa 180

gaacgugacc gugacccaca gugugaaccu gcuggaggac aagcacaacg gaaagcugug 240

caagcugaga ggaguugccc cccuccaccu ggggaagugc aacaucgccg gguggauccu 300

gggcaacccc gagugugaga gccugagcac cgccaggagc ugguccuaca ucguggagac 360

cagcaauucu gauaauggga ccugcuaccc cggcgauuuc aucaacuacg aggagcugag 420

ggagcagcug agcuccguca gcuccuucga gcgcuucgag aucuucccca agaccagcuc 480

uuggcccaac caugacagcg acaacggcgu gaccgccgcu uguccucaug ccggggccaa 540

gagcuucuac aagaaccuga ucuggcuggu gaagaagggg aaaagcuacc ccaagaucaa 600

ccagaccuac aucaacgaca aggggaagga ggugcucgug cuguggggga uacaccaccc 660

ucccacaauc gccgaccagc agucccugua ucagaaugcu gaugccuacg uguucguggg 720

caccagcagg uacaguaaga aguucaagcc ugagaucgcg acccgcccca aggugcggga 780

ucgcgagggc aggaugaacu auuacuggac ccugguggag ccaggcgaca agaucacauu 840

cgaggccacc ggcaaccugg uggccccccg guacgccuuc accauggagc gcgaugccgg 900

gucugggauc aucaucucag acacacccgu gcacgacugu aacaccaccu gccagacccc 960

ugagggggca aucaacacca gccugcccuu ucagaaugug caucccauca ccauugggaa 1020

gugucccaag uacgugaaaa gcacaaagcu caggcuggcc accggccuga ggaacgugcc 1080

cucaauccag agccggggcc uguucggggc caucgccggc uucauugagg gcggguggac 1140

uggcauggug gacgguuggu acggguacca ccaccagaac gagcagggca gcggcuacgc 1200

cgcugaccug aaguccaccc agaacgccau cgacaagauc accaacaagg ugaacuccgu 1260

gaucgagaag augaacaccc aguucaccgc cgugggcaag gaguucaauc aucucgagaa 1320

gcggaucgag aaccugaaca agaaggugga cgauggcuuu cuggacaucu ggacuuacaa 1380

cgcagagcug cuggugcugc ucgagaacga gcggacacug gacuaccacg acagcaaugu 1440

gaagaaucug uacgagaagg ugcggaacca gcugaagaac aaugccaagg agauuggcaa 1500

cggcugcuuc gaguucuacc acaaguguga caacacuugu auggagagcg ugaagaaugg 1560

gaccuacgac uaucccaagu acagcgagga ggccaagcug aacagggaga agaucgaugg 1620

agucaagcug gacuccacca ggaucuacca gauccuggcg aucuacucca cuguggccuc 1680

cucgcugguu cugguggugu cccucggcgc caucagcuuc uggaugugcu ccaacggcag 1740

ccugcagugu cggauuugca ucugagcugc cuucugcggg gcuugccuuc uggccaugcc 1800

cuucuucucu cccuugcacc uguaccucuu ggucuuugaa uaaagccuga guaggaagua 1860

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1920

aaaaaaaaaa aaaa 1934

<210> 36

<211> 1934

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 3 (H1N1) mRNA

<400> 36

aggaaauucc auuuggcugc agcuucugga gggagccgac aggagacgug gggagacggc 60

caccaugaaa gcaauacucg uggugaugcu guacaccuuc accacugcaa augccgacac 120

ccugugcauc ggguaccaug ccaauaauuc uaccgacacc guggacacgg uguuggagaa 180

gaaugugacg gugacacauu cugugaaccu ccuggaggac aagcacaacg gcaaguugug 240

caagcuccgg gggguggccc cccugcaucu gggcaagugc aacaucgccg gcuggaucuu 300

ggggaaucca gagugcgagu cccugagcac ggcccggucu uggaguuaca ucguggagac 360

gaguaacucc gacaacggga cgugcuaccc cggggacuuc aucaacuacg aggagcugag 420

agagcagcug agcuccguca gcuccuucga gcgcuuugag aucuucccca agaccuccag 480

cuggcccaac caugacuccg acaacggagu cacggccgcu ugcccacaug cgggggccaa 540

gucauuuuau aagaaccuga ucugguuggu caagaagggu aagagcuacc cuaagaucaa 600

ccagacuuau aucaaugaca agggcaagga gguguuggug cuguggggga uacaccaccc 660

accaacaauc gcagaccagc agucccugua ccagaaugcu gaugccuacg uguucguggg 720

caccagcagg uacagcaaga aguucaagcc ugagaucgcg acccgcccca aggugcggga 780

ucgcgagggc aggaugaacu acuacuggac ucuggucgag ccuggugaca agaucaccuu 840

cgaggccacc ggaaaccugg uggccccaag guacgcuuuc accauggaga gagaugccgg 900

cagcggcauc aucaucuccg acacuccggu gcaugacugu aacacuacau gucagacacc 960

ggagggcgcc aucaacaccu ccuugcccuu ccagaaugug caccccauca caauuggcaa 1020

gugcccgaag uacgugaaaa gcacaaagcu caggcuggcc accggccuga ggaaugugcc 1080

uucaauccag ucccgcggcc ucuuuggagc caucgccggc uucauugagg gcggguggac 1140

uggaauggug gauggcuggu acggcuacca ccaccagaau gagcagggca gcggcuacgc 1200

cgcugaccug aaaagcaccc agaacgccau cgauaagauu accaacaagg ugaacagcgu 1260

gaucgagaag augaacacgc aguucaccgc uguugguaag gaguucaauc aucuggagaa 1320

gagaaucgag aaccugaaca agaagguuga cgauggcuuc cuggauauuu ggacuuacaa 1380

ugccgagcuc cuggugcugc ucgagaacga gcgcacccug gauuaucacg acagcaacgu 1440

gaagaaccug uacgagaagg uucggaacca gcugaagaau aaugccaagg agaucggcaa 1500

ugggugcuuc gaguucuacc acaaguguga caacacuugu auggagagcg ugaagaacgg 1560

caccuaugac uacccuaagu acagcgagga ggccaagcug aacagggaga agaucgaugg 1620

cgugaagcug gacagcacca ggaucuacca gauucuggca aucuacagca cgguggccag 1680

cagucugguc cugguggugu cccugggugc uaucucauuc uggaugugcu ccaacgggag 1740

ccugcagugu cggauuugca ucugagcugc cuucugcggg gcuugccuuc uggccaugcc 1800

cuucuucucu cccuugcacc uguaccucuu ggucuuugaa uaaagccuga guaggaagua 1860

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1920

aaaaaaaaaa aaaa 1934

<210> 37

<211> 1934

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 4 (H1N1) mRNA

<400> 37

aggaaauucc auuuggcugc agcuucugga gggagccgac aggagacgug gggagacggc 60

caccaugaaa gcaauauuag uggugauguu guauacauuc accaccgcca augccgacac 120

ccugugcauc ggcuaccaug cgaacaauuc cacugacacu guggacacgg uccuggagaa 180

gaacgugacc gugacccaca gugucaaccu ccuggaggac aagcacaacg gcaaguugug 240

caagcuccgg gggguggcgc cguugcacuu gggaaagugc aacaucgccg gcuggaucuu 300

ggggaauccg gagugcgagu cccugagcac ggcccggucu uggaguuaca ucguggagac 360

gaguaacucc gacaacggga cgugcuaccc cggggacuuc aucaacuacg aggagcugag 420

agagcagcug agcuccguca gcuccuucga gcgcuucgag auuuucccca agaccagcuc 480

guggccgaac caugacuccg acaacggagu cacggccgcg ugcccccacg cgggggcaaa 540

gucguuuuau aagaaccuga ucugguuggu caagaagggu aagucuuacc cuaagaucaa 600

ccagacuuau auaaacgaca agggcaagga ggugcugguc cuguggggga uacaccaccc 660

accaacaauc gcagaccagc agucgcugua ccagaaugcu gaugccuacg uguucguggg 720

caccagcagg uacagcaaga aguucaagcc ggagaucgcg acccgcccca aggugcggga 780

ucgcgagggc cggaugaacu acuauuggac ccugguggag ccaggggaca agauuaccuu 840

ugaggccaca gguaaucugg uggccccccg guacgcguuc accauggagc gcgaugccgg 900

guccgggauu auuaucucgg acacuccggu gcaugacugu aacacuacau gucagacacc 960

ggagggggcc aucaacaccu ccuugcccuu ccagaacguc cacccuauaa ccaucggcaa 1020

gugccccaag uaugugaaaa gcacgaagcu caggcuggcc accggccuga ggaacgugcc 1080

uuccauacag agcagaggac ucuuuggagc aauugcagga uuuaucgagg guggauggac 1140

uggaaugguu gauggcuggu acggguacca ccaccagaac gagcagggca gcggcuacgc 1200

cgcugaccug aagucgacgc agaaugcgau cgacaagauu accaacaagg ugaacagcgu 1260

gaucgagaag augaacacgc aguucaccgc uguugguaag gaguucaauc accucgagaa 1320

gcgcaucgag aaccugaaca agaagguuga cgauggguuu cucgauauuu ggacuuacaa 1380

cgcugagcug cugguccuuc ucgagaacga gcgcacguug gauuaccacg auuccaacgu 1440

gaagaacuug uacgagaagg uccggaacca gcucaagaac aaugccaagg agauuggcaa 1500

cgggugcuuc gaguucuauc auaagugcga uaauacaugc auggagagcg ugaagaaugg 1560

cacuuaugau uacccgaagu acucggagga ggccaagcug aaccgggaga agaucgaugg 1620

agucaagcuu gacuccacca ggaucuacca gauccuggcg aucuacucca cgguggccuc 1680

cucccucguu cuggugguga gccugggagc caucagcuuu uggauguguu cgaaugguag 1740

ccugcagugu cggauuugca ucugagcugc cuucugcggg gcuugccuuc uggccaugcc 1800

cuucuucucu cccuugcacc uguaccucuu ggucuuugaa uaaagccuga guaggaagua 1860

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1920

aaaaaaaaaa aaaa 1934

<210> 38

<211> 1934

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 5 (H1N1) mRNA

<400> 38

aggaaauucc auuuggcugc agcuucugga gggagccgac aggagacgug gggagacggc 60

caccaugaag gccauccugg uggugaugcu guacaccuuc accaccgcca acgccgacac 120

ccugugcauc ggcuaccacg ccaacaacag caccgacacc guggacaccg ugcuggagaa 180

gaacgugacc gugacccaca gcgugaaccu gcuggaggac aagcacaacg gcaagcugug 240

caagcugaga ggcguggccc cccugcaccu gggcaagugc aacaucgccg gcuggauccu 300

gggcaacccc gagugcgaga gccugagcac cgccagaagc uggagcuaca ucguggagac 360

cagcaacagc gacaacggca ccugcuaccc cggcgacuuc aucaacuacg aggagcugag 420

agagcagcug agcagcguga gcagcuucga gagguucgag aucuucccca agaccagcag 480

cuggcccaac cacgacagcg acaacggcgu gaccgccgcc ugcccccacg ccggcgccaa 540

gagcuucuac aagaaccuga ucuggcuggu gaagaagggc aagagcuacc ccaagaucaa 600

ccagaccuac aucaacgaca agggcaagga ggugcuggug cuguggggca uccaccaccc 660

ccccaccauc gccgaccagc agagccugua ccagaacgcc gacgccuacg uguucguggg 720

caccagcaga uacagcaaga aguucaagcc cgagaucgcc accagaccca aggugaggga 780

cagggagggc agaaugaacu acuacuggac ccugguggag cccggcgaca agaucaccuu 840

cgaggccacc ggcaaccugg uggcccccag auacgccuuc accauggaga gagaugccgg 900

cagcggcauc aucaucagcg acacccccgu gcacgacugc aacaccaccu gccagacccc 960

cgagggcgcc aucaacacca gccugcccuu ccagaacgug caccccauca ccaucggcaa 1020

gugccccaag uacgucaaga gcaccaagcu gaggcuggcc accggccuga ggaacgugcc 1080

cagcauccag agcagaggcc uguucggcgc caucgccggc uucaucgagg gcggcuggac 1140

cggcauggug gacggcuggu acggcuacca ccaccagaac gagcagggca gcggcuacgc 1200

cgccgaccug aaguccaccc agaacgccau cgacaagauc accaacaagg ugaacagcgu 1260

gaucgagaag augaacaccc aguucaccgc cgugggcaag gaguucaacc accuggagaa 1320

gaggaucgag aaccugaaca agaaggugga cgacggcuuc cuggacaucu ggaccuacaa 1380

cgccgagcug cuggugcugc uggagaacga gagaacccug gacuaccacg acagcaacgu 1440

gaagaaccug uacgagaagg ugaggaacca gcugaagaac aacgccaagg agaucggcaa 1500

cggcugcuuc gaguucuacc acaagugcga caacaccugc auggagagcg ugaagaacgg 1560

caccuacgac uaccccaagu acagcgagga ggccaagcug aacagggaga agaucgacgg 1620

cgugaagcug gacagcacca ggaucuacca gauccuggcc aucuacagca ccguggccag 1680

cagccuggug cuggugguga gccugggcgc caucagcuuc uggaugugca gcaacggcag 1740

ccugcagugc agaaucugca ucugagcugc cuucugcggg gcuugccuuc uggccaugcc 1800

cuucuucucu cccuugcacc uguaccucuu ggucuuugaa uaaagccuga guaggaagua 1860

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1920

aaaaaaaaaa aaaa 1934

<210> 39

<211> 1934

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 1 (H3N2) mRNA

<400> 39

aggaaauucc auuuggcugc agcuucugga gggagccgac aggagacgug gggagacggc 60

caccaugaaa acaauaaucg cccugagcua cauccugugc cugguguucg cccagaagau 120

ccccggcaac gauaacagca cagccacccu gugccugggg caccacgccg ugcccaacgg 180

caccaucgug aagaccauca ccaacgaucg gaucgaggug accaacgcca ccgagcuggu 240

gcagaacucc uccaucgggg agaucugcga cagcccccac cagauccugg augggggcaa 300

cugcacacug aucgacgccc ugcugggcga cccucagugu gacggguucc agaacaagga 360

gugggaccug uucguggagc ggagcagggc caacagcaac ugcuaccccu acgacgugcc 420

ugacuaugcc agccugcgga gccugguggc cagcagcggc acccuggagu ucaagaacga 480

gagcuucaac uggaccgggg ugaagcagaa uggcaccagc uccgccugca uucggggcag 540

cagcuccagc uucuucagcc ggcugaacug gcugacccac cugaacuaca aguacccugc 600

ccugaaugug accaugccca acaaugagca guucgacaag cuguacaucu ggggcgugca 660

ccacccccgg accgacaagg accagaucuc acuguucgcc cagcccucug ggcggaucac 720

agugagcacc aagcgcuccc agcaggccgu gauccccaac aucggaucac ggccucggau 780

ccgggacauc cccucccgga ucuccaucua cuggaccauc gugaagcccg gcgacauccu 840

gcugaucaac agcaccggca accugaucgc cccccggggc uacuucaaga ucagguccgg 900

caagagcucc aucaugcgga gcgaugcucc cauugggaag ugcaagagcg agugcaucac 960

ccccaauggg agcaucccca acgacaagcc cuuccagaac gugaaccgga ucaccuacgg 1020

cgccugcccc cgguacguga agcagagcac ccugaagcug gccaccggca ugaggaacgu 1080

gccugagaag cagacccggg gcaucuucgg cgccaucgcc ggcuucaucg agaacggcug 1140

ggagggcaug guggacggcu gguauggcuu caggcaccag aacuccgagg gccgcggcca 1200

ggccgccgau cugaagucua cccaggccgc cauugaccag aucaauggca agcugaauag 1260

acugaucggc aagaccaacg agaaguucca ccagaucgag aaggaauucu ccgaggugga 1320

gggccgggua caggaccugg agaaguacgu ggaggacacc aagaucgauc uguggagcua 1380

caacgccgag cugcuggugg cccuggagaa ccagcacacc aucgaucuga ccgacagcga 1440

gaugaacaag cuguucgaga agaccaagaa gcagcugcgg gagaaugccg aggacauggg 1500

caacggcugc uucaagaucu accacaagug ugacaacgcu uguaucggcu ccauccgcaa 1560

ugagaccuac gaccacaacg uguacaggga cgaggcccug aacaacaggu uucagaucaa 1620

ggggguggag cugaagucag gcuacaagga cuggauccug uggaucuccu ucgccaugag 1680

cugcuuccug cugugcaucg cccugcuggg guucaucaug ugggccugcc agaagggcaa 1740

caucaggugc aacaucugca ucugagcugc cuucugcggg gcuugccuuc uggccaugcc 1800

cuucuucucu cccuugcacc uguaccucuu ggucuuugaa uaaagccuga guaggaagua 1860

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1920

aaaaaaaaaa aaaa 1934

<210> 40

<211> 1934

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 2 (H3N2) mRNA

<400> 40

aggaaauucc auuuggcugc agcuucugga gggagccgac aggagacgug gggagacggc 60

caccaugaaa acaauaauag cccugagcua uauucugugc cuggucuucg cccagaagau 120

cccaggcaau gacaauagca ccgccaccuu gugccugggu caucacgccg ugccuaaugg 180

caccaucgug aagaccauca ccaacgacag gaucgaggug accaaugcua cugagcuggu 240

gcagaacagu agcauugggg agaucugcga uuccccacau cagauccugg auggggggaa 300

uugcacacug aucgacgccc ugcugggcga uccccagugu gacggguucc agaacaagga 360

gugggaccug uucguggagc ggaguagggc uaacagcaac uguuaccccu acgacguucc 420

cgacuacgcc ucccugaggu cucugguggc cagcaguggc acacuggagu ucaagaacga 480

gagcuucaac uggacaggcg ugaagcagaa cggcaccucu uccgccugua uccggggaag 540

cucuaguucu uucuucagcc ggcugaacug gcugacccac cugaacuaca aguauccagc 600

ucugaacgug accaugccca acaaugagca guucgacaag cuguauauuu ggggggugca 660

ccacccccgg accgacaagg accagaucuc ccuguucgcc cagcccucug ggcggaucac 720

cgugagcacc aagcggucuc agcaggccgu gauccccaac aucggaucac ggccucggau 780

cagggauauc cccagcagga ucuccaucua uuggaccauc gugaagccug gggauauccu 840

gcugaucaac ucuacgggca aucugauugc cccuagaggg uacuucaaga ucaggagcgg 900

caagagcucu aucaugaggu cugacgcucc uaucgggaag ugcaagagug agugcaucac 960

cccuaacgga agcaucccca acgacaagcc auuucagaac gugaacagga ucaccuacgg 1020

ggccugcccc cguuacguga agcaguccac ucugaagcug gcgacuggca ugaggaaugu 1080

ccccgagaag cagacucggg gcaucuucgg cgccaucgcc ggcuucaucg agaacggcug 1140

ggaaggaaug guagacggcu gguacggcuu ccgccaucag aacucugagg gucggggcca 1200

ggccgccgac cugaagagua cccaggccgc caucgaucag aucaauggca agcugaaucg 1260

gcugaucggc aagaccaaug agaaguucca ccagauugag aaggaguucu cagaggugga 1320

