CN117327766A

CN117327766A - Ammonolysis liquid and preparation method and application thereof

Info

Publication number: CN117327766A
Application number: CN202311271817.8A
Authority: CN
Inventors: 周方园; 卜梅杰; 丁彬彬; 唐芦波; 董梓钰; 郝军政; 郑佳琳; 张妍妍
Original assignee: Genewiz Suzhou Ltd
Current assignee: Genewiz Suzhou Ltd
Priority date: 2023-09-28
Filing date: 2023-09-28
Publication date: 2024-01-02

Abstract

The invention provides an ammonolysis solution, a preparation method and application thereof, wherein the ammonolysis solution comprises the following components: tert-butylamine, methanol and aqueous ammonia. The ammonolysis solution can inhibit the generation of ACR derivatives and spirolactone with the molecular weight of 13Da larger than a target molecular weight when the HEX probe is ammonolysis, and can be suitable for ammonolysis of most probes. The invention also provides an ammonolysis method of the probe, which is simple to operate, mild in condition and applicable to ammonolysis of most probes.

Description

Ammonolysis liquid and preparation method and application thereof

Technical Field

The invention belongs to the technical field of nucleic acid solid phase synthesis, and particularly relates to an ammonolysis solution, a preparation method and application thereof.

Background

Oligodeoxynucleotides (ODNs) containing fluorescent groups are widely used in the field of molecular biology and medical diagnostics. 6-carboxyhexachlorofluorescein (HEX) is a common orange dye, commonly used for fluorescent labeling of deoxyribonucleic acid (DNA) probes. The HEX-labeled oligodeoxynucleotides (HEX-ODNs) can be used to measure changes in fluorescence or for other applications where HEX-ODNs interact with biopolymers. HEX-ODNs can be used for both conventional Polymerase Chain Reaction (PCR) and real-time fluorescent quantitative PCR (RT-qPCR). In particular, HEX markers can be used for so-called polychromatic combined probe coding, in which one of 13-15 possible DNA targets is defined during a PCR; the necessary number of probes are labeled with one or 2-4 different fluorophores, including HEX. The presence or absence of defined DNA binding sites in the sample was confirmed from the shape and ratio of the four fluorescence accumulation Curves (CFAs).

In order to monitor subtle differences in dye properties and to perform quantitative and multiplex biological assays, the HEX probe must be of high purity. The HEX probe typically has two methods, ammonia ammonolysis and AMA (ammonia/methylamine aqueous solution=1:1).

(1) Ammonia ammonolysis: the ammonolysis of probes using aqueous ammonium hydroxide under heating is the most conventional method and can be traced back to the earliest early stages of oligonucleotide synthesis. The method has the advantages that the composition of the ammonolysis solution is simple, but when HEX is contained in the probe, ammonia water is used for ammonolysis to damage the HEX structure and generate hexachloroaryl Acridine (ACR) derivatives.

(2) AMA ammonolysis: ammonolysis of probes using AMA under heating is also a common method. The method has the advantages that the ammonolysis time is short, but when HEX is contained in the probe, ammonia is used for ammonolysis to damage the HEX structure and generate spirolactone with the molecular weight being 13Da larger than the target molecular weight.

Ammonia hydrolysis of the above ammonia: the disadvantage is that HEX is caused to form ACR derivatives having different UV-visible and fluorescent properties, which may seriously affect the optical and physicochemical properties of the probe and may lead to inaccurate or erroneous results.

The AMA ammonolysis described above: the disadvantage is that HEX is allowed to form spirolactone of 13Da above the target molecular weight, which is not absorbed in the visible spectrum, which would affect the optical and physicochemical properties of the probe and may lead to inaccurate or erroneous results.

Therefore, the novel ammonolysis solution which can be applied to ammonolysis reaction of most probes has important application value.

Disclosure of Invention

Aiming at the defects existing in the prior art, the invention aims to provide an ammonolysis solution, and a preparation method and application thereof. The ammonolysis solution can inhibit the generation of ACR derivatives and spirolactone with the molecular weight of 13Da larger than a target molecular weight when the HEX probe is ammonolysis, and can be suitable for ammonolysis of most probes.

In order to achieve the aim of the invention, the invention adopts the following technical scheme:

in a first aspect, the present invention provides an ammonolysis solution comprising: tert-butylamine, methanol and aqueous ammonia.

In order to solve the problem that the structure of the HEX probe is destroyed to generate ACR derivatives and spirolactone with the molecular weight being 13Da larger than the target molecular weight when the HEX probe is subjected to ammonia hydrolysis and AMA ammonolysis in the prior art, the invention provides a novel ammonolysis reagent. The ammonolysis reagent suppresses the generation of impurities, has mild use conditions, and can be suitable for ammonolysis of most probes.

Preferably, the volume ratio of tert-butylamine, methanol and ammonia water