gggccgggug caggaccugg agaaguacgu ugaggacacc aagaucgacc ugugguccua 1380

caacgccgag cuccuggucg cccuggagaa ucagcacacu aucgaccuga ccgauaguga 1440

gaugaacaag cuguuugaga agaccaagaa gcagcugcgg gagaacgccg aggacauggg 1500

caacggaugc uucaagaucu accacaagug ugacaacgcu uguaucggaa gcauccggaa 1560

cgagaccuac gaccacaacg uguacaggga cgaggcccug aacaacagau uccagaucaa 1620

gggcguagag cugaagucug gcuacaaaga uuggauccug uggaucagcu ucgccauguc 1680

cugcuuucug cuguguauug cccuucuggg guucaucaug ugggccugcc agaagggcaa 1740

uaucaggugc aacaucugca ucugagcugc cuucugcggg gcuugccuuc uggccaugcc 1800

cuucuucucu cccuugcacc uguaccucuu ggucuuugaa uaaagccuga guaggaagua 1860

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1920

aaaaaaaaaa aaaa 1934

<210> 41

<211> 1934

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 3 (H3N2) mRNA

<400> 41

aggaaauucc auuuggcugc agcuucugga gggagccgac aggagacgug gggagacggc 60

caccaugaaa acaauaauag cccugagcua uauucugugc cuggucuucg cccagaagau 120

cccaggcaau gacaauagca cagccacgcu gugucugggc caccacgccg ugccaaacgg 180

caccaucgug aagacuauca ccaacgaccg gaucgaggug accaacgcca cagagcuggu 240

gcagaacucc uccaucgggg agaucugcga uuccccccac cagauccugg auggggggaa 300

uugcacacug aucgacgccc ugcugggcga uccucagugu gacggguucc agaacaagga 360

gugggaccug uucguggagc ggaguagggc uaacagcaac uguuaccccu acgacguucc 420

cgauuacgcc agucugagaa gccucguggc cagcuccggg acacuggagu ucaagaacga 480

gagcuucaau uggacuggcg ugaagcagaa ugggaccagu ucagccugca ucagagggag 540

cagcagcucc uucuucagca ggcugaacug gcugacccau cugaacuaca aguacccagc 600

ucugaacgug accaugccca acaaugagca guucgacaag cuguacaucu ggggcgugca 660

ccacccccgg accgacaagg aucagauuag ccuguucgcc cagcccucug ggcggaucac 720

ugugagcacc aagcgcucac agcaggccgu gauccccaac aucggaucac ggccucggau 780

cagggauauc cccagcagga ucuccaucua uuggacgauc gugaagccug gggauauccu 840

gcugaucaac agcacaggca aucugaucgc uccccggggg uacuucaaga uccggucugg 900

gaagucuucu aucaugagga gcgaugcucc cauugggaag ugcaagagcg agugcauuac 960

ucccaauggg agcauuccua augauaagcc cuuccagaac gugaaucgga ucaccuacgg 1020

ugccugccca cgguacguga agcagagcac ccugaagcug gcaacaggca ugcggaaugu 1080

gcccgagaag cagacucggg gcauauucgg cgccaucgcc ggcuucaucg agaacggcug 1140

ggagggcaug guggacggcu gguacggcuu ccggcaccag aacagcgagg gcagggggca 1200

ggcugccgau cugaagucua cucaggcugc cauugaucag aucaauggca agcugaauag 1260

acugaucggc aagaccaacg agaaguucca ccagaucgag aaggaauucu ccgaggugga 1320

gggccgggua caggaccugg agaaguacgu ggaggacacc aagaucgauc uguggagcua 1380

caacgcggag cugcuggugg cucucgaaaa ccagcacacc aucgacuuaa ccgacagcga 1440

gaugaacaag cuguucgaga agaccaagaa gcagcuccgc gagaacgccg aggacauggg 1500

gaaugggugc uucaagaucu accacaagug ugacaacgcu uguaucggcu ccauccgcaa 1560

ugagaccuau gaccacaacg uguacaggga cgaggcccug aacaauaggu uucagaucaa 1620

ggggguggag cugaaguccg gcuacaagga cuggaucuug uggaucucau ucgccauguc 1680

cugcuuccug cucuguauug cccuucuggg guucaucaug ugggccugcc agaagggcaa 1740

uaucagaugc aacaucugca ucugagcugc cuucugcggg gcuugccuuc uggccaugcc 1800

cuucuucucu cccuugcacc uguaccucuu ggucuuugaa uaaagccuga guaggaagua 1860

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1920

aaaaaaaaaa aaaa 1934

<210> 42

<211> 1934

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 4 (H3N2) mRNA

<400> 42

aggaaauucc auuuggcugc agcuucugga gggagccgac aggagacgug gggagacggc 60

caccaugaaa acaauaauag cccugagcua cauacuuugu uuagucuuug cccagaagau 120

uccgggcaau gacaacucga cugccacacu gugccugggg caucacgcgg ugccuaaugg 180

caccaucgug aagacgauua ccaaugaccg gaucgaggug accaacgcga cagagcuggu 240

gcagaacucc ucuauugggg agaucugcga uuccccccac cagauccugg auggggggaa 300

uugcacacug aucgacgccc ugcugggcga uccucagugu gacggguucc agaacaagga 360

gugggaccug uucguggagc ggaguagggc uaacagcaac uguuaccccu acgacguucc 420

cgauuacgcc agucugagaa gccucguggc gagcuccggg acacuggagu ucaagaacga 480

gagcuucaau uggacuggcg ugaagcagaa ugggaccagu ucagccugca uaagagggag 540

cagcagcucc uucuucagca ggcugaacug guugacccau cugaacuaca aguacccagc 600

ucugaacgug accaugccca auaaugagca guuugacaag cuguacauuu ggggcgugca 660

ccacccccgg acggacaagg aucagaucuc ccuguucgcc cagcccucug ggcggaucac 720

ugugagcacc aagcgcucac agcaggccgu gauccccaac aucggaucac ggccucggau 780

cagggauauc cccagcagga ucuccaucua uuggacgauc gugaagccug gggauauccu 840

gcugaucaac agcacaggga aucugaucgc uccccggggg uacuucaaga uccggucagg 900

gaagucgucu aucaugagga gcgaugcucc cauugggaag ugcaagagcg agugcauuac 960

ccccaauggg agcaucccua augauaagcc cuuccagaac gugaaccgga ucacguacgg 1020

ggcuugcccc agguacguga agcagucgac ucugaagcug gcgacgggca ugcggaaugu 1080

gcccgagaag cagacucggg gcauauucgg cgccaucgcc ggcuucaucg agaaugggug 1140

ggagggcaug gucgacggcu gguacggcuu ucgccaccag aacagcgagg gccggggcca 1200

ggccgccgac cugaagucca cccaggcugc cauugaucag aucaauggca agcugaaccg 1260

ucucauuggg aagaccaaug agaaguucca ucagaucgag aaggaguuca gcgaggucga 1320

ggggcggguc caggaccucg agaaguacgu cgaggacacc aagaucgacc ucuggagcua 1380

caacgcugag cuccuggugg cgcuggagaa ccagcacacc aucgaucuga cggacagcga 1440

gaugaacaag cuguucgaga agacaaagaa gcagcucagg gagaaugcag aggacauggg 1500

gaacgggugc uucaagaucu accacaagug ugacaacgcu uguaucggcu ccauccgcaa 1560

ugagaccuau gaccacaacg uguacaggga cgaggcccug aacaauaggu uucagaucaa 1620

ggggguggag cugaaguccg gcuacaagga cuggaucuug uggaucucgu ucgccauguc 1680

cugcuuccug cuguguauug cccuucuggg guucaucaug ugggccugcc agaagggcaa 1740

uaucaggugc aauaucugca uuugagcugc cuucugcggg gcuugccuuc uggccaugcc 1800

cuucuucucu cccuugcacc uguaccucuu ggucuuugaa uaaagccuga guaggaagua 1860

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1920

aaaaaaaaaa aaaa 1934

<210> 43

<211> 1934

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 5 (H3N2) mRNA

<400> 43

aggaaauucc auuuggcugc agcuucugga gggagccgac aggagacgug gggagacggc 60

caccaugaaa acaauaauag cgcugagcua cauucucugu cugguguuug cccagaagau 120

uccgggcaac gacaacagca cagccacgcu gugccuuggg caccacgcgg ugcccaacgg 180

uacgaucgug aagaccauca cgaacgaccg cauagagguc accaaugcua cugagcuggu 240

gcagaacagu agcauuggug agaucuguga uuccccccac cagauccugg auggggggaa 300

uuguacucuu auugaugcgc uguuaggcga uccgcagugc gacggguucc agaacaagga 360

gugggaccug uucguagagc ggagucgugc gaauagcaac ugcuauccgu acgacgugcc 420

agacuacgca uccuugcgua gucugguugc uuccuccggg acguuggagu ucaagaacga 480

gagcuucaac uggaccggag ugaagcagaa ugggaccagu ucagccugca uaagagggag 540

cagcagcucc uucuucagca ggcugaacug guugacccau uugaacuaca aguacccggc 600

ccucaauguu acgaugccga acaacgagca guuugauaaa uuguacaucu ggggggugca 660

ccacccccgg acugacaagg aucagauuag cuuguucgcu cagccgagcg gccguaucac 720

cguauccacc aaacgcuccc agcaagccgu gaucccgaac aucgggucac ggccucggau 780

ccgggacauc ccgucccgga ucucgauuua cuggacuauu guuaagccag gagacauucu 840

ccugauuaac aguaccggua acuugaucgc cccgagggga uacuucaaga uccgcucggg 900

gaagucaagu aucaugcgga gcgaugcucc cauugggaag ugcaagagcg agugcauuac 960

ccccaauggg agcaucccga augauaagcc guuccagaau gugaaccgca ucacguacgg 1020

ggccugcccc cgguacguga agcagucgac ccugaagcuu gccacgggga ugcggaacgu 1080

gcccgagaag cagacccgug gcaucuucgg ggcgauugcg ggguucauag agaacggcug 1140

ggaaggcaug guagacggau gguacggcuu ucggcaucag aacagugagg gccggggcca 1200

ggcagcggau cugaagagua cacaggcugc cauugaucag aucaauggca agcugaaccg 1260

ucucauuggg aagaccaaug agaaguucca ccagauagag aaggaguuca gcgaggucga 1320

gggucguguc caggaccugg agaaguacgu cgaggacacg aagaucgacc uguggaguua 1380

caacgccgag uugcuggugg cgcuggagaa ccagcacacc aucgacuuga cggacagcga 1440

gaugaacaag cuguucgaga agaccaagaa gcagcuccgc gagaacgcgg aggacauggg 1500

gaacgggugc uucaagaucu accacaagug ugacaacgcu uguaucggcu ccauccgcaa 1560

ugagaccuau gaccacaacg ucuacagaga ugaggcguug aacaauaggu uucagaucaa 1620

ggggguggag cugaaguccg gcuacaagga cuggaucuug uggaucucgu ucgccauguc 1680

cugcuucuug cuuuguauug cccuucuggg guucaucaug ugggccugcc agaagggcaa 1740

uauccguugu aacaucugca ucugagcugc cuucugcggg gcuugccuuc uggccaugcc 1800

cuucuucucu cccuugcacc uguaccucuu ggucuuugaa uaaagccuga guaggaagua 1860

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1920

aaaaaaaaaa aaaa 1934

<210> 44

<211> 1982

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 1 (B/Victoria) mRNA

<400> 44

aggaaauucc auuuggcugc agcuucugga gggagccgac aggagacgug gggagacggc 60

caccaugaaa gcaauaauag ugcugcugau gguggugacc agcaacgccg acaggaucug 120

caccggcauc accagcagca acagcccuca cguggugaag accgccaccc agggcgaggu 180

gaacgugacc ggagugauac cacugacaac aacaccaaca aagucucacu ucgccaaccu 240

gaagggcacc gagaccaggg ggaagcugug ccccaagugc cugaacugca cagaccugga 300

cguggcccug ggccggccaa agugcaccgg caagaucccc agcgcccggg ugagcauccu 360

gcacgaggug cggccuguga cauccgggug cuuuccuauc augcacgaua ggaccaagau 420

uaggcagcug ccuaaucugc ugcgggggua cgagcacgug aggcugucca cccacaacgu 480

gaucaacgcc gaggacgccc cuggacggcc uuacgagauc ggcaccuccg gcagcugccc 540

caacaucacc aacggcaacg gguucuucgc caccauggcu ugggccgugc ccaagaacaa 600

gaccgccacc aacccccuga ccaucgaggu gcccuacauc ugcaccgagg gggaggacca 660

gaucaccgua uggggcuucc acuccgacag cgagacccag auggccaagc uguacggaga 720

cagcaagccc cagaaguuca ccuccuccgc caacggcgug accacccacu acgugagcca 780

gauuggcggc uuccccaacc agaccgagga ugggggccug ccccagucug gccgcaucgu 840

gguggacuac auggugcaga aaagcggcaa gaccggcacc aucaccuacc agcggggcau 900

ccugcugccc cagaaggugu ggugcgccuc uggccgcucu aaggugauca agggcagccu 960

gccccugauc ggcgaggccg acugccugca cgagaaguac ggcgggcuga acaagagcaa 1020

gcccuacuac accggcgagc acgccaaggc cauuggcaac ugccccaucu gggugaagac 1080

cccccugaag cuggccaaug gcaccaagua ccggcccccc gccaagcugc ugaaggagcg 1140

gggcuucuuc ggcgccaucg ccggcuucuu agaaggaggc ugggaaggca ugauugcagg 1200

cuggcacggc uacaccagcc acggcgccca cggcguggcc guggccgccg accuuaagag 1260

cacccaggag gcaaucaaca agaucaccaa gaaccugaac agccugagcg agcuggaggu 1320

gaagaaccuc cagcggcugu ccggggccau ggaugagcug cacaacgaga uccuggagcu 1380

ggacgagaag guggacgauc ugagagcuga caccaucagc ucucagaucg agcuggccgu 1440

gcugcugagc aacgagggca ucaucaacag cgaggaugag caccugcugg cccuggagcg 1500

gaagcugaag aagaugcugg gccccagcgc cguggagauc ggcaacggcu gcuucgagac 1560

caagcacaag ugcaaucaga ccugucugga caggaucgcc gccggcaccu ucgacgccgg 1620

cgaguucucc cugcccaccu ucgacagccu gaacaucacc gccgccagcc ugaacgacga 1680

cgggcuggac aaccacacca uccugcugua cuacuccacc gccgccagca gccuggccgu 1740

gacacugaug aucgccaucu ucguggugua cauggugucc cgcgacaacg uguccugcuc 1800

caucugucug ugagcugccu ucugcggggc uugccuucug gccaugcccu ucuucucucc 1860

cuugcaccug uaccucuugg ucuuugaaua aagccugagu aggaaguaaa aaaaaaaaaa 1920

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1980

aa 1982

<210> 45

<211> 1982

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 2 (B/Victoria) mRNA

<400> 45

aggaaauucc auuuggcugc agcuucugga gggagccgac aggagacgug gggagacggc 60

caccaugaaa gcaauaauag ugcugcugau gguggugacc agcaaugcag aucggaucug 120

cacuggcauc accagcagca acagcccuca cguggugaag accgccaccc aaggagaagu 180

gaacgugaca ggagugauac cacugacaac aacaccaaca aagagccacu ucgcaaaccu 240

gaaggggacc gagacacggg gcaagcugug ccccaagugu cugaacugca ccgaucucga 300

uguagcccug ggccggccca agugcacugg gaagaucccc agugcacggg uguccauccu 360

gcaugaggug cggccaguga ccucuggcug cuuccccauc augcacgauc ggacaaagau 420

uaggcagcug ccuaaucugc ugcgcggcua cgagcacgug cggcugagca cccacaacgu 480

gaucaacgcu gaggaugcuc ccggccggcc auacgagauc ggcaccucug guucuugccc 540

uaacaucacc aauggcaaug gguucuuugc caccauggcu ugggccgugc ccaagaacaa 600

gacggcaacc aacccauuga ccauugaggu gcccuacauc ugcaccgagg gcgaggacca 660

gaucaccguc uggggcuucc acuccgacag cgagacccag auggccaagc uguacggaga 720

cagcaagccc cagaaguuca ccuccuccgc caauggcgug acuacccacu acgugagcca 780

gaucggcggg uuccccaacc agaccgagga ugggggccug ccccagucug gccggauugu 840

gguggacuac augguccaga aguccggcaa gacuggcacc aucaccuauc agcggggcau 900

ccugcugccc cagaaggugu ggugugccag cggucggucu aaggugauca agggcagccu 960

gcccuugauc ggcgaggccg acugccugca cgagaaguau ggcggacuga acaaguccaa 1020

gccauacuac accggggagc acgcuaaggc cauuggcaac ugccccaucu gggugaagac 1080

cccccugaag cuggccaaug gcacuaagua ccggcccccc gccaagcugc ucaaggagcg 1140

cggguucuuc ggcgccaucg ccggcuuccu ggagggaggc ugggagggca ugaucgccgg 1200

auggcacggg uacacuuccc acggcgccca cggcguggcc guggccgccg accugaagag 1260

uacccaggag gccaucaaca agaucaccaa gaaccugaac uccuugagcg agcuggaggu 1320

gaagaaccuc cagcggcugu ccggcgccau ggaugagcug cacaacgaga uccuggagcu 1380

ggacgagaag guggacgauc ugagagcaga uaccaucagc ucucagaucg agcucgccgu 1440

gcugcugucc aacgagggca ucaucaacag cgaggacgag caucuccugg cacuggagag 1500

gaaacugaag aagaugcugg gccccagcgc cguggagauc ggcaacgggu gcuuugagac 1560

aaagcacaag ugcaaccaga ccugccugga caggaucgcc gccggcaccu ucgaugccgg 1620

cgaguucucc cugcccaccu ucgacagccu gaacaucacc gcugccagcc ugaacgacga 1680

cgggcuggac aaccacacca uccugcugua cuacagcacc gcugccagcu cacuggccgu 1740

gacacugaug aucgccaucu ucguggugua caugguguca cgggacaacg ugagcugcag 1800

caucugccug ugagcugccu ucugcggggc uugccuucug gccaugcccu ucuucucucc 1860

cuugcaccug uaccucuugg ucuuugaaua aagccugagu aggaaguaaa aaaaaaaaaa 1920

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1980

aa 1982

<210> 46

<211> 1982

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 3 (B/Victoria) mRNA

<400> 46

aggaaauucc auuuggcugc agcuucugga gggagccgac aggagacgug gggagacggc 60

caccaugaaa gcaauaauag ugcucuugau gguggugaca ucuaacgcag accgcaucug 120

caccgggauc accuccagca auagccccca cguggugaag acugcgacuc aaggagaagu 180

gaacgucaca ggagugauac cacugacgac aacaccaaca aagucgcacu ucgccaaccu 240

caaggguaca gagacucgug gcaaguugug ccccaagugc cucaacugca cggaccugga 300

cguggcccug gggagaccca agugcacugg gaagauuccc agugcacggg ucuccauccu 360

gcaugaggug cgcccgguga ccuccgggug cuuccccauc augcacgauc gcacgaagau 420

ucggcagcug ccgaaucuuc ugcggggcua cgaacacgug cgguugagca cgcacaacgu 480

gauaaacgcg gaggaugcuc ccggacgucc cuacgagauu gggacguccg ggagcugucc 540

gaauaucacc aaugggaacg gcuucuucgc caccauggcg ugggccguuc ccaagaauaa 600

gacugccacg aacccucuga ccauugaggu uccguacauc uguacggagg gggaggacca 660

gauuacaguu uggggguuuc acuccgacag ugagacccag auggccaagc uguaugguga 720

cuccaagccg cagaaguuca cuucuucggc uaauggaguc accacccauu acgucaguca 780

gauugggggc uuccccaauc agacugagga ugggggccuc ccccagucug gccggauugu 840

gguggacuac augguccaga aguccggcaa gacuggcacc aucaccuacc agcggggaau 900

ccuucucccg cagaaggugu ggugcgcaag cggucggucu aaggugauca aggggagccu 960

gcccuugauc ggcgaggccg acugcuugca cgagaaguac ggcgggcuca acaagagcaa 1020

gccguacuac acaggggagc acgccaaggc gaucgggaac ugcccgaucu gggugaagac 1080

uccccugaag cuggcgaacg guaccaagua ccguccgcca gcgaagcucc ucaaggagag 1140

gggcuucuuc ggggcuauug cuggauuccu ggagggcgga ugggagggca ugauugccgg 1200

guggcauggc uacacuagcc auggcgccca cggcguugcu guggccgccg accucaagag 1260

cacccaggag gccauaaaca agaucacgaa gaaccugaac ucgcugagcg agcuggaggu 1320

gaagaaccuc cagcggcuca gcggggccau ggacgagcuc cauaacgaga ucuuggagcu 1380

cgacgagaag guggaugauc ugcgagcuga uaccaucagc ucgcagaucg agcuggcggu 1440

gcuccugucc aacgagggga ucaucaacuc ggaggacgag caccugcuag cgcuggagcg 1500

caagcucaag aagaugcuug ggcccagcgc ggucgagaua gguaaugggu gcuucgagac 1560

gaagcacaag ugcaaccaga ccugucucga ccgcaucgcc gccggcacuu uugaugccgg 1620

cgaguucagc cugccaacgu ucgacucgcu gaacaucacc gcagcgaguc ugaacgacga 1680

cgggcuggac aaucacacca uucuccucua uuacagcacc gcggccaguu cucuggccgu 1740

gacgcugaug auagcuaucu ucguggucua uauggucucc cgggacaacg ugucgugcuc 1800

gauauguuug ugagcugccu ucugcggggc uugccuucug gccaugcccu ucuucucucc 1860

cuugcaccug uaccucuugg ucuuugaaua aagccugagu aggaaguaaa aaaaaaaaaa 1920

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1980

aa 1982

<210> 47

<211> 1982

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 4 (B/Victoria) mRNA

<400> 47

aggaaauucc auuuggcugc agcuucugga gggagccgac aggagacgug gggagacggc 60

caccaugaag gccaucaucg ugcugcugau gguggugacc agcaacgccg acaggaucug 120

caccggcauc accagcagca acagccccca cguggugaag accgccaccc agggcgaggu 180

gaacgugacc ggcgugaucc cccugaccac cacccccacc aagagccacu ucgccaaccu 240

gaagggcacc gagaccaggg gcaagcugug ccccaagugc cugaacugca ccgaccugga 300

cguggcccug ggcagaccca agugcaccgg caagaucccc agcgccaggg ugagcauccu 360

gcacgaggug agacccguga ccagcggcug cuuccccauc augcacgaca gaaccaagau 420

cagacagcug cccaaccugc ugaggggcua cgagcacgug aggcugagca cccacaacgu 480

gaucaacgcc gaggacgccc ccggcagacc cuacgagauc ggcaccagcg gcagcugccc 540

caacaucacc aacggcaacg gcuucuucgc caccauggcc ugggccgugc ccaagaacaa 600

gaccgccacc aacccccuga ccaucgaggu gcccuacauc ugcaccgagg gcgaggacca 660

gaucaccgug uggggcuucc acagcgacag cgagacccag auggccaagc uguacggcga 720

cagcaagccc cagaaguuca ccagcagcgc caacggcgug accacccacu acgugagcca 780

gaucggcggc uuccccaacc agaccgagga cggcggccug ccccagagcg gcagaaucgu 840

gguggacuac auggugcaga aguccggcaa gaccggcacc aucaccuacc agaggggcau 900

ccugcugccc cagaaggugu ggugcgccag cggcaggagc aaggugauca agggcagccu 960

gccccugauc ggcgaggccg acugccugca cgagaaguac ggcggccuga acaagagcaa 1020

gcccuacuac accggcgagc acgccaaggc caucggcaac ugccccaucu gggugaagac 1080

cccccugaag cuggccaacg gcaccaagua cagacccccc gccaagcugc ugaaggagag 1140

aggcuucuuc ggcgccaucg ccggcuuccu ggagggcggc ugggagggca ugaucgccgg 1200

cuggcacggc uacaccagcc acggcgccca cggcguggcc guggccgccg accucaagag 1260

cacccaggag gccaucaaca agaucaccaa gaaccugaac agccugagcg agcuggaggu 1320

gaagaaccug cagagacuga gcggcgccau ggacgagcug cacaacgaga uccuggagcu 1380

ggacgagaag guggacgacc ugagggccga caccaucagc agccagaucg agcuggccgu 1440

gcugcugagc aacgagggca ucaucaacag cgaggacgag caccugcugg cccuggagag 1500

aaagcugaag aagaugcugg gccccagcgc cguggagauc ggcaacggcu gcuucgagac 1560

caagcacaag ugcaaccaga ccugccugga cagaaucgcc gccggcaccu ucgacgccgg 1620

cgaguucagc cugcccaccu ucgacagccu gaacaucacc gccgccagcc ugaacgacga 1680

cggccuggac aaccacacca uccugcugua cuacagcacc gccgccagca gccuggccgu 1740

gacccugaug aucgccaucu ucguggugua cauggugagc agagacaacg ugagcugcag 1800

caucugccug ugagcugccu ucugcggggc uugccuucug gccaugcccu ucuucucucc 1860

cuugcaccug uaccucuugg ucuuugaaua aagccugagu aggaaguaaa aaaaaaaaaa 1920

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1980

aa 1982

<210> 48

<211> 1988

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 1 (B/Yamagata) mRNA

<400> 48

aggaaauucc auuuggcugc agcuucugga gggagccgac aggagacgug gggagacggc 60

caccaugaaa gcaauaauag ugcugcugau gguggugacc agcaacgccg acaggaucug 120

caccggcauc accagcagca acagccccca cguggugaag acagccaccc agggcgaggu 180

gaacgugacc ggagugauac cacugacaac aacaccaaca aagucuuacu ucgccaaccu 240

gaagggcacc aggacccggg gcaagcugug ccccgacugc cugaacugca ccgaucugga 300

uguggcccug gggcggccua ugugcguggg gaccaccccc agcgccaagg ccagcauccu 360

gcacgaggug cggccuguga ccagcggcug cuuuccuauc augcacgaua ggaccaagau 420

caggcagcug cccaaccugc ugcggggcua cgagaagauc cggcugagca cccagaacgu 480

gaucgacgcc gagaaggccc ccggcgggcc cuacaggcug ggcaccuccg ggagcugccc 540

caacgccaca uccaagaucg gcuucuucgc caccauggcc ugggccgugc ccaaggacaa 600

cuacaagaac gccaccaauc cacugaccgu ggaggugccc uacaucugua ccgagggcga 660

ggaccagauc accguguggg gcuuccacag cgaugacaag acacagauga agucccugua 720

cggcgacagc aacccccaga aguucaccag cuccgccaac ggcgugacca cccacuacgu 780

gagccagauu ggggacuucc ccgaccagac cgaggacggg ggccugcccc agucuggccg 840

caucguggug gacuacauga ugcagaagcc cggcaagacc gggaccaucg uguaccagcg 900

gggcgugcug cugccccaga agguguggug cgccagcggg cggagcaagg ugaucaaggg 960

cagucugccu cugaucggcg aggcagacug ccugcacgag gaguauggcg gacugaacaa 1020

guccaagcca uacuacaccg gcaagcacgc caaggccauu ggcaacugcc ccaucugggu 1080

gaagaccccc cugaagcugg ccaauggcac caaguaccgc ccuccagcca agcugcugaa 1140

ggagcggggc uucuucggcg ccaucgccgg cuuccuggag ggcggcuggg agggcaugau 1200

cgccggcugg cacggauaca ccagccacgg cgcccacggc guggccgugg ccgccgaccu 1260

gaaguccacc caggaggcca uaaacaagau caccaagaac uugaacagcc ugagcgagcu 1320

ggaggugaag aaccuccagc ggcuguccgg cgccauggac gagcugcaca acgagauccu 1380

ggagcuggac gagaaggugg acgaucugag agcugacacc aucagcucuc agaucgagcu 1440

ggccgugcug cugagcaacg agggcaucau caacagcgag gaugagcacc ugcuggcccu 1500

ggagcggaag cugaagaaga ugcuggggcc cagcgccgug gacaucggca acggcugcuu 1560

cgagaccaag cacaagugca aucagaccug ucuggacagg aucgccgccg gcaccuucaa 1620

cgccggcgag uucucccugc ccaccuucga cagccugaac aucaccgccg ccagccugaa 1680

cgacgacggg cuggacaacc acaccauccu gcuguacuac uccaccgccg ccagcagccu 1740

ggccgugacc cugaugcugg ccaucuucau cguguacaug gugagcaggg acaauguguc 1800

uugcuccauc ugccugugag cugccuucug cggggcuugc cuucuggcca ugcccuucuu 1860

cucucccuug caccuguacc ucuuggucuu ugaauaaagc cugaguagga aguaaaaaaa 1920

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1980

aaaaaaaa 1988

<210> 49

<211> 1988

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 2 (B/Yamagata) mRNA

<400> 49

aggaaauucc auuuggcugc agcuucugga gggagccgac aggagacgug gggagacggc 60

caccaugaaa gcaauaaucg ugcugcugau gguggugacc agcaaugccg acaggauuug 120

caccggcauc accagcagca acucccccca uguggugaag accgccacac agggggaggu 180

gaaugugaca ggcgugaucc cucugaccac cacacccacc aaguccuacu ucgccaaccu 240

gaaggggacc cggacccggg gcaagcugug uccagacugu cugaacugca cagaucugga 300

cguggcccug ggccggccca ugugcguggg gaccaccccc agcgccaagg ccagcauccu 360

gcacgaggug aggcccguga cuagcggcug cuuuccuauc augcacgaua ggaccaagau 420

uaggcagcug ccuaaucugc ugcgcggcua ugagaagauc aggcugucca cccagaaugu 480

gaucgacgcc gagaaggcuc ccggcggccc cuaccggcug ggcaccucug gcucaugccc 540

uaacgccacc uccaagauug gguucuuugc caccauggcc ugggccgugc ccaaggacaa 600

cuacaagaac gccaccaacc cccugacugu ggaggugccc uacaucugca cagaggggga 660

ggaucagauc accguguggg gcuuccacuc ugacgacaag acccagauga agucccugua 720

cggugauucu aauccccaga aguucaccag cuccgccaau ggcgugacca cccacuacgu 780

cucccagauu ggggacuucc ccgaccagac cgaggacggg ggccugcccc agucugggag 840

aaucguggug gacuacauga ugcagaagcc cgggaagacc gggaccaucg uguaccagcg 900

gggcgugcug cugccccaga agguguggug cgccagcggg cggagcaagg ugaucaaggg 960

cagucugccu cugaucggag aggcagacug ccugcacgag gaguauggcg gacugaacaa 1020

guccaagcca uacuacaccg gcaagcacgc caaggccauu ggcaacugcc caaucugggu 1080

gaagacaccc cugaagcugg cgaacggcac caaguaccgc ccuccagcca agcugcugaa 1140

ggagcggggc uucuucggug ccauugccgg cuuucuggag ggcggcuggg agggcaugau 1200

cgccggcugg cacggcuaca ccagccaugg cgcccauggc guggccgugg cagccgaccu 1260

gaaguccacc caggaggcua ucaacaagau uaccaagaau cugaauagcc ugagcgagcu 1320

ggaggugaag aaccuccagc ggcuguccgg cgccauggau gagcugcaca acgagauccu 1380

ggagcuggac gagaaggugg acgaucugag agcugauacc aucagcucuc agaucgagcu 1440

ggccguguua cuguccaacg agggcaucau caacagcgag gaugagcacc ugcuggcgcu 1500

ggagcgcaag cugaagaaga ugcugggccc cagcgccgug gacaucggca acggcugcuu 1560

cgagaccaag cacaagugca accagaccug ccuggaccgg aucgccgccg ggaccuucaa 1620

cgcaggcgag uucagccugc ccacauucga cagccugaac aucacagccg ccagccugaa 1680

cgacgauggc cuggacaacc acaccauccu gcuguacuac agcacagccg cuagcagccu 1740

ggccgugacc cugaugcugg ccaucuucau cguguacaug gucagcaggg acaacguguc 1800

cugcagcauu ugccugugag cugccuucug cggggcuugc cuucuggcca ugcccuucuu 1860

cucucccuug caccuguacc ucuuggucuu ugaauaaagc cugaguagga aguaaaaaaa 1920

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1980

aaaaaaaa 1988

<210> 50

<211> 1988

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 3 (B/Yamagata) mRNA

<400> 50

aggaaauucc auuuggcugc agcuucugga gggagccgac aggagacgug gggagacggc 60

caccaugaaa gcaauaauag ugcugcugau gguggugacc agcaaugcag aucggaucug 120

cacuggcauc accagcagca acucccccca uguggugaag accgccacac agggggaggu 180

gaacgugacc ggcgugauac cacucacaac aacaccaaca aagagcuacu ucgccaaccu 240

gaaggggacu cggacacggg gcaagcugug ccccgacugu cugaacugca cugaucugga 300

cguggcccug gggcggccua ugugcguggg gaccaccccc agcgcaaagg ccucuauccu 360

gcaugaggug cggccaguga ccucuggcug cuuccccauc augcacgaua gaaccaagau 420

uaggcagcug ccuaaucugc uccggggcua cgagaagauc aggcugucca cccagaacgu 480

caucgacgcc gagaaggccc ccggggggcc uuaccggcug gggaccagcg gaaguugccc 540

caacgcaacu uccaagauug gguucuuugc caccauggcc ugggccgugc ccaaggacaa 600

cuacaagaac gccaccaauc cccugacggu ggaggugccc uacaucugca ccgaggggga 660

ggaucagauc accguguggg gcuuccacuc ugacgacaag acucagauga agucccugua 720

cggugauucu aauccccaga aguucaccag cuccgccaau ggcgugacca cccacuacgu 780

cucccagauu ggggacuucc ccgaccagac cgaggacggg ggccugcccc agucugggag 840

aaucguggug gacuacauga ugcagaagcc cgggaagacc gggaccaucg uguaccagcg 900

gggcgugcug cugccccaga agguguggug cgccagcggg cggagcaagg ugaucaaggg 960

cagucugccu cugaucggag aggcagacug ccugcacgag gaguauggcg gacugaacaa 1020

guccaagcca uacuacaccg gcaagcacgc caaggccauu ggcaacugcc caaucugggu 1080

gaagacaccc cugaagcugg ccaacggcac caaguacagg ccccccgcca agcuccugaa 1140

ggagcggggc uuuuucggcg ccaucgcugg cuuuuuagaa ggaggauggg aagggaugau 1200

cgccggcugg cacggcuaca ccagccaugg cgcccauggc guggccgugg cagccgaccu 1260

gaaguccacc caggaggcua ucaacaagau uaccaagaau cugaauagcc ucagcgagcu 1320

ggaggugaag aaccuccagc ggcuguccgg cgccauggau gagcugcaca acgagauccu 1380

ggagcuggac gagaaggugg acgaucugag agcugauacc aucagcucuc agaucgagcu 1440

ggccgugcug cugucaaaug aaggcauuau caacagcgag gacgagcauc uucuggcccu 1500

ggagaggaag cugaagaaga ugcucggccc cuccgcuguu gauaucggca acgggugcuu 1560

ugagacaaag cacaagugca accagaccug ucuggaccgg aucgccgccg gcaccuucaa 1620

ugccggcgag uuuucccugc ccacauuuga cagccugaau auuacagcag ccagccugaa 1680

cgacgacggg cuggacaacc acaccauccu gcuguauuau ucaaccgcgg ccagcucccu 1740

ggccgugaca cugaugcugg ccaucuucau cguguacaug gugagccggg acaacgugag 1800

cugcagcauc ugccugugag cugccuucug cggggcuugc cuucuggcca ugcccuucuu 1860

cucucccuug caccuguacc ucuuggucuu ugaauaaagc cugaguagga aguaaaaaaa 1920

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1980

aaaaaaaa 1988

<210> 51

<211> 1988

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 4 (B/Yamagata) mRNA

<400> 51

aggaaauucc auuuggcugc agcuucugga gggagccgac aggagacgug gggagacggc 60

caccaugaaa gcgauaauag ugcugcugau gguggugacc agcaaugccg acaggauuug 120

caccggcauc accagcagca acagcccaca cguggugaag acagcuaccc aaggagaagu 180

gaacgucaca ggagugauac cacugacaac aacaccaaca aagagcuacu ucgccaaccu 240

gaagggcacu cggacacggg gcaagcugug ccccgacugu cugaacugca ccgaucugga 300

cguggcccug gggaggccca ugugcguggg cacaaccccc uccgccaagg ccucuauccu 360

gcaugaggug cggccaguga ccucuggcug cuuccccauc augcacgaua gaaccaagau 420

ccggcagcug cccaaccugc ugcgcggaua cgagaagauu cggcugucaa cacagaacgu 480

gauugacgcc gagaaggccc ccggaggucc cuaccggcug gggaccuccg gguccugccc 540

aaaugccacc agcaagauug gguucuucgc caccauggcc ugggccgugc ccaaggacaa 600

uuauaagaac gccaccaauc cacugaccgu ggaggugccu uauauuugua ccgagggcga 660

ggaccagauc accguguggg gcuuccacag ugacgacaag acgcagauga agucacugua 720

uggggauagc aauccccaga aguucacuuc aucugccaau ggggugacca cccacuacgu 780

cagucagauc ggggacuucc ccgaucagac ugaggauggg ggucugcccc aguccgggcg 840

caucguggug gacuacauga ugcagaagcc cggaaagacc ggcaccaucg uguaccagcg 900

cggggugcug cugccucaga aggucuggug cgccagcggu cggucuaagg ugaucaaggg 960

gagccugccc cugaucggcg aggccgacug ccugcacgag gaguauggcg gacugaacaa 1020

guccaagcca uacuacacug ggaagcaugc caaggccauu ggcaacugcc cuaucugggu 1080

gaagaccccc cugaagcugg ccaacgggac caaguaccgg cccccugcca agcugcugaa 1140

ggagcggggc uucuucggcg ccaucgccgg auuccuggag ggcggcuggg agggcaugau 1200

cgccgggugg cauggcuaca ccagccaugg cgcccacggc guggccgucg cagccgaccu 1260

caagagcacu caggaggcga ucaacaagau caccaagaac cugaacucuc ugagcgagcu 1320

ggaggugaag aaccuccagc ggcucagcgg cgccauggac gagcuccaca acgagauccu 1380

ggagcuggau gagaaggugg acgaccugcg cgccgacacc aucagcagcc agaucgagcu 1440

ggcugugcuc cugagcaacg agggcaucau caacagcgag gaugagcacc uccuggcucu 1500

ggagcggaag cugaagaaga ugcugggccc cagcgccguc gacaucggca acgggugcuu 1560

cgagaccaag cacaagugca accagacgug ccuggaccgg aucgccgccg gcacguucaa 1620

cgcaggcgag uucucucugc ccaccuucga cagccugaac aucaccgcug ccagccugaa 1680

cgacgacggg cuggacaacc acaccauccu gcuguacuac agcaccgccg ccagcagccu 1740

ggcggugaca cugaugcugg ccaucuucau cguguacaug gugucucgcg acaacgugag 1800

cugcagcauc ugccugugag cugccuucug cggggcuugc cuucuggcca ugcccuucuu 1860

cucucccuug caccuguacc ucuuggucuu ugaauaaagc cugaguagga aguaaaaaaa 1920

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1980

aaaaaaaa 1988

<210> 52

<211> 1988

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 5 (B/Yamagata) mRNA

<400> 52

aggaaauucc auuuggcugc agcuucugga gggagccgac aggagacgug gggagacggc 60

caccaugaaa gcaauaauag ugcugcugau gguggugacc agcaaugcag aucggaucug 120

cacuggcauc accagcagca acucccccca cguggugaag accgccacgc agggagaagu 180

gaaugucaca ggagugauac cacugacaac aacaccaaca aagagcuacu ucgccaaccu 240

gaagggcacu cggacucggg gcaagcugug ccccgacugu cugaacugca cggaucugga 300

cguggcgcug gggaggccca ugugcguggg cacuaccccc agcgccaagg ccagcauccu 360

gcacgaggug cggcccguga cuagugggug cuuucccauu augcacgacc gcaccaagau 420

uaggcagcug ccuaaucucc uccgggggua cgagaagauu cggcugucga cacagaaugu 480

gaucgacgcc gagaaggccc ccggagggcc cuacagguug gggaccagug gcucuugccc 540

aaaugcuaca uccaagaucg gguucuuugc caccauggcc ugggccgugc ccaaggacaa 600

uuacaagaau gccaccaauc cccugacggu ggaggugccc uacaucugca ccgaggggga 660

ggaucagauc accguguggg gcuuccacuc ugacgacaag acgcagauga agucccugua 720

cggugauucu aauccccaga aguucaccag cuccgccaau ggcgucacca cccacuacgu 780

cucccagauu ggggacuucc ccgaucagac cgaggauggg ggacugcccc agucugggag 840

aaucguggug gacuacauga ugcagaagcc cggcaagacu gguacaaucg uguaccagcg 900

gggcgugcuu cugccucaga agguguggug cgccagcggg cggagcaagg ugaucaaggg 960

cagucugccg cucaucggag aggcagacug ccugcacgag gaguacggcg ggcucaacaa 1020

gagcaagccg uacuacaccg gcaagcacgc caaggccauu ggcaauugcc cgaucugggu 1080

gaagaccccu cugaagcugg ccaacgggac gaaguaucgu cccccggcca agcuucugaa 1140

ggagaggggc uucuucgggg ccaucgccgg auucuuagaa ggcggcuggg aagguaugau 1200

ugcugggugg cacggguaca ccagccacgg cgcccacggg gucgccgugg cugccgaccu 1260

gaaguccacc caggaggcga ucaacaagau caccaagaac cugaacucgc ucagcgagcu 1320

ggaggugaag aaccuccagc ggcugagcgg ggccauggac gagcuccaca acgagauccu 1380

ggagcucgac gagaaggugg acgaucugag agcugauacc aucagcucuc agaucgagcu 1440

ggcggugcuc cuguccaaug aggggaucau caacucagag gacgagcacc ugcuggcucu 1500

ggagagaaag cugaagaaga ugcugggucc aagcgcgguc gacaucggca acgggugcuu 1560

cgagacgaag cacaagugca accagaccug cuuggaccgc aucgccgccg gcaccuucaa 1620

ugccggcgag uuuucucucc ccaccuucga cagccugaac aucacggcug ccagccugaa 1680

cgacgacggg cuggacaauc auaccauccu gcuguacuac agcacagccg ccuccagccu 1740

ggcggugacc cugaugcucg ccauauucau cguguauaug gugagcaggg acaacguguc 1800

cuguagcauu ugccugugag cugccuucug cggggcuugc cuucuggcca ugcccuucuu 1860

cucucccuug caccuguacc ucuuggucuu ugaauaaagc cugaguagga aguaaaaaaa 1920

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1980

aaaaaaaa 1988

<210> 53

<211> 1988

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 6 (B/Yamagata) mRNA

<400> 53

aggaaauucc auuuggcugc agcuucugga gggagccgac aggagacgug gggagacggc 60

caccaugaaa gcaauaaucg ugcugcugau gguggugacc agcaaugcag aucggaucug 120

cacuggcauc accagcagca acucccccca cguggugaag accgccacgc agggggaggu 180

aaauguuaca ggcguuaucc cguugaccac gacucccacg aaguccuacu ucgccaaccu 240

gaaggggacu aggacucgug ggaagcugug cccggacugc uugaauugua ccgaucuuga 300

cguggcccug gggcggccua ugugcguggg gaccaccccg agcgcaaagg ccucgauccu 360

gcaugaggug cgcccgguga ccuccgggug cuuccccauc augcacgauc gaaccaagau 420

ucggcagcug ccgaaucugc uccggggcua cgagaagauc cggcugucga cacagaaugu 480

gaucgacgcc gagaaggccc caggcgggcc cuaccgccug gggacuucug ggagcugccc 540

caacgccacg ucgaagaucg gcuucuucgc cacgauggcg ugggcaguuc ccaaggacaa 600

uuacaagaac gcuacuaacc cccucacggu ggaggucccc uacaucugca cagaggggga 660

ggaccagauc accguguggg gguuucauag cgacgacaag acgcagauga agucacuuua 720

uggggauagc aauccccaga aguucacuuc aucugcgaac ggggugacca cccauuacgu 780

cagucagauc ggggacuucc ccgaucagac ugaggauggg ggucuccccc aguccgggcg 840

caucgugguc gacuacauga ugcagaagcc gggcaagacc ggcaccaucg uguaccagag 900

gggggucuug cugccccaga aggucuggug ugcuagcggu cggucuaagg ugaucaaggg 960

cucccugccc uugaucggcg aggccgacug cuugcacgag gaguacggcg ggcucaacaa 1020

gagcaagccg uacuacaccg gcaagcacgc caaggccauc gggaacugcc cgaucugggu 1080

caagaccccc cucaagcugg cgaacgguac caaguaccgu ccgccagcga agcuccucaa 1140

ggagaggggc uucuucgggg cgaucgcagg auucuuagaa ggaggguggg aagggaugau 1200

cgccggcugg caugguuaca ccagccacgg cgcccacggg gucgccgugg cugccgaccu 1260

gaaguccaca caggaggcca ucaacaagau caccaagaac cugaacucgc ucagcgagcu 1320

ggaggugaag aaccuccagc ggcugagcgg ggccauggac gagcuccaua acgagaucuu 1380

ggagcucgac gagaaggugg acgaucugcg agcagauacc aucagcucgc agaucgagcu 1440

agcggugcuc cuguccaacg aggggaucau caacucggag gacgagcacc ugcuggcucu 1500

ugagcggaag cucaagaaga uguuggggcc uucugccgug gacaucggga acgggugcuu 1560

cgagacgaag cacaagugua accagacgug ccuggaccgc aucgcggccg gcacguucaa 1620

cgccggcgag uuuucccuuc ccaccuucga uagucugaac aucacggccg cgucguugaa 1680

cgacgacggc cuugauaauc acacuauccu gcuguacuac aguacagcag ccuccagccu 1740

ggcggucacc cugaugcucg ccauauucau cguguauaug gugagcaggg auaacguguc 1800

cuguagcauu ugccugugag cugccuucug cggggcuugc cuucuggcca ugcccuucuu 1860

cucucccuug caccuguacc ucuuggucuu ugaauaaagc cugaguagga aguaaaaaaa 1920

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1980

aaaaaaaa 1988

<210> 54

<211> 1988

<212> RNA

<213> Artificial Sequence

<220>

<223> Opti 7 (B/Yamagata) mRNA

<400> 54

aggaaauucc auuuggcugc agcuucugga gggagccgac aggagacgug gggagacggc 60

caccaugaag gccaucaucg ugcugcugau gguggugacc agcaacgccg acaggaucug 120

caccggcauc accagcagca acagccccca cguggugaag accgccaccc agggcgaggu 180

gaacgugacc ggcgugaucc cccugaccac cacccccacc aagagcuacu ucgccaaccu 240

gaagggcacc aggaccagag gcaagcugug ccccgacugc cugaacugca ccgaccugga 300

cguggcccug ggcaggccca ugugcguggg caccaccccc agcgccaagg ccagcauccu 360

gcacgaggug agacccguga ccagcggcug cuuccccauc augcacgaca gaaccaagau 420

caggcagcug cccaaccugc ugaggggcua cgagaagauc aggcugagca cccagaacgu 480

gaucgacgcc gagaaggccc ccggcggccc cuacagacug ggcaccagcg gcagcugccc 540

caacgccacc agcaagaucg gcuucuucgc caccauggcc ugggccgugc ccaaggacaa 600

cuacaagaac gccaccaacc cccugaccgu ggaggugccc uacaucugca ccgagggcga 660

ggaccagauc accguguggg gcuuccacag cgacgacaag acccagauga agucccugua 720

cggcgacagc aacccccaga aguucaccag cagcgccaac ggcgugacca cccacuacgu 780

gagccagauc ggcgacuucc ccgaccagac cgaggacggc ggccugcccc agagcggcag 840

aaucguggug gacuacauga ugcagaagcc cggcaagacc ggcaccaucg uguaccagag 900

gggcgugcug cugccccaga agguguggug cgccagcggc aggagcaagg ugaucaaggg 960

cagccugccc cugaucggcg aggccgacug ccugcacgag gaguacggcg gccugaacaa 1020

gagcaagccc uacuacaccg gcaagcacgc caaggccauc ggcaacugcc ccaucugggu 1080

gaagaccccc cugaagcugg ccaacggcac caaguacagg ccccccgcca agcugcugaa 1140

ggagaggggc uucuucggcg ccaucgccgg cuuccuggag ggcggcuggg agggcaugau 1200

cgccggcugg cacggcuaca ccagccacgg cgcccacggc guggccgugg ccgccgaccu 1260

gaaguccacc caggaggcca ucaacaagau caccaagaac cugaacagcc ugagcgagcu 1320

ggaggugaag aaccugcaga ggcugagcgg cgccauggac gagcugcaca acgagauccu 1380

ggagcuggac gagaaggugg acgaccugag agccgacacc aucagcagcc agaucgagcu 1440

ggccgugcug cugagcaacg agggcaucau caacagcgag gacgagcacc ugcuggcccu 1500

ggagaggaag cugaagaaga ugcugggccc cagcgccgug gacaucggca acggcugcuu 1560

cgagaccaag cacaagugca accagaccug ccuggacagg aucgccgccg gcaccuucaa 1620

cgccggcgag uucagccugc ccaccuucga cagccugaac aucaccgccg ccagccugaa 1680

cgacgacggc cuggacaacc acaccauccu gcuguacuac agcaccgccg ccagcagccu 1740

ggccgugacc cugaugcugg ccaucuucau cguguacaug gugagcaggg acaacgugag 1800

cugcagcauc ugccugugag cugccuucug cggggcuugc cuucuggcca ugcccuucuu 1860

cucucccuug caccuguacc ucuuggucuu ugaauaaagc cugaguagga aguaaaaaaa 1920

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1980

aaaaaaaa 1988

<210> 55

<211> 1701

<212> DNA

<213> Artificial Sequence

<220>

<223> Opti 1 (H1N1) DNA ORF

<400> 55

atgaaagcaa tattagtggt gatgctgtac accttcacca cagccaatgc cgacaccctg 60

tgcattggct accacgccaa caacagcacc gacactgtgg acaccgtgct ggagaagaat 120

gtgaccgtga cccacagcgt gaacctgctg gaggacaagc acaatggcaa gctgtgcaag 180

ctgcgggggg tggccccact gcacctgggc aagtgcaaca tcgccggctg gattctgggc 240

aacccagagt gcgagagcct gagcactgcc cggagctggt cctacatcgt ggagaccagc 300

aacagcgaca acggcacctg ctaccccggg gacttcatca actacgagga gctgagggag 360

cagctgagct ccgtgagctc cttcgagagg ttcgagatct tccccaagac cagctcttgg 420

cccaaccacg acagcgacaa cggcgtgacc gccgcctgcc ctcacgccgg ggccaagagc 480

ttctacaaga acctgatctg gctggtgaag aaggggaaaa gctaccccaa gatcaaccag 540

acctacatca acgacaaagg aaaagaagtg ttagtgctgt ggggcataca ccaccctccc 600

accatcgccg accagcagtc cctgtaccag aatgctgatg cctacgtgtt cgtgggcacc 660

agcaggtaca gcaagaagtt caagcccgag atcgccaccc ggcccaaggt gcgggaccgg 720

gagggccgga tgaactacta ctggaccctg gtggagcccg gggacaagat caccttcgag 780

gccaccggca acctggtggc cccccggtac gccttcacca tggagagaga tgccggcagc 840

ggcatcatca tctccgacac ccccgtgcac gactgcaaca ccacttgcca gacccctgag 900

ggggccatca acacctctct gcccttccag aatgtgcacc ccatcaccat cggcaagtgc 960

cccaagtacg tgaagtccac caagctgagg ctggccaccg gcctgcggaa cgtgcccagc 1020

atccagagcc ggggcctgtt cggcgccatc gccggcttca tcgagggcgg ctggaccggc 1080

atggtggacg gctggtacgg ctaccaccac cagaatgagc aggggtccgg ctacgccgcc 1140

gatctgaagt ccacccagaa cgccatcgac aagatcacca acaaggtgaa ctccgtgatc 1200

gagaagatga acacccagtt caccgccgtg ggcaaggagt tcaatcatct ggagaagcgg 1260

atcgagaacc tgaacaagaa ggtggacgat ggctttctgg acatctggac ttacaatgcc 1320

gagctgctgg tgctgctgga gaacgagcgg acactggact atcacgacag caacgtgaag 1380

aatctgtacg agaaggtgcg gaaccagctg aagaacaatg ccaaggagat tggcaacggc 1440

tgcttcgagt tctaccacaa gtgtgacaac acttgcatgg agagcgtgaa gaacggcacc 1500

tacgactacc ccaagtacag cgaggaggcc aagctgaacc gggagaagat cgacggcgtg 1560

aagctggact ccaccaggat ctaccagatc ctggccatct acagcaccgt ggccagcagc 1620

ctggtgctgg tggtgtccct gggcgccatc tcattctgga tgtgcagcaa cgggtccctg 1680

cagtgtcgga tctgtatctg a 1701

<210> 56

<211> 1701

<212> DNA

<213> Artificial Sequence

<220>

<223> Opti 2 (H1N1) DNA ORF

<400> 56

atgaaagcaa tactcgtggt gatgctgtac accttcacca ctgcaaatgc cgacactctg 60

tgcattggct accacgccaa taacagcaca gacactgtgg acacggtcct ggagaagaac 120

gtgaccgtga cccacagtgt gaacctgctg gaggacaagc acaacggaaa gctgtgcaag 180

ctgagaggag ttgcccccct ccacctgggg aagtgcaaca tcgccgggtg gatcctgggc 240

aaccccgagt gtgagagcct gagcaccgcc aggagctggt cctacatcgt ggagaccagc 300

aattctgata atgggacctg ctaccccggc gatttcatca actacgagga gctgagggag 360

cagctgagct ccgtcagctc cttcgagcgc ttcgagatct tccccaagac cagctcttgg 420

cccaaccatg acagcgacaa cggcgtgacc gccgcttgtc ctcatgccgg ggccaagagc 480

ttctacaaga acctgatctg gctggtgaag aaggggaaaa gctaccccaa gatcaaccag 540

acctacatca acgacaaggg gaaggaggtg ctcgtgctgt gggggataca ccaccctccc 600

acaatcgccg accagcagtc cctgtatcag aatgctgatg cctacgtgtt cgtgggcacc 660

agcaggtaca gtaagaagtt caagcctgag atcgcgaccc gccccaaggt gcgggatcgc 720

gagggcagga tgaactatta ctggaccctg gtggagccag gcgacaagat cacattcgag 780

gccaccggca acctggtggc cccccggtac gccttcacca tggagcgcga tgccgggtct 840

gggatcatca tctcagacac acccgtgcac gactgtaaca ccacctgcca gacccctgag 900

ggggcaatca acaccagcct gccctttcag aatgtgcatc ccatcaccat tgggaagtgt 960

cccaagtacg tgaaaagcac aaagctcagg ctggccaccg gcctgaggaa cgtgccctca 1020

atccagagcc ggggcctgtt cggggccatc gccggcttca ttgagggcgg gtggactggc 1080

atggtggacg gttggtacgg gtaccaccac cagaacgagc agggcagcgg ctacgccgct 1140

gacctgaagt ccacccagaa cgccatcgac aagatcacca acaaggtgaa ctccgtgatc 1200

gagaagatga acacccagtt caccgccgtg ggcaaggagt tcaatcatct cgagaagcgg 1260

atcgagaacc tgaacaagaa ggtggacgat ggctttctgg acatctggac ttacaacgca 1320

gagctgctgg tgctgctcga gaacgagcgg acactggact accacgacag caatgtgaag 1380

aatctgtacg agaaggtgcg gaaccagctg aagaacaatg ccaaggagat tggcaacggc 1440

tgcttcgagt tctaccacaa gtgtgacaac acttgtatgg agagcgtgaa gaatgggacc 1500

tacgactatc ccaagtacag cgaggaggcc aagctgaaca gggagaagat cgatggagtc 1560

aagctggact ccaccaggat ctaccagatc ctggcgatct actccactgt ggcctcctcg 1620

ctggttctgg tggtgtccct cggcgccatc agcttctgga tgtgctccaa cggcagcctg 1680

cagtgtcgga tttgcatctg a 1701

<210> 57

<211> 1701

<212> DNA

<213> Artificial Sequence

<220>

<223> Opti 3 (H1N1) DNA ORF

<400> 57

atgaaagcaa tactcgtggt gatgctgtac accttcacca ctgcaaatgc cgacaccctg 60

tgcatcgggt accatgccaa taattctacc gacaccgtgg acacggtgtt ggagaagaat 120

gtgacggtga cacattctgt gaacctcctg gaggacaagc acaacggcaa gttgtgcaag 180

ctccgggggg tggcccccct gcatctgggc aagtgcaaca tcgccggctg gatcttgggg 240

aatccagagt gcgagtccct gagcacggcc cggtcttgga gttacatcgt ggagacgagt 300

aactccgaca acgggacgtg ctaccccggg gacttcatca actacgagga gctgagagag 360

cagctgagct ccgtcagctc cttcgagcgc tttgagatct tccccaagac ctccagctgg 420

cccaaccatg actccgacaa cggagtcacg gccgcttgcc cacatgcggg ggccaagtca 480

ttttataaga acctgatctg gttggtcaag aagggtaaga gctaccctaa gatcaaccag 540

acttatatca atgacaaggg caaggaggtg ttggtgctgt gggggataca ccacccacca 600

acaatcgcag accagcagtc cctgtaccag aatgctgatg cctacgtgtt cgtgggcacc 660

agcaggtaca gcaagaagtt caagcctgag atcgcgaccc gccccaaggt gcgggatcgc 720

gagggcagga tgaactacta ctggactctg gtcgagcctg gtgacaagat caccttcgag 780

gccaccggaa acctggtggc cccaaggtac gctttcacca tggagagaga tgccggcagc 840

ggcatcatca tctccgacac tccggtgcat gactgtaaca ctacatgtca gacaccggag 900

ggcgccatca acacctcctt gcccttccag aatgtgcacc ccatcacaat tggcaagtgc 960

ccgaagtacg tgaaaagcac aaagctcagg ctggccaccg gcctgaggaa tgtgccttca 1020

atccagtccc gcggcctctt tggagccatc gccggcttca ttgagggcgg gtggactgga 1080

atggtggatg gctggtacgg ctaccaccac cagaatgagc agggcagcgg ctacgccgct 1140

gacctgaaaa gcacccagaa cgccatcgat aagattacca acaaggtgaa cagcgtgatc 1200

gagaagatga acacgcagtt caccgctgtt ggtaaggagt tcaatcatct ggagaagaga 1260

atcgagaacc tgaacaagaa ggttgacgat ggcttcctgg atatttggac ttacaatgcc 1320

gagctcctgg tgctgctcga gaacgagcgc accctggatt atcacgacag caacgtgaag 1380

aacctgtacg agaaggttcg gaaccagctg aagaataatg ccaaggagat cggcaatggg 1440

tgcttcgagt tctaccacaa gtgtgacaac acttgtatgg agagcgtgaa gaacggcacc 1500

tatgactacc ctaagtacag cgaggaggcc aagctgaaca gggagaagat cgatggcgtg 1560

aagctggaca gcaccaggat ctaccagatt ctggcaatct acagcacggt ggccagcagt 1620

ctggtcctgg tggtgtccct gggtgctatc tcattctgga tgtgctccaa cgggagcctg 1680

cagtgtcgga tttgcatctg a 1701

<210> 58

<211> 1701

<212> DNA

<213> Artificial Sequence

<220>

<223> Opti 4 (H1N1) DNA ORF

<400> 58

atgaaagcaa tattagtggt gatgttgtat acattcacca ccgccaatgc cgacaccctg 60

tgcatcggct accatgcgaa caattccact gacactgtgg acacggtcct ggagaagaac 120

gtgaccgtga cccacagtgt caacctcctg gaggacaagc acaacggcaa gttgtgcaag 180

ctccgggggg tggcgccgtt gcacttggga aagtgcaaca tcgccggctg gatcttgggg 240

aatccggagt gcgagtccct gagcacggcc cggtcttgga gttacatcgt ggagacgagt 300

aactccgaca acgggacgtg ctaccccggg gacttcatca actacgagga gctgagagag 360

cagctgagct ccgtcagctc cttcgagcgc ttcgagattt tccccaagac cagctcgtgg 420

ccgaaccatg actccgacaa cggagtcacg gccgcgtgcc cccacgcggg ggcaaagtcg 480

ttttataaga acctgatctg gttggtcaag aagggtaagt cttaccctaa gatcaaccag 540

acttatataa acgacaaggg caaggaggtg ctggtcctgt gggggataca ccacccacca 600

acaatcgcag accagcagtc gctgtaccag aatgctgatg cctacgtgtt cgtgggcacc 660

agcaggtaca gcaagaagtt caagccggag atcgcgaccc gccccaaggt gcgggatcgc 720

gagggccgga tgaactacta ttggaccctg gtggagccag gggacaagat tacctttgag 780

gccacaggta atctggtggc cccccggtac gcgttcacca tggagcgcga tgccgggtcc 840

gggattatta tctcggacac tccggtgcat gactgtaaca ctacatgtca gacaccggag 900

ggggccatca acacctcctt gcccttccag aacgtccacc ctataaccat cggcaagtgc 960

cccaagtatg tgaaaagcac gaagctcagg ctggccaccg gcctgaggaa cgtgccttcc 1020

atacagagca gaggactctt tggagcaatt gcaggattta tcgagggtgg atggactgga 1080

atggttgatg gctggtacgg gtaccaccac cagaacgagc agggcagcgg ctacgccgct 1140

gacctgaagt cgacgcagaa tgcgatcgac aagattacca acaaggtgaa cagcgtgatc 1200

gagaagatga acacgcagtt caccgctgtt ggtaaggagt tcaatcacct cgagaagcgc 1260

atcgagaacc tgaacaagaa ggttgacgat gggtttctcg atatttggac ttacaacgct 1320

gagctgctgg tccttctcga gaacgagcgc acgttggatt accacgattc caacgtgaag 1380

aacttgtacg agaaggtccg gaaccagctc aagaacaatg ccaaggagat tggcaacggg 1440

tgcttcgagt tctatcataa gtgcgataat acatgcatgg agagcgtgaa gaatggcact 1500

tatgattacc cgaagtactc ggaggaggcc aagctgaacc gggagaagat cgatggagtc 1560

aagcttgact ccaccaggat ctaccagatc ctggcgatct actccacggt ggcctcctcc 1620

ctcgttctgg tggtgagcct gggagccatc agcttttgga tgtgttcgaa tggtagcctg 1680

cagtgtcgga tttgcatctg a 1701

<210> 59

<211> 1701

<212> DNA

<213> Artificial Sequence

<220>

<223> Opti 5 (H1N1) DNA ORF

<400> 59

atgaaggcca tcctggtggt gatgctgtac accttcacca ccgccaacgc cgacaccctg 60

tgcatcggct accacgccaa caacagcacc gacaccgtgg acaccgtgct ggagaagaac 120

gtgaccgtga cccacagcgt gaacctgctg gaggacaagc acaacggcaa gctgtgcaag 180

ctgagaggcg tggcccccct gcacctgggc aagtgcaaca tcgccggctg gatcctgggc 240

aaccccgagt gcgagagcct gagcaccgcc agaagctgga gctacatcgt ggagaccagc 300

aacagcgaca acggcacctg ctaccccggc gacttcatca actacgagga gctgagagag 360

cagctgagca gcgtgagcag cttcgagagg ttcgagatct tccccaagac cagcagctgg 420

cccaaccacg acagcgacaa cggcgtgacc gccgcctgcc cccacgccgg cgccaagagc 480

ttctacaaga acctgatctg gctggtgaag aagggcaaga gctaccccaa gatcaaccag 540

acctacatca acgacaaggg caaggaggtg ctggtgctgt ggggcatcca ccaccccccc 600

accatcgccg accagcagag cctgtaccag aacgccgacg cctacgtgtt cgtgggcacc 660

agcagataca gcaagaagtt caagcccgag atcgccacca gacccaaggt gagggacagg 720

gagggcagaa tgaactacta ctggaccctg gtggagcccg gcgacaagat caccttcgag 780

gccaccggca acctggtggc ccccagatac gccttcacca tggagagaga tgccggcagc 840

ggcatcatca tcagcgacac ccccgtgcac gactgcaaca ccacctgcca gacccccgag 900

ggcgccatca acaccagcct gcccttccag aacgtgcacc ccatcaccat cggcaagtgc 960

cccaagtacg tcaagagcac caagctgagg ctggccaccg gcctgaggaa cgtgcccagc 1020

atccagagca gaggcctgtt cggcgccatc gccggcttca tcgagggcgg ctggaccggc 1080

atggtggacg gctggtacgg ctaccaccac cagaacgagc agggcagcgg ctacgccgcc 1140

gacctgaagt ccacccagaa cgccatcgac aagatcacca acaaggtgaa cagcgtgatc 1200

gagaagatga acacccagtt caccgccgtg ggcaaggagt tcaaccacct ggagaagagg 1260

atcgagaacc tgaacaagaa ggtggacgac ggcttcctgg acatctggac ctacaacgcc 1320

gagctgctgg tgctgctgga gaacgagaga accctggact accacgacag caacgtgaag 1380

aacctgtacg agaaggtgag gaaccagctg aagaacaacg ccaaggagat cggcaacggc 1440

tgcttcgagt tctaccacaa gtgcgacaac acctgcatgg agagcgtgaa gaacggcacc 1500

tacgactacc ccaagtacag cgaggaggcc aagctgaaca gggagaagat cgacggcgtg 1560

aagctggaca gcaccaggat ctaccagatc ctggccatct acagcaccgt ggccagcagc 1620

ctggtgctgg tggtgagcct gggcgccatc agcttctgga tgtgcagcaa cggcagcctg 1680

cagtgcagaa tctgcatctg a 1701

<210> 60

<211> 1701

<212> DNA

<213> Artificial Sequence

<220>

<223> Ori (H1N1) DNA ORF

<400> 60

atgaaggcaa tactagtagt tatgctgtat acatttacaa ccgcaaatgc agacacatta 60

tgtataggtt atcatgcgaa caattcaaca gacactgtgg acacagtact agaaaagaat 120

gtaacagtaa cacactctgt caatcttctg gaagacaagc ataacggaaa actatgcaaa 180

ctaagagggg tagccccatt gcatttgggt aaatgtaaca ttgctggctg gatcctggga 240

aatccagagt gtgaatcact ctccacagca agatcatggt cctacattgt ggaaacatct 300

aattcagaca atggaacgtg ttacccagga gatttcatca attatgagga gctaagagag 360

caattgagct cagtgtcatc atttgaaagg tttgaaatat tccccaagac aagttcatgg 420

cctaatcatg actcggacaa tggtgtaacg gcagcatgtc ctcacgctgg agcaaaaagc 480

ttctacaaaa acttgatatg gctggttaaa aaaggaaaat catacccaaa gatcaaccaa 540

acctacatta atgataaagg gaaagaagtc ctcgtgctgt ggggcattca ccatccacct 600

actattgctg accaacaaag tctctatcag aatgcagatg catatgtttt tgtggggaca 660

tcaagataca gcaagaagtt caagccggaa atagcaacaa gacccaaagt gagggatcga 720

gaagggagaa tgaactatta ctggacacta gtagaaccgg gagacaaaat aacattcgaa 780

gcaactggta atctagtggc accgagatat gcattcacaa tggaaagaga tgctggatct 840

ggtattatca tttcagatac accagtccac gattgcaata caacttgtca gacacccgag 900

ggtgctataa acaccagcct cccatttcag aatgtacatc cgatcacaat tgggaaatgt 960

ccaaagtatg taaaaagcac aaaattgaga ctggccacag gattgaggaa tgtcccgtct 1020

attcaatcta gaggcctatt cggggccatt gctggcttca tcgaaggggg gtggacaggg 1080

atggtagatg gatggtacgg ttatcaccat caaaatgagc aggggtcagg atatgcagcc 1140

gatctgaaaa gcacacaaaa tgccattgat aagattacta acaaagtaaa ttctgttatt 1200

gaaaagatga atacacagtt cacagcagtt ggtaaagagt tcaaccacct tgaaaaaaga 1260

atagagaatc taaataaaaa ggttgatgat ggtttcctgg acatttggac ttacaatgcc 1320

gaactgttgg ttctactgga aaacgaaaga actttggact atcacgattc aaatgtgaag 1380

aacttgtatg aaaaagtaag aaaccagtta aaaaacaatg ccaaggaaat tggaaacggc 1440

tgctttgaat tttaccacaa atgcgacaac acatgcatgg aaagtgtcaa gaatgggact 1500

tatgactacc caaaatactc agaggaagca aaattaaaca gagaaaaaat agatggagta 1560

aagctggact caacaaggat ctaccagatt ttggcgatct attcaactgt tgccagttca 1620

ttggtactgg tagtctccct gggggcaatc agcttctgga tgtgctctaa tgggtctcta 1680

cagtgtagaa tatgtattta a 1701

<210> 61

<211> 1701

<212> DNA

<213> Artificial Sequence

<220>

<223> Opti 1 (H3N2) DNA ORF

<400> 61

atgaaaacaa taatcgccct gagctacatc ctgtgcctgg tgttcgccca gaagatcccc 60

ggcaacgata acagcacagc caccctgtgc ctggggcacc acgccgtgcc caacggcacc 120

atcgtgaaga ccatcaccaa cgatcggatc gaggtgacca acgccaccga gctggtgcag 180

aactcctcca tcggggagat ctgcgacagc ccccaccaga tcctggatgg gggcaactgc 240

acactgatcg acgccctgct gggcgaccct cagtgtgacg ggttccagaa caaggagtgg 300

gacctgttcg tggagcggag cagggccaac agcaactgct acccctacga cgtgcctgac 360

tatgccagcc tgcggagcct ggtggccagc agcggcaccc tggagttcaa gaacgagagc 420

ttcaactgga ccggggtgaa gcagaatggc accagctccg cctgcattcg gggcagcagc 480

tccagcttct tcagccggct gaactggctg acccacctga actacaagta ccctgccctg 540

aatgtgacca tgcccaacaa tgagcagttc gacaagctgt acatctgggg cgtgcaccac 600

ccccggaccg acaaggacca gatctcactg ttcgcccagc cctctgggcg gatcacagtg 660

agcaccaagc gctcccagca ggccgtgatc cccaacatcg gatcacggcc tcggatccgg 720

gacatcccct cccggatctc catctactgg accatcgtga agcccggcga catcctgctg 780

atcaacagca ccggcaacct gatcgccccc cggggctact tcaagatcag gtccggcaag 840

agctccatca tgcggagcga tgctcccatt gggaagtgca agagcgagtg catcaccccc 900

aatgggagca tccccaacga caagcccttc cagaacgtga accggatcac ctacggcgcc 960

tgcccccggt acgtgaagca gagcaccctg aagctggcca ccggcatgag gaacgtgcct 1020

gagaagcaga cccggggcat cttcggcgcc atcgccggct tcatcgagaa cggctgggag 1080

ggcatggtgg acggctggta tggcttcagg caccagaact ccgagggccg cggccaggcc 1140

gccgatctga agtctaccca ggccgccatt gaccagatca atggcaagct gaatagactg 1200

atcggcaaga ccaacgagaa gttccaccag atcgagaagg aattctccga ggtggagggc 1260

cgggtacagg acctggagaa gtacgtggag gacaccaaga tcgatctgtg gagctacaac 1320

gccgagctgc tggtggccct ggagaaccag cacaccatcg atctgaccga cagcgagatg 1380

aacaagctgt tcgagaagac caagaagcag ctgcgggaga atgccgagga catgggcaac 1440

ggctgcttca agatctacca caagtgtgac aacgcttgta tcggctccat ccgcaatgag 1500

acctacgacc acaacgtgta cagggacgag gccctgaaca acaggtttca gatcaagggg 1560

gtggagctga agtcaggcta caaggactgg atcctgtgga tctccttcgc catgagctgc 1620

ttcctgctgt gcatcgccct gctggggttc atcatgtggg cctgccagaa gggcaacatc 1680

aggtgcaaca tctgcatctg a 1701

<210> 62

<211> 1701

<212> DNA

<213> Artificial Sequence

<220>

<223> Opti 2 (H3N2) DNA ORF

<400> 62

atgaaaacaa taatagccct gagctatatt ctgtgcctgg tcttcgccca gaagatccca 60

ggcaatgaca atagcaccgc caccttgtgc ctgggtcatc acgccgtgcc taatggcacc 120

atcgtgaaga ccatcaccaa cgacaggatc gaggtgacca atgctactga gctggtgcag 180

aacagtagca ttggggagat ctgcgattcc ccacatcaga tcctggatgg ggggaattgc 240

acactgatcg acgccctgct gggcgatccc cagtgtgacg ggttccagaa caaggagtgg 300

gacctgttcg tggagcggag tagggctaac agcaactgtt acccctacga cgttcccgac 360

tacgcctccc tgaggtctct ggtggccagc agtggcacac tggagttcaa gaacgagagc 420

ttcaactgga caggcgtgaa gcagaacggc acctcttccg cctgtatccg gggaagctct 480

agttctttct tcagccggct gaactggctg acccacctga actacaagta tccagctctg 540

aacgtgacca tgcccaacaa tgagcagttc gacaagctgt atatttgggg ggtgcaccac 600

ccccggaccg acaaggacca gatctccctg ttcgcccagc cctctgggcg gatcaccgtg 660

agcaccaagc ggtctcagca ggccgtgatc cccaacatcg gatcacggcc tcggatcagg 720

gatatcccca gcaggatctc catctattgg accatcgtga agcctgggga tatcctgctg 780

atcaactcta cgggcaatct gattgcccct agagggtact tcaagatcag gagcggcaag 840

agctctatca tgaggtctga cgctcctatc gggaagtgca agagtgagtg catcacccct 900

aacggaagca tccccaacga caagccattt cagaacgtga acaggatcac ctacggggcc 960

tgcccccgtt acgtgaagca gtccactctg aagctggcga ctggcatgag gaatgtcccc 1020

gagaagcaga ctcggggcat cttcggcgcc atcgccggct tcatcgagaa cggctgggaa 1080

ggaatggtag acggctggta cggcttccgc catcagaact ctgagggtcg gggccaggcc 1140

gccgacctga agagtaccca ggccgccatc gatcagatca atggcaagct gaatcggctg 1200

atcggcaaga ccaatgagaa gttccaccag attgagaagg agttctcaga ggtggagggc 1260

cgggtgcagg acctggagaa gtacgttgag gacaccaaga tcgacctgtg gtcctacaac 1320

gccgagctcc tggtcgccct ggagaatcag cacactatcg acctgaccga tagtgagatg 1380

aacaagctgt ttgagaagac caagaagcag ctgcgggaga acgccgagga catgggcaac 1440

ggatgcttca agatctacca caagtgtgac aacgcttgta tcggaagcat ccggaacgag 1500

acctacgacc acaacgtgta cagggacgag gccctgaaca acagattcca gatcaagggc 1560

gtagagctga agtctggcta caaagattgg atcctgtgga tcagcttcgc catgtcctgc 1620

tttctgctgt gtattgccct tctggggttc atcatgtggg cctgccagaa gggcaatatc 1680

aggtgcaaca tctgcatctg a 1701

<210> 63

<211> 1701

<212> DNA

<213> Artificial Sequence

<220>

<223> Opti 3 (H3N2) DNA ORF

<400> 63

atgaaaacaa taatagccct gagctatatt ctgtgcctgg tcttcgccca gaagatccca 60

ggcaatgaca atagcacagc cacgctgtgt ctgggccacc acgccgtgcc aaacggcacc 120

atcgtgaaga ctatcaccaa cgaccggatc gaggtgacca acgccacaga gctggtgcag 180

aactcctcca tcggggagat ctgcgattcc ccccaccaga tcctggatgg ggggaattgc 240

acactgatcg acgccctgct gggcgatcct cagtgtgacg ggttccagaa caaggagtgg 300

gacctgttcg tggagcggag tagggctaac agcaactgtt acccctacga cgttcccgat 360

tacgccagtc tgagaagcct cgtggccagc tccgggacac tggagttcaa gaacgagagc 420

ttcaattgga ctggcgtgaa gcagaatggg accagttcag cctgcatcag agggagcagc 480

agctccttct tcagcaggct gaactggctg acccatctga actacaagta cccagctctg 540

aacgtgacca tgcccaacaa tgagcagttc gacaagctgt acatctgggg cgtgcaccac 600

ccccggaccg acaaggatca gattagcctg ttcgcccagc cctctgggcg gatcactgtg 660

agcaccaagc gctcacagca ggccgtgatc cccaacatcg gatcacggcc tcggatcagg 720

gatatcccca gcaggatctc catctattgg acgatcgtga agcctgggga tatcctgctg 780

atcaacagca caggcaatct gatcgctccc cgggggtact tcaagatccg gtctgggaag 840

tcttctatca tgaggagcga tgctcccatt gggaagtgca agagcgagtg cattactccc 900

aatgggagca ttcctaatga taagcccttc cagaacgtga atcggatcac ctacggtgcc 960

tgcccacggt acgtgaagca gagcaccctg aagctggcaa caggcatgcg gaatgtgccc 1020

gagaagcaga ctcggggcat attcggcgcc atcgccggct tcatcgagaa cggctgggag 1080

ggcatggtgg acggctggta cggcttccgg caccagaaca gcgagggcag ggggcaggct 1140

gccgatctga agtctactca ggctgccatt gatcagatca atggcaagct gaatagactg 1200

atcggcaaga ccaacgagaa gttccaccag atcgagaagg aattctccga ggtggagggc 1260

cgggtacagg acctggagaa gtacgtggag gacaccaaga tcgatctgtg gagctacaac 1320

gcggagctgc tggtggctct cgaaaaccag cacaccatcg acttaaccga cagcgagatg 1380

aacaagctgt tcgagaagac caagaagcag ctccgcgaga acgccgagga catggggaat 1440

gggtgcttca agatctacca caagtgtgac aacgcttgta tcggctccat ccgcaatgag 1500

acctatgacc acaacgtgta cagggacgag gccctgaaca ataggtttca gatcaagggg 1560

gtggagctga agtccggcta caaggactgg atcttgtgga tctcattcgc catgtcctgc 1620

ttcctgctct gtattgccct tctggggttc atcatgtggg cctgccagaa gggcaatatc 1680

agatgcaaca tctgcatctg a 1701

<210> 64

<211> 1701

<212> DNA

<213> Artificial Sequence

<220>

<223> Opti 4 (H3N2) DNA ORF

<400> 64

atgaaaacaa taatagccct gagctacata ctttgtttag tctttgccca gaagattccg 60

ggcaatgaca actcgactgc cacactgtgc ctggggcatc acgcggtgcc taatggcacc 120

atcgtgaaga cgattaccaa tgaccggatc gaggtgacca acgcgacaga gctggtgcag 180

aactcctcta ttggggagat ctgcgattcc ccccaccaga tcctggatgg ggggaattgc 240

acactgatcg acgccctgct gggcgatcct cagtgtgacg ggttccagaa caaggagtgg 300

gacctgttcg tggagcggag tagggctaac agcaactgtt acccctacga cgttcccgat 360

tacgccagtc tgagaagcct cgtggcgagc tccgggacac tggagttcaa gaacgagagc 420

ttcaattgga ctggcgtgaa gcagaatggg accagttcag cctgcataag agggagcagc 480

agctccttct tcagcaggct gaactggttg acccatctga actacaagta cccagctctg 540

aacgtgacca tgcccaataa tgagcagttt gacaagctgt acatttgggg cgtgcaccac 600

ccccggacgg acaaggatca gatctccctg ttcgcccagc cctctgggcg gatcactgtg 660

agcaccaagc gctcacagca ggccgtgatc cccaacatcg gatcacggcc tcggatcagg 720

gatatcccca gcaggatctc catctattgg acgatcgtga agcctgggga tatcctgctg 780

atcaacagca cagggaatct gatcgctccc cgggggtact tcaagatccg gtcagggaag 840

tcgtctatca tgaggagcga tgctcccatt gggaagtgca agagcgagtg cattaccccc 900

aatgggagca tccctaatga taagcccttc cagaacgtga accggatcac gtacggggct 960

tgccccaggt acgtgaagca gtcgactctg aagctggcga cgggcatgcg gaatgtgccc 1020

gagaagcaga ctcggggcat attcggcgcc atcgccggct tcatcgagaa tgggtgggag 1080

ggcatggtcg acggctggta cggctttcgc caccagaaca gcgagggccg gggccaggcc 1140

gccgacctga agtccaccca ggctgccatt gatcagatca atggcaagct gaaccgtctc 1200

attgggaaga ccaatgagaa gttccatcag atcgagaagg agttcagcga ggtcgagggg 1260

cgggtccagg acctcgagaa gtacgtcgag gacaccaaga tcgacctctg gagctacaac 1320

gctgagctcc tggtggcgct ggagaaccag cacaccatcg atctgacgga cagcgagatg 1380

aacaagctgt tcgagaagac aaagaagcag ctcagggaga atgcagagga catggggaac 1440

gggtgcttca agatctacca caagtgtgac aacgcttgta tcggctccat ccgcaatgag 1500

acctatgacc acaacgtgta cagggacgag gccctgaaca ataggtttca gatcaagggg 1560

gtggagctga agtccggcta caaggactgg atcttgtgga tctcgttcgc catgtcctgc 1620

ttcctgctgt gtattgccct tctggggttc atcatgtggg cctgccagaa gggcaatatc 1680

aggtgcaata tctgcatttg a 1701

<210> 65

<211> 1701

<212> DNA

<213> Artificial Sequence

<220>

<223> Opti 5 (H3N2) DNA ORF

<400> 65

atgaaaacaa taatagcgct gagctacatt ctctgtctgg tgtttgccca gaagattccg 60

ggcaacgaca acagcacagc cacgctgtgc cttgggcacc acgcggtgcc caacggtacg 120

atcgtgaaga ccatcacgaa cgaccgcata gaggtcacca atgctactga gctggtgcag 180

aacagtagca ttggtgagat ctgtgattcc ccccaccaga tcctggatgg ggggaattgt 240

actcttattg atgcgctgtt aggcgatccg cagtgcgacg ggttccagaa caaggagtgg 300

gacctgttcg tagagcggag tcgtgcgaat agcaactgct atccgtacga cgtgccagac 360

tacgcatcct tgcgtagtct ggttgcttcc tccgggacgt tggagttcaa gaacgagagc 420

ttcaactgga ccggagtgaa gcagaatggg accagttcag cctgcataag agggagcagc 480

agctccttct tcagcaggct gaactggttg acccatttga actacaagta cccggccctc 540

aatgttacga tgccgaacaa cgagcagttt gataaattgt acatctgggg ggtgcaccac 600

ccccggactg acaaggatca gattagcttg ttcgctcagc cgagcggccg tatcaccgta 660

tccaccaaac gctcccagca agccgtgatc ccgaacatcg ggtcacggcc tcggatccgg 720

gacatcccgt cccggatctc gatttactgg actattgtta agccaggaga cattctcctg 780

attaacagta ccggtaactt gatcgccccg aggggatact tcaagatccg ctcggggaag 840

tcaagtatca tgcggagcga tgctcccatt gggaagtgca agagcgagtg cattaccccc 900

aatgggagca tcccgaatga taagccgttc cagaatgtga accgcatcac gtacggggcc 960

tgcccccggt acgtgaagca gtcgaccctg aagcttgcca cggggatgcg gaacgtgccc 1020

gagaagcaga cccgtggcat cttcggggcg attgcggggt tcatagagaa cggctgggaa 1080

ggcatggtag acggatggta cggctttcgg catcagaaca gtgagggccg gggccaggca 1140

gcggatctga agagtacaca ggctgccatt gatcagatca atggcaagct gaaccgtctc 1200

attgggaaga ccaatgagaa gttccaccag atagagaagg agttcagcga ggtcgagggt 1260

cgtgtccagg acctggagaa gtacgtcgag gacacgaaga tcgacctgtg gagttacaac 1320

gccgagttgc tggtggcgct ggagaaccag cacaccatcg acttgacgga cagcgagatg 1380

aacaagctgt tcgagaagac caagaagcag ctccgcgaga acgcggagga catggggaac 1440

gggtgcttca agatctacca caagtgtgac aacgcttgta tcggctccat ccgcaatgag 1500

acctatgacc acaacgtcta cagagatgag gcgttgaaca ataggtttca gatcaagggg 1560

gtggagctga agtccggcta caaggactgg atcttgtgga tctcgttcgc catgtcctgc 1620

ttcttgcttt gtattgccct tctggggttc atcatgtggg cctgccagaa gggcaatatc 1680

cgttgtaaca tctgcatctg a 1701

<210> 66

<211> 1701

<212> DNA

<213> Artificial Sequence

<220>

<223> Ori (H3N2) DNA ORF

<400> 66

atgaagacta tcattgcttt gagctacatt ctatgtcttg ttttcgctca aaaaatccct 60

ggaaatgaca atagcacggc aacgctgtgc cttgggcacc atgcagtacc aaacggaacg 120

atagtgaaaa caatcacaaa tgaccgaatt gaagttacta atgctactga gttggttcag 180

aattcctcaa taggtgaaat atgcgacagt cctcatcaga tccttgatgg agggaactgc 240

acactaatag atgctctatt gggggaccct cagtgtgacg gctttcaaaa taaggaatgg 300

gacctttttg ttgaacgaag cagagccaac agcaactgtt acccttatga tgtgccggat 360

tatgcctccc ttaggtcact agttgcctca tccggcacac tggagtttaa aaatgaaagc 420

ttcaattgga ctggagtcaa acaaaacgga acaagttctg cgtgcataag gggatctagt 480

agtagttttt ttagtagatt aaattggttg acccacttaa actacaaata tccagcactg 540

aacgtgacta tgccaaacaa tgaacaattt gacaaattgt acatttgggg ggttcaccac 600

ccgagaacgg acaaggacca aatctccctg tttgctcaac catcaggaag aatcacagta 660

tctaccaaaa gaagccaaca agctgtaatc ccaaatatag gatctagacc cagaataagg 720

gatatcccta gcagaataag catctattgg acaatagtaa aaccgggaga catacttttg 780

attaacagca cagggaatct aattgctcct aggggttact tcaaaatacg aagtgggaaa 840

agctcaataa tgagatcaga tgcacccatt ggcaaatgca agtctgaatg catcactcca 900

aatggaagca ttcccaatga caaaccgttc caaaatgtaa acaggatcac atacggggcc 960

tgtcccagat atgtcaagca aagcaccctg aaattggcaa caggaatgcg aaatgtacca 1020

gagaaacaaa ccagaggcat atttggcgca atagcgggtt tcatagaaaa tggatgggag 1080

ggaatggtgg atggttggta cggtttcagg catcaaaatt ctgagggaag aggacaagca 1140

gcagatctca aaagcactca agcagcaatc gatcaaatca atgggaagct gaatcgattg 1200

atcggaaaaa ccaacgagaa attccatcag attgaaaaag aattctcaga agtagaagga 1260

agagttcaag accttgagaa atatgttgag gacactaaaa tagatctctg gtcatacaac 1320

gctgagcttc ttgttgccct ggagaaccaa catacaattg acctaactga ctcagaaatg 1380

aacaaactgt ttgaaaaaac aaagaagcaa ctgagggaaa atgctgagga tatgggaaat 1440

ggttgtttca aaatatacca caaatgtgac aatgcctgca taggatcaat aagaaatgaa 1500

acttatgacc acaatgtgta cagggatgaa gcattaaaca accggttcca gatcaaggga 1560

gttgagctga agtcagggta caaagattgg atcctatgga tttcctttgc catgtcatgt 1620

tttttgcttt gtattgcttt gttggggttc atcatgtggg cctgccaaaa gggcaacatt 1680

agatgcaaca tttgcatttg a 1701

<210> 67

<211> 1749

<212> DNA

<213> Artificial Sequence

<220>

<223> Opti 1 (B/Victoria) DNA ORF

<400> 67

atgaaagcaa taatagtgct gctgatggtg gtgaccagca acgccgacag gatctgcacc 60

ggcatcacca gcagcaacag ccctcacgtg gtgaagaccg ccacccaggg cgaggtgaac 120

gtgaccggag tgataccact gacaacaaca ccaacaaagt ctcacttcgc caacctgaag 180

ggcaccgaga ccagggggaa gctgtgcccc aagtgcctga actgcacaga cctggacgtg 240

gccctgggcc ggccaaagtg caccggcaag atccccagcg cccgggtgag catcctgcac 300

gaggtgcggc ctgtgacatc cgggtgcttt cctatcatgc acgataggac caagattagg 360

cagctgccta atctgctgcg ggggtacgag cacgtgaggc tgtccaccca caacgtgatc 420

aacgccgagg acgcccctgg acggccttac gagatcggca cctccggcag ctgccccaac 480

atcaccaacg gcaacgggtt cttcgccacc atggcttggg ccgtgcccaa gaacaagacc 540

gccaccaacc ccctgaccat cgaggtgccc tacatctgca ccgaggggga ggaccagatc 600

accgtatggg gcttccactc cgacagcgag acccagatgg ccaagctgta cggagacagc 660

aagccccaga agttcacctc ctccgccaac ggcgtgacca cccactacgt gagccagatt 720

ggcggcttcc ccaaccagac cgaggatggg ggcctgcccc agtctggccg catcgtggtg 780

gactacatgg tgcagaaaag cggcaagacc ggcaccatca cctaccagcg gggcatcctg 840

ctgccccaga aggtgtggtg cgcctctggc cgctctaagg tgatcaaggg cagcctgccc 900

ctgatcggcg aggccgactg cctgcacgag aagtacggcg ggctgaacaa gagcaagccc 960

tactacaccg gcgagcacgc caaggccatt ggcaactgcc ccatctgggt gaagaccccc 1020

ctgaagctgg ccaatggcac caagtaccgg ccccccgcca agctgctgaa ggagcggggc 1080

ttcttcggcg ccatcgccgg cttcttagaa ggaggctggg aaggcatgat tgcaggctgg 1140

cacggctaca ccagccacgg cgcccacggc gtggccgtgg ccgccgacct taagagcacc 1200

caggaggcaa tcaacaagat caccaagaac ctgaacagcc tgagcgagct ggaggtgaag 1260

aacctccagc ggctgtccgg ggccatggat gagctgcaca acgagatcct ggagctggac 1320

gagaaggtgg acgatctgag agctgacacc atcagctctc agatcgagct ggccgtgctg 1380

ctgagcaacg agggcatcat caacagcgag gatgagcacc tgctggccct ggagcggaag 1440

ctgaagaaga tgctgggccc cagcgccgtg gagatcggca acggctgctt cgagaccaag 1500

cacaagtgca atcagacctg tctggacagg atcgccgccg gcaccttcga cgccggcgag 1560

ttctccctgc ccaccttcga cagcctgaac atcaccgccg ccagcctgaa cgacgacggg 1620

ctggacaacc acaccatcct gctgtactac tccaccgccg ccagcagcct ggccgtgaca 1680

ctgatgatcg ccatcttcgt ggtgtacatg gtgtcccgcg acaacgtgtc ctgctccatc 1740

tgtctgtga 1749

<210> 68

<211> 1749

<212> DNA

<213> Artificial Sequence

<220>

<223> Opti 2 (B/Victoria) DNA ORF

<400> 68

atgaaagcaa taatagtgct gctgatggtg gtgaccagca atgcagatcg gatctgcact 60

ggcatcacca gcagcaacag ccctcacgtg gtgaagaccg ccacccaagg agaagtgaac 120

gtgacaggag tgataccact gacaacaaca ccaacaaaga gccacttcgc aaacctgaag 180

gggaccgaga cacggggcaa gctgtgcccc aagtgtctga actgcaccga tctcgatgta 240

gccctgggcc ggcccaagtg cactgggaag atccccagtg cacgggtgtc catcctgcat 300

gaggtgcggc cagtgacctc tggctgcttc cccatcatgc acgatcggac aaagattagg 360

cagctgccta atctgctgcg cggctacgag cacgtgcggc tgagcaccca caacgtgatc 420

aacgctgagg atgctcccgg ccggccatac gagatcggca cctctggttc ttgccctaac 480

atcaccaatg gcaatgggtt ctttgccacc atggcttggg ccgtgcccaa gaacaagacg 540

gcaaccaacc cattgaccat tgaggtgccc tacatctgca ccgagggcga ggaccagatc 600

accgtctggg gcttccactc cgacagcgag acccagatgg ccaagctgta cggagacagc 660

aagccccaga agttcacctc ctccgccaat ggcgtgacta cccactacgt gagccagatc 720

ggcgggttcc ccaaccagac cgaggatggg ggcctgcccc agtctggccg gattgtggtg 780

gactacatgg tccagaagtc cggcaagact ggcaccatca cctatcagcg gggcatcctg 840

ctgccccaga aggtgtggtg tgccagcggt cggtctaagg tgatcaaggg cagcctgccc 900

ttgatcggcg aggccgactg cctgcacgag aagtatggcg gactgaacaa gtccaagcca 960

tactacaccg gggagcacgc taaggccatt ggcaactgcc ccatctgggt gaagaccccc 1020

ctgaagctgg ccaatggcac taagtaccgg ccccccgcca agctgctcaa ggagcgcggg 1080

ttcttcggcg ccatcgccgg cttcctggag ggaggctggg agggcatgat cgccggatgg 1140

cacgggtaca cttcccacgg cgcccacggc gtggccgtgg ccgccgacct gaagagtacc 1200

caggaggcca tcaacaagat caccaagaac ctgaactcct tgagcgagct ggaggtgaag 1260

aacctccagc ggctgtccgg cgccatggat gagctgcaca acgagatcct ggagctggac 1320

gagaaggtgg acgatctgag agcagatacc atcagctctc agatcgagct cgccgtgctg 1380

ctgtccaacg agggcatcat caacagcgag gacgagcatc tcctggcact ggagaggaaa 1440

ctgaagaaga tgctgggccc cagcgccgtg gagatcggca acgggtgctt tgagacaaag 1500

cacaagtgca accagacctg cctggacagg atcgccgccg gcaccttcga tgccggcgag 1560

ttctccctgc ccaccttcga cagcctgaac atcaccgctg ccagcctgaa cgacgacggg 1620

ctggacaacc acaccatcct gctgtactac agcaccgctg ccagctcact ggccgtgaca 1680

ctgatgatcg ccatcttcgt ggtgtacatg gtgtcacggg acaacgtgag ctgcagcatc 1740

tgcctgtga 1749

<210> 69

<211> 1749

<212> DNA

<213> Artificial Sequence

<220>

<223> Opti 3 (B/Victoria) DNA ORF

<400> 69

atgaaagcaa taatagtgct cttgatggtg gtgacatcta acgcagaccg catctgcacc 60

gggatcacct ccagcaatag cccccacgtg gtgaagactg cgactcaagg agaagtgaac 120

gtcacaggag tgataccact gacgacaaca ccaacaaagt cgcacttcgc caacctcaag 180

ggtacagaga ctcgtggcaa gttgtgcccc aagtgcctca actgcacgga cctggacgtg 240

gccctgggga gacccaagtg cactgggaag attcccagtg cacgggtctc catcctgcat 300

gaggtgcgcc cggtgacctc cgggtgcttc cccatcatgc acgatcgcac gaagattcgg 360

cagctgccga atcttctgcg gggctacgaa cacgtgcggt tgagcacgca caacgtgata 420

aacgcggagg atgctcccgg acgtccctac gagattggga cgtccgggag ctgtccgaat 480

atcaccaatg ggaacggctt cttcgccacc atggcgtggg ccgttcccaa gaataagact 540

gccacgaacc ctctgaccat tgaggttccg tacatctgta cggaggggga ggaccagatt 600

acagtttggg ggtttcactc cgacagtgag acccagatgg ccaagctgta tggtgactcc 660

aagccgcaga agttcacttc ttcggctaat ggagtcacca cccattacgt cagtcagatt 720

gggggcttcc ccaatcagac tgaggatggg ggcctccccc agtctggccg gattgtggtg 780

gactacatgg tccagaagtc cggcaagact ggcaccatca cctaccagcg gggaatcctt 840

ctcccgcaga aggtgtggtg cgcaagcggt cggtctaagg tgatcaaggg gagcctgccc 900

ttgatcggcg aggccgactg cttgcacgag aagtacggcg ggctcaacaa gagcaagccg 960

tactacacag gggagcacgc caaggcgatc gggaactgcc cgatctgggt gaagactccc 1020

ctgaagctgg cgaacggtac caagtaccgt ccgccagcga agctcctcaa ggagaggggc 1080

ttcttcgggg ctattgctgg attcctggag ggcggatggg agggcatgat tgccgggtgg 1140

catggctaca ctagccatgg cgcccacggc gttgctgtgg ccgccgacct caagagcacc 1200

caggaggcca taaacaagat cacgaagaac ctgaactcgc tgagcgagct ggaggtgaag 1260

aacctccagc ggctcagcgg ggccatggac gagctccata acgagatctt ggagctcgac 1320

gagaaggtgg atgatctgcg agctgatacc atcagctcgc agatcgagct ggcggtgctc 1380

ctgtccaacg aggggatcat caactcggag gacgagcacc tgctagcgct ggagcgcaag 1440

ctcaagaaga tgcttgggcc cagcgcggtc gagataggta atgggtgctt cgagacgaag 1500

cacaagtgca accagacctg tctcgaccgc atcgccgccg gcacttttga tgccggcgag 1560

ttcagcctgc caacgttcga ctcgctgaac atcaccgcag cgagtctgaa cgacgacggg 1620

ctggacaatc acaccattct cctctattac agcaccgcgg ccagttctct ggccgtgacg 1680

ctgatgatag ctatcttcgt ggtctatatg gtctcccggg acaacgtgtc gtgctcgata 1740

tgtttgtga 1749

<210> 70

<211> 1749

<212> DNA

<213> Artificial Sequence

<220>

<223> Opti 4 (B/Victoria) DNA ORF

<400> 70

atgaaggcca tcatcgtgct gctgatggtg gtgaccagca acgccgacag gatctgcacc 60

ggcatcacca gcagcaacag cccccacgtg gtgaagaccg ccacccaggg cgaggtgaac 120

gtgaccggcg tgatccccct gaccaccacc cccaccaaga gccacttcgc caacctgaag 180

ggcaccgaga ccaggggcaa gctgtgcccc aagtgcctga actgcaccga cctggacgtg 240

gccctgggca gacccaagtg caccggcaag atccccagcg ccagggtgag catcctgcac 300

gaggtgagac ccgtgaccag cggctgcttc cccatcatgc acgacagaac caagatcaga 360

cagctgccca acctgctgag gggctacgag cacgtgaggc tgagcaccca caacgtgatc 420

aacgccgagg acgcccccgg cagaccctac gagatcggca ccagcggcag ctgccccaac 480

atcaccaacg gcaacggctt cttcgccacc atggcctggg ccgtgcccaa gaacaagacc 540

gccaccaacc ccctgaccat cgaggtgccc tacatctgca ccgagggcga ggaccagatc 600

accgtgtggg gcttccacag cgacagcgag acccagatgg ccaagctgta cggcgacagc 660

aagccccaga agttcaccag cagcgccaac ggcgtgacca cccactacgt gagccagatc 720

ggcggcttcc ccaaccagac cgaggacggc ggcctgcccc agagcggcag aatcgtggtg 780

gactacatgg tgcagaagtc cggcaagacc ggcaccatca cctaccagag gggcatcctg 840

ctgccccaga aggtgtggtg cgccagcggc aggagcaagg tgatcaaggg cagcctgccc 900

ctgatcggcg aggccgactg cctgcacgag aagtacggcg gcctgaacaa gagcaagccc 960

tactacaccg gcgagcacgc caaggccatc ggcaactgcc ccatctgggt gaagaccccc 1020

ctgaagctgg ccaacggcac caagtacaga ccccccgcca agctgctgaa ggagagaggc 1080

ttcttcggcg ccatcgccgg cttcctggag ggcggctggg agggcatgat cgccggctgg 1140

cacggctaca ccagccacgg cgcccacggc gtggccgtgg ccgccgacct caagagcacc 1200

caggaggcca tcaacaagat caccaagaac ctgaacagcc tgagcgagct ggaggtgaag 1260

aacctgcaga gactgagcgg cgccatggac gagctgcaca acgagatcct ggagctggac 1320

gagaaggtgg acgacctgag ggccgacacc atcagcagcc agatcgagct ggccgtgctg 1380

ctgagcaacg agggcatcat caacagcgag gacgagcacc tgctggccct ggagagaaag 1440

ctgaagaaga tgctgggccc cagcgccgtg gagatcggca acggctgctt cgagaccaag 1500

cacaagtgca accagacctg cctggacaga atcgccgccg gcaccttcga cgccggcgag 1560

ttcagcctgc ccaccttcga cagcctgaac atcaccgccg ccagcctgaa cgacgacggc 1620

ctggacaacc acaccatcct gctgtactac agcaccgccg ccagcagcct ggccgtgacc 1680

ctgatgatcg ccatcttcgt ggtgtacatg gtgagcagag acaacgtgag ctgcagcatc 1740

tgcctgtga 1749

<210> 71

<211> 1749

<212> DNA

<213> Artificial Sequence

<220>

<223> Ori (B/Victoria) DNA ORF

<400> 71

atgaaggcaa taattgtact actcatggta gtaacatcca atgcagatcg aatctgcact 60

gggataacat cgtcaaactc accacatgtc gtcaaaactg ctactcaagg ggaggtcaac 120

gtgaccggtg taataccact gacaacaaca cccaccaaat ctcattttgc aaatctcaaa 180

ggaacagaaa ccagggggaa actatgccca aaatgcctca actgcacaga tctggatgta 240

gccttgggca gaccaaaatg cacagggaaa ataccctctg caagggtttc aatactccat 300

gaagtcagac ctgttacatc tgggtgcttt cctataatgc acgatagaac aaaaattaga 360

cagctgccta accttctccg aggatacgaa catgtcaggt tatcaactca caacgttatc 420

aatgcagaag atgcaccagg aagaccctac gaaattggaa cctcagggtc ttgccctaac 480

attaccaatg gaaacggatt cttcgcaaca atggcttggg ccgtcccaaa aaacaaaaca 540

gcaacaaatc cattaacaat agaagtacca tacatttgta cagaaggaga agaccaaatt 600

accgtttggg ggttccactc tgacagcgag acccaaatgg caaagctcta tggggactca 660

aagccccaga agttcacctc atctgccaac ggagtgacca cacattacgt ttcacagatt 720

ggtggcttcc caaatcaaac agaagacgga ggactaccac aaagtggcag aattgttgtt 780

gattacatgg tgcagaaatc tggaaaaaca ggaacaatta cctatcaaag aggtatttta 840

ttgcctcaaa aggtgtggtg cgcaagtggc aggagcaagg taataaaagg atccttgccc 900

ttaattggag aagcagattg cctccatgaa aaatacggtg gattaaacaa aagcaagcct 960

tactacacag gggaacatgc aaaggccata ggaaattgcc caatatgggt gaaaacaccc 1020

ttgaagctgg ccaatggaac caaatataga ccccctgcaa aactattaaa ggaaagaggt 1080

ttcttcggag ccattgctgg tttcttagag ggaggatggg aaggaatgat tgcaggttgg 1140

cacggataca catcccatgg ggcacatgga gtagcggtgg cagctgacct taagagcact 1200

caagaggcca taaacaagat aacaaaaaat ctcaactctt tgagtgagct ggaagtaaag 1260

aatcttcaaa gactaagcgg tgccatggat gaactccaca acgaaatact agaactagat 1320

gagaaagtgg atgatctcag agctgataca ataagctcac aaatagaact cgcagtcctg 1380

ctttccaatg aaggaataat aaacagtgaa gatgaacatc tcttggcgct tgaaagaaag 1440

ctgaagaaaa tgctgggccc ctctgctgta gagataggga atggatgctt tgaaaccaaa 1500

cacaagtgca accagacctg tctcgacaga atagctgctg gtacctttga tgcaggagaa 1560

ttttctctcc ccacctttga ttcactgaat attactgctg catctttaaa tgacgacgga 1620

ttggacaatc atactatact gctttactac tcaactgctg cctccagttt ggctgtaaca 1680

ctgatgatag ctatctttgt tgtttatatg gtctccagag acaatgtttc ttgctccatt 1740

tgtctataa 1749

<210> 72

<211> 1755

<212> DNA

<213> Artificial Sequence

<220>

<223> Opti 1 (B/Yamagata) DNA ORF

<400> 72

atgaaagcaa taatagtgct gctgatggtg gtgaccagca acgccgacag gatctgcacc 60

ggcatcacca gcagcaacag cccccacgtg gtgaagacag ccacccaggg cgaggtgaac 120

gtgaccggag tgataccact gacaacaaca ccaacaaagt cttacttcgc caacctgaag 180

ggcaccagga cccggggcaa gctgtgcccc gactgcctga actgcaccga tctggatgtg 240

gccctggggc ggcctatgtg cgtggggacc acccccagcg ccaaggccag catcctgcac 300

gaggtgcggc ctgtgaccag cggctgcttt cctatcatgc acgataggac caagatcagg 360

cagctgccca acctgctgcg gggctacgag aagatccggc tgagcaccca gaacgtgatc 420

gacgccgaga aggcccccgg cgggccctac aggctgggca cctccgggag ctgccccaac 480

gccacatcca agatcggctt cttcgccacc atggcctggg ccgtgcccaa ggacaactac 540

aagaacgcca ccaatccact gaccgtggag gtgccctaca tctgtaccga gggcgaggac 600

cagatcaccg tgtggggctt ccacagcgat gacaagacac agatgaagtc cctgtacggc 660

gacagcaacc cccagaagtt caccagctcc gccaacggcg tgaccaccca ctacgtgagc 720

cagattgggg acttccccga ccagaccgag gacgggggcc tgccccagtc tggccgcatc 780

gtggtggact acatgatgca gaagcccggc aagaccggga ccatcgtgta ccagcggggc 840

gtgctgctgc cccagaaggt gtggtgcgcc agcgggcgga gcaaggtgat caagggcagt 900

ctgcctctga tcggcgaggc agactgcctg cacgaggagt atggcggact gaacaagtcc 960

aagccatact acaccggcaa gcacgccaag gccattggca actgccccat ctgggtgaag 1020

acccccctga agctggccaa tggcaccaag taccgccctc cagccaagct gctgaaggag 1080

cggggcttct tcggcgccat cgccggcttc ctggagggcg gctgggaggg catgatcgcc 1140

ggctggcacg gatacaccag ccacggcgcc cacggcgtgg ccgtggccgc cgacctgaag 1200

tccacccagg aggccataaa caagatcacc aagaacttga acagcctgag cgagctggag 1260

gtgaagaacc tccagcggct gtccggcgcc atggacgagc tgcacaacga gatcctggag 1320

ctggacgaga aggtggacga tctgagagct gacaccatca gctctcagat cgagctggcc 1380

gtgctgctga gcaacgaggg catcatcaac agcgaggatg agcacctgct ggccctggag 1440

cggaagctga agaagatgct ggggcccagc gccgtggaca tcggcaacgg ctgcttcgag 1500

accaagcaca agtgcaatca gacctgtctg gacaggatcg ccgccggcac cttcaacgcc 1560

ggcgagttct ccctgcccac cttcgacagc ctgaacatca ccgccgccag cctgaacgac 1620

gacgggctgg acaaccacac catcctgctg tactactcca ccgccgccag cagcctggcc 1680

gtgaccctga tgctggccat cttcatcgtg tacatggtga gcagggacaa tgtgtcttgc 1740

tccatctgcc tgtga 1755

<210> 73

<211> 1755

<212> DNA

<213> Artificial Sequence

<220>

<223> Opti 2 (B/Yamagata) DNA ORF

<400> 73

atgaaagcaa taatcgtgct gctgatggtg gtgaccagca atgccgacag gatttgcacc 60

ggcatcacca gcagcaactc cccccatgtg gtgaagaccg ccacacaggg ggaggtgaat 120

gtgacaggcg tgatccctct gaccaccaca cccaccaagt cctacttcgc caacctgaag 180

gggacccgga cccggggcaa gctgtgtcca gactgtctga actgcacaga tctggacgtg 240

gccctgggcc ggcccatgtg cgtggggacc acccccagcg ccaaggccag catcctgcac 300

gaggtgaggc ccgtgactag cggctgcttt cctatcatgc acgataggac caagattagg 360

cagctgccta atctgctgcg cggctatgag aagatcaggc tgtccaccca gaatgtgatc 420

gacgccgaga aggctcccgg cggcccctac cggctgggca cctctggctc atgccctaac 480

gccacctcca agattgggtt ctttgccacc atggcctggg ccgtgcccaa ggacaactac 540

aagaacgcca ccaaccccct gactgtggag gtgccctaca tctgcacaga gggggaggat 600

cagatcaccg tgtggggctt ccactctgac gacaagaccc agatgaagtc cctgtacggt 660

gattctaatc cccagaagtt caccagctcc gccaatggcg tgaccaccca ctacgtctcc 720

cagattgggg acttccccga ccagaccgag gacgggggcc tgccccagtc tgggagaatc 780

gtggtggact acatgatgca gaagcccggg aagaccggga ccatcgtgta ccagcggggc 840

gtgctgctgc cccagaaggt gtggtgcgcc agcgggcgga gcaaggtgat caagggcagt 900

ctgcctctga tcggagaggc agactgcctg cacgaggagt atggcggact gaacaagtcc 960

aagccatact acaccggcaa gcacgccaag gccattggca actgcccaat ctgggtgaag 1020

acacccctga agctggcgaa cggcaccaag taccgccctc cagccaagct gctgaaggag 1080

cggggcttct tcggtgccat tgccggcttt ctggagggcg gctgggaggg catgatcgcc 1140

ggctggcacg gctacaccag ccatggcgcc catggcgtgg ccgtggcagc cgacctgaag 1200

tccacccagg aggctatcaa caagattacc aagaatctga atagcctgag cgagctggag 1260

gtgaagaacc tccagcggct gtccggcgcc atggatgagc tgcacaacga gatcctggag 1320

ctggacgaga aggtggacga tctgagagct gataccatca gctctcagat cgagctggcc 1380

gtgttactgt ccaacgaggg catcatcaac agcgaggatg agcacctgct ggcgctggag 1440

cgcaagctga agaagatgct gggccccagc gccgtggaca tcggcaacgg ctgcttcgag 1500

accaagcaca agtgcaacca gacctgcctg gaccggatcg ccgccgggac cttcaacgca 1560

ggcgagttca gcctgcccac attcgacagc ctgaacatca cagccgccag cctgaacgac 1620

gatggcctgg acaaccacac catcctgctg tactacagca cagccgctag cagcctggcc 1680

gtgaccctga tgctggccat cttcatcgtg tacatggtca gcagggacaa cgtgtcctgc 1740

agcatttgcc tgtga 1755

<210> 74

<211> 1755

<212> DNA

<213> Artificial Sequence

<220>

<223> Opti 3 (B/Yamagata) DNA ORF

<400> 74

atgaaagcaa taatagtgct gctgatggtg gtgaccagca atgcagatcg gatctgcact 60

ggcatcacca gcagcaactc cccccatgtg gtgaagaccg ccacacaggg ggaggtgaac 120

gtgaccggcg tgataccact cacaacaaca ccaacaaaga gctacttcgc caacctgaag 180

gggactcgga cacggggcaa gctgtgcccc gactgtctga actgcactga tctggacgtg 240

gccctggggc ggcctatgtg cgtggggacc acccccagcg caaaggcctc tatcctgcat 300

gaggtgcggc cagtgacctc tggctgcttc cccatcatgc acgatagaac caagattagg 360

cagctgccta atctgctccg gggctacgag aagatcaggc tgtccaccca gaacgtcatc 420

gacgccgaga aggcccccgg ggggccttac cggctgggga ccagcggaag ttgccccaac 480

gcaacttcca agattgggtt ctttgccacc atggcctggg ccgtgcccaa ggacaactac 540

aagaacgcca ccaatcccct gacggtggag gtgccctaca tctgcaccga gggggaggat 600

cagatcaccg tgtggggctt ccactctgac gacaagactc agatgaagtc cctgtacggt 660

gattctaatc cccagaagtt caccagctcc gccaatggcg tgaccaccca ctacgtctcc 720

cagattgggg acttccccga ccagaccgag gacgggggcc tgccccagtc tgggagaatc 780

gtggtggact acatgatgca gaagcccggg aagaccggga ccatcgtgta ccagcggggc 840

gtgctgctgc cccagaaggt gtggtgcgcc agcgggcgga gcaaggtgat caagggcagt 900

ctgcctctga tcggagaggc agactgcctg cacgaggagt atggcggact gaacaagtcc 960

aagccatact acaccggcaa gcacgccaag gccattggca actgcccaat ctgggtgaag 1020

acacccctga agctggccaa cggcaccaag tacaggcccc ccgccaagct cctgaaggag 1080

cggggctttt tcggcgccat cgctggcttt ttagaaggag gatgggaagg gatgatcgcc 1140

ggctggcacg gctacaccag ccatggcgcc catggcgtgg ccgtggcagc cgacctgaag 1200

tccacccagg aggctatcaa caagattacc aagaatctga atagcctcag cgagctggag 1260

gtgaagaacc tccagcggct gtccggcgcc atggatgagc tgcacaacga gatcctggag 1320

ctggacgaga aggtggacga tctgagagct gataccatca gctctcagat cgagctggcc 1380

gtgctgctgt caaatgaagg cattatcaac agcgaggacg agcatcttct ggccctggag 1440

aggaagctga agaagatgct cggcccctcc gctgttgata tcggcaacgg gtgctttgag 1500

acaaagcaca agtgcaacca gacctgtctg gaccggatcg ccgccggcac cttcaatgcc 1560

ggcgagtttt ccctgcccac atttgacagc ctgaatatta cagcagccag cctgaacgac 1620

gacgggctgg acaaccacac catcctgctg tattattcaa ccgcggccag ctccctggcc 1680

gtgacactga tgctggccat cttcatcgtg tacatggtga gccgggacaa cgtgagctgc 1740

agcatctgcc tgtga 1755

<210> 75

<211> 1755

<212> DNA

<213> Artificial Sequence

<220>

<223> Opti 4 (B/Yamagata) DNA ORF

<400> 75

atgaaagcga taatagtgct gctgatggtg gtgaccagca atgccgacag gatttgcacc 60

ggcatcacca gcagcaacag cccacacgtg gtgaagacag ctacccaagg agaagtgaac 120

gtcacaggag tgataccact gacaacaaca ccaacaaaga gctacttcgc caacctgaag 180

ggcactcgga cacggggcaa gctgtgcccc gactgtctga actgcaccga tctggacgtg 240

gccctgggga ggcccatgtg cgtgggcaca accccctccg ccaaggcctc tatcctgcat 300

gaggtgcggc cagtgacctc tggctgcttc cccatcatgc acgatagaac caagatccgg 360

cagctgccca acctgctgcg cggatacgag aagattcggc tgtcaacaca gaacgtgatt 420

gacgccgaga aggcccccgg aggtccctac cggctgggga cctccgggtc ctgcccaaat 480

gccaccagca agattgggtt cttcgccacc atggcctggg ccgtgcccaa ggacaattat 540

aagaacgcca ccaatccact gaccgtggag gtgccttata tttgtaccga gggcgaggac 600

cagatcaccg tgtggggctt ccacagtgac gacaagacgc agatgaagtc actgtatggg 660

gatagcaatc cccagaagtt cacttcatct gccaatgggg tgaccaccca ctacgtcagt 720

cagatcgggg acttccccga tcagactgag gatgggggtc tgccccagtc cgggcgcatc 780

gtggtggact acatgatgca gaagcccgga aagaccggca ccatcgtgta ccagcgcggg 840

gtgctgctgc ctcagaaggt ctggtgcgcc agcggtcggt ctaaggtgat caaggggagc 900

ctgcccctga tcggcgaggc cgactgcctg cacgaggagt atggcggact gaacaagtcc 960

aagccatact acactgggaa gcatgccaag gccattggca actgccctat ctgggtgaag 1020

acccccctga agctggccaa cgggaccaag taccggcccc ctgccaagct gctgaaggag 1080

cggggcttct tcggcgccat cgccggattc ctggagggcg gctgggaggg catgatcgcc 1140

gggtggcatg gctacaccag ccatggcgcc cacggcgtgg ccgtcgcagc cgacctcaag 1200

agcactcagg aggcgatcaa caagatcacc aagaacctga actctctgag cgagctggag 1260

gtgaagaacc tccagcggct cagcggcgcc atggacgagc tccacaacga gatcctggag 1320

ctggatgaga aggtggacga cctgcgcgcc gacaccatca gcagccagat cgagctggct 1380

gtgctcctga gcaacgaggg catcatcaac agcgaggatg agcacctcct ggctctggag 1440

cggaagctga agaagatgct gggccccagc gccgtcgaca tcggcaacgg gtgcttcgag 1500

accaagcaca agtgcaacca gacgtgcctg gaccggatcg ccgccggcac gttcaacgca 1560

ggcgagttct ctctgcccac cttcgacagc ctgaacatca ccgctgccag cctgaacgac 1620

gacgggctgg acaaccacac catcctgctg tactacagca ccgccgccag cagcctggcg 1680

gtgacactga tgctggccat cttcatcgtg tacatggtgt ctcgcgacaa cgtgagctgc 1740

agcatctgcc tgtga 1755

<210> 76

<211> 1755

<212> DNA

<213> Artificial Sequence

<220>

<223> Opti 5 (B/Yamagata) DNA ORF

<400> 76

atgaaagcaa taatagtgct gctgatggtg gtgaccagca atgcagatcg gatctgcact 60

ggcatcacca gcagcaactc cccccacgtg gtgaagaccg ccacgcaggg agaagtgaat 120

gtcacaggag tgataccact gacaacaaca ccaacaaaga gctacttcgc caacctgaag 180

ggcactcgga ctcggggcaa gctgtgcccc gactgtctga actgcacgga tctggacgtg 240

gcgctgggga ggcccatgtg cgtgggcact acccccagcg ccaaggccag catcctgcac 300

gaggtgcggc ccgtgactag tgggtgcttt cccattatgc acgaccgcac caagattagg 360

cagctgccta atctcctccg ggggtacgag aagattcggc tgtcgacaca gaatgtgatc 420

gacgccgaga aggcccccgg agggccctac aggttgggga ccagtggctc ttgcccaaat 480

gctacatcca agatcgggtt ctttgccacc atggcctggg ccgtgcccaa ggacaattac 540

aagaatgcca ccaatcccct gacggtggag gtgccctaca tctgcaccga gggggaggat 600

cagatcaccg tgtggggctt ccactctgac gacaagacgc agatgaagtc cctgtacggt 660

gattctaatc cccagaagtt caccagctcc gccaatggcg tcaccaccca ctacgtctcc 720

cagattgggg acttccccga tcagaccgag gatgggggac tgccccagtc tgggagaatc 780

gtggtggact acatgatgca gaagcccggc aagactggta caatcgtgta ccagcggggc 840

gtgcttctgc ctcagaaggt gtggtgcgcc agcgggcgga gcaaggtgat caagggcagt 900

ctgccgctca tcggagaggc agactgcctg cacgaggagt acggcgggct caacaagagc 960

aagccgtact acaccggcaa gcacgccaag gccattggca attgcccgat ctgggtgaag 1020

acccctctga agctggccaa cgggacgaag tatcgtcccc cggccaagct tctgaaggag 1080

aggggcttct tcggggccat cgccggattc ttagaaggcg gctgggaagg tatgattgct 1140

gggtggcacg ggtacaccag ccacggcgcc cacggggtcg ccgtggctgc cgacctgaag 1200

tccacccagg aggcgatcaa caagatcacc aagaacctga actcgctcag cgagctggag 1260

gtgaagaacc tccagcggct gagcggggcc atggacgagc tccacaacga gatcctggag 1320

ctcgacgaga aggtggacga tctgagagct gataccatca gctctcagat cgagctggcg 1380

gtgctcctgt ccaatgaggg gatcatcaac tcagaggacg agcacctgct ggctctggag 1440

agaaagctga agaagatgct gggtccaagc gcggtcgaca tcggcaacgg gtgcttcgag 1500

acgaagcaca agtgcaacca gacctgcttg gaccgcatcg ccgccggcac cttcaatgcc 1560

ggcgagtttt ctctccccac cttcgacagc ctgaacatca cggctgccag cctgaacgac 1620

gacgggctgg acaatcatac catcctgctg tactacagca cagccgcctc cagcctggcg 1680

gtgaccctga tgctcgccat attcatcgtg tatatggtga gcagggacaa cgtgtcctgt 1740

agcatttgcc tgtga 1755

<210> 77

<211> 1755

<212> DNA

<213> Artificial Sequence

<220>

<223> Opti 6 (B/Yamagata) DNA ORF

<400> 77

atgaaagcaa taatcgtgct gctgatggtg gtgaccagca atgcagatcg gatctgcact 60

ggcatcacca gcagcaactc cccccacgtg gtgaagaccg ccacgcaggg ggaggtaaat 120

gttacaggcg ttatcccgtt gaccacgact cccacgaagt cctacttcgc caacctgaag 180

gggactagga ctcgtgggaa gctgtgcccg gactgcttga attgtaccga tcttgacgtg 240

gccctggggc ggcctatgtg cgtggggacc accccgagcg caaaggcctc gatcctgcat 300

gaggtgcgcc cggtgacctc cgggtgcttc cccatcatgc acgatcgaac caagattcgg 360

cagctgccga atctgctccg gggctacgag aagatccggc tgtcgacaca gaatgtgatc 420

gacgccgaga aggccccagg cgggccctac cgcctgggga cttctgggag ctgccccaac 480

gccacgtcga agatcggctt cttcgccacg atggcgtggg cagttcccaa ggacaattac 540

aagaacgcta ctaaccccct cacggtggag gtcccctaca tctgcacaga gggggaggac 600

cagatcaccg tgtgggggtt tcatagcgac gacaagacgc agatgaagtc actttatggg 660

gatagcaatc cccagaagtt cacttcatct gcgaacgggg tgaccaccca ttacgtcagt 720

cagatcgggg acttccccga tcagactgag gatgggggtc tcccccagtc cgggcgcatc 780

gtggtcgact acatgatgca gaagccgggc aagaccggca ccatcgtgta ccagaggggg 840

gtcttgctgc cccagaaggt ctggtgtgct agcggtcggt ctaaggtgat caagggctcc 900

ctgcccttga tcggcgaggc cgactgcttg cacgaggagt acggcgggct caacaagagc 960

aagccgtact acaccggcaa gcacgccaag gccatcggga actgcccgat ctgggtcaag 1020

acccccctca agctggcgaa cggtaccaag taccgtccgc cagcgaagct cctcaaggag 1080

aggggcttct tcggggcgat cgcaggattc ttagaaggag ggtgggaagg gatgatcgcc 1140

ggctggcatg gttacaccag ccacggcgcc cacggggtcg ccgtggctgc cgacctgaag 1200

tccacacagg aggccatcaa caagatcacc aagaacctga actcgctcag cgagctggag 1260

gtgaagaacc tccagcggct gagcggggcc atggacgagc tccataacga gatcttggag 1320

ctcgacgaga aggtggacga tctgcgagca gataccatca gctcgcagat cgagctagcg 1380

gtgctcctgt ccaacgaggg gatcatcaac tcggaggacg agcacctgct ggctcttgag 1440

cggaagctca agaagatgtt ggggccttct gccgtggaca tcgggaacgg gtgcttcgag 1500

acgaagcaca agtgtaacca gacgtgcctg gaccgcatcg cggccggcac gttcaacgcc 1560

ggcgagtttt cccttcccac cttcgatagt ctgaacatca cggccgcgtc gttgaacgac 1620

gacggccttg ataatcacac tatcctgctg tactacagta cagcagcctc cagcctggcg 1680

gtcaccctga tgctcgccat attcatcgtg tatatggtga gcagggataa cgtgtcctgt 1740

agcatttgcc tgtga 1755

<210> 78

<211> 1755

<212> DNA

<213> Artificial Sequence

<220>

<223> Opti 7 (B/Yamagata) DNA ORF

<400> 78

atgaaggcca tcatcgtgct gctgatggtg gtgaccagca acgccgacag gatctgcacc 60

ggcatcacca gcagcaacag cccccacgtg gtgaagaccg ccacccaggg cgaggtgaac 120

gtgaccggcg tgatccccct gaccaccacc cccaccaaga gctacttcgc caacctgaag 180

ggcaccagga ccagaggcaa gctgtgcccc gactgcctga actgcaccga cctggacgtg 240

gccctgggca ggcccatgtg cgtgggcacc acccccagcg ccaaggccag catcctgcac 300

gaggtgagac ccgtgaccag cggctgcttc cccatcatgc acgacagaac caagatcagg 360

cagctgccca acctgctgag gggctacgag aagatcaggc tgagcaccca gaacgtgatc 420

gacgccgaga aggcccccgg cggcccctac agactgggca ccagcggcag ctgccccaac 480

gccaccagca agatcggctt cttcgccacc atggcctggg ccgtgcccaa ggacaactac 540

aagaacgcca ccaaccccct gaccgtggag gtgccctaca tctgcaccga gggcgaggac 600

cagatcaccg tgtggggctt ccacagcgac gacaagaccc agatgaagtc cctgtacggc 660

gacagcaacc cccagaagtt caccagcagc gccaacggcg tgaccaccca ctacgtgagc 720

cagatcggcg acttccccga ccagaccgag gacggcggcc tgccccagag cggcagaatc 780

gtggtggact acatgatgca gaagcccggc aagaccggca ccatcgtgta ccagaggggc 840

gtgctgctgc cccagaaggt gtggtgcgcc agcggcagga gcaaggtgat caagggcagc 900

ctgcccctga tcggcgaggc cgactgcctg cacgaggagt acggcggcct gaacaagagc 960

aagccctact acaccggcaa gcacgccaag gccatcggca actgccccat ctgggtgaag 1020

acccccctga agctggccaa cggcaccaag tacaggcccc ccgccaagct gctgaaggag 1080

aggggcttct tcggcgccat cgccggcttc ctggagggcg gctgggaggg catgatcgcc 1140

ggctggcacg gctacaccag ccacggcgcc cacggcgtgg ccgtggccgc cgacctgaag 1200

tccacccagg aggccatcaa caagatcacc aagaacctga acagcctgag cgagctggag 1260

gtgaagaacc tgcagaggct gagcggcgcc atggacgagc tgcacaacga gatcctggag 1320

ctggacgaga aggtggacga cctgagagcc gacaccatca gcagccagat cgagctggcc 1380

gtgctgctga gcaacgaggg catcatcaac agcgaggacg agcacctgct ggccctggag 1440

aggaagctga agaagatgct gggccccagc gccgtggaca tcggcaacgg ctgcttcgag 1500

accaagcaca agtgcaacca gacctgcctg gacaggatcg ccgccggcac cttcaacgcc 1560

ggcgagttca gcctgcccac cttcgacagc ctgaacatca ccgccgccag cctgaacgac 1620

gacggcctgg acaaccacac catcctgctg tactacagca ccgccgccag cagcctggcc 1680

gtgaccctga tgctggccat cttcatcgtg tacatggtga gcagggacaa cgtgagctgc 1740

agcatctgcc tgtga 1755

<210> 79

<211> 1755

<212> DNA

<213> Artificial Sequence

<220>

<223> Ori (B/Yamagata) DNA ORF

<400> 79

atgaaggcaa taattgtact actcatggta gtaacatcca acgcagatcg aatctgcact 60

gggataacat cttcaaactc acctcatgtg gtcaaaacag ctactcaagg ggaggtcaat 120

gtgactggcg tgataccact gacaacaaca ccaacaaaat cttattttgc aaatctcaaa 180

ggaacaagga ccagagggaa actatgcccg gactgtctca actgtacaga tctggatgtg 240

gccttgggca ggccaatgtg tgtggggacc acaccttctg ctaaagcttc aatactccat 300

gaggtcagac ctgttacatc cgggtgcttt cctataatgc acgacagaac aaaaatcagg 360

caactaccca atcttctcag aggatatgaa aagatcaggt tatcaaccca aaacgttatc 420

gatgcagaaa aagcaccagg aggaccctac agacttggaa cctcaggatc ttgccctaac 480

gctaccagta aaatcggatt ttttgcaaca atggcttggg ctgtcccaaa ggacaactac 540

aaaaatgcaa cgaacccact aacagtggaa gtaccataca tttgtacaga aggggaagac 600

caaattactg tttgggggtt ccattcggat gacaaaaccc aaatgaaaag cctctatgga 660

gactcaaatc ctcaaaagtt cacctcatct gctaatggag taaccacgca ttatgtttct 720

cagattggcg acttcccaga tcaaacagaa gacggaggac taccacaaag cggcagaatt 780

gttgttgatt acatgatgca aaaacctggg aaaacaggaa caattgtcta tcaaaggggt 840

gttttgttgc ctcaaaaggt gtggtgcgcg agtggcagga gcaaagtaat aaaagggtca 900

ttgcctttaa ttggtgaagc agattgcctt catgaagaat acggtggatt aaacaaaagc 960

aagccttact acacaggaaa acatgcaaaa gccataggaa attgcccaat atgggtaaaa 1020

acacctttga agcttgccaa tggaaccaaa tatagacctc ctgcaaaact attgaaggaa 1080

aggggtttct tcggagctat tgctggtttc ctagaaggag gatgggaagg aatgattgca 1140

ggttggcacg gatacacatc tcacggagca catggagtgg cagtggcggc agaccttaag 1200

agtacacaag aagctataaa taagataaca aaaaatctca attctttgag tgaactagaa 1260

gtaaagaacc ttcaaagact aagtggtgcc atggatgaac tccacaacga aatactcgag 1320

ctggatgaaa aagtggatga tctcagagct gacactataa gctcacaaat agaacttgca 1380

gtcttgcttt ccaacgaagg aataataaac agtgaagacg agcatctatt ggcacttgag 1440

agaaaactaa agaaaatgct gggtccctct gctgtagaca taggaaacgg atgcttcgaa 1500

accaaacaca aatgcaacca gacctgctta gacaggatag ctgctggcac ctttaatgca 1560

ggagaatttt ctctccccac ttttgattca ttgaacatta ctgctgcatc tttaaatgat 1620

gatggattgg ataaccatac tatactgctc tattactcaa ctgctgcttc tagtttggct 1680

gtaacattaa tgctagctat ttttattgtt tatatggtct ccagagacaa cgtttcatgc 1740

tccatctgtc tataa 1755

Claims

(2) A second coding region that (a) encodes the amino acid sequence of SEQ ID NO. 2 or an amino acid sequence that is at least 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO. 2; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOS: 11-15;

(3) A third coding region that (a) encodes the amino acid sequence of SEQ ID NO. 3 or an amino acid sequence that is at least 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO. 3; and (b) comprises a nucleotide sequence having at least 90% identity to the nucleotide sequence of any one of SEQ ID NOS: 17-20; and

2. The vaccine of claim 1, wherein the at least one coding region is selected from the group consisting of:

3. The vaccine of claim 2, wherein the at least one coding region is selected from the group consisting of:

4. The vaccine of claim 2, wherein the at least one coding region is selected from the group consisting of:

5. The vaccine of claim 3 or 4, wherein said at least one coding region is selected from the group consisting of:

(1) A first coding region comprising the nucleotide sequence of SEQ ID NO. 5;

(2) A second coding region comprising the nucleotide sequence of SEQ ID NO. 12;

(4) A fourth coding region comprising the nucleotide sequence of SEQ ID NO. 26.

6. The vaccine of claim 1, wherein the at least one RNA is selected from the group consisting of:

7. The vaccine of claim 6, wherein the at least one RNA is selected from the group consisting of:

8. The vaccine of claim 7, wherein the at least one RNA is selected from the group consisting of:

(3) A third RNA comprising a third coding region, wherein said third coding region comprises the nucleotide sequence of any one of SEQ ID NOs 17-20; and

9. The vaccine of claim 7, wherein the at least one RNA is selected from the group consisting of:

10. The vaccine of claim 8 or 9, wherein the at least one RNA is selected from the group consisting of:

12. The vaccine of claim 8, wherein the at least one RNA is selected from the group consisting of:

13. The vaccine of claim 10, wherein the at least one RNA is selected from the group consisting of:

(1) A first RNA comprising the nucleotide sequence of SEQ ID NO. 34;

(2) A second RNA comprising the nucleotide sequence of SEQ ID NO. 40;

(3) A third RNA comprising the nucleotide sequence of SEQ ID NO. 44; and

(4) And a fourth RNA comprising the nucleotide sequence of SEQ ID NO. 52.

19. The vaccine of claim 18, wherein the at least one cationic polymer is selected from the group consisting of poly-L-lysine, protamine, and polyethylenimine; preferably, the cationic polymer is protamine.

21. The vaccine of claim 20, wherein

(1) The cationic lipid comprises M5, which has the following structure:

22. The vaccine of claim 21, wherein the lipid particle comprises 10-70 mole% M5, 10-70 mole% 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 10-70 mole% cholesterol, and 0.05-20 mole% 1, 2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG) 2000;

25. A composition comprising at least one polynucleotide of claim 24.

26. The composition of claim 25, comprising:

27. The composition of claim 25, comprising:

(1) A first RNA comprising the nucleotide sequence of SEQ ID NO. 34;

(2) A second RNA comprising the nucleotide sequence of SEQ ID NO. 40;

(3) A third RNA comprising the nucleotide sequence of SEQ ID NO. 44; and

(4) And a fourth RNA comprising the nucleotide sequence of SEQ ID NO. 52.

28. The composition of claim 26 or 27, wherein the mass ratio of the first RNA, the second RNA, the third RNA, and the fourth RNA is 1:0.5-2:0.5-4:0.5-4;

29. Use of a vaccine according to any one of claims 1 to 23, a polynucleotide according to claim 24 or a composition according to any one of claims 25 to 28 in the manufacture of a medicament for the prophylaxis and/or treatment of influenza virus infection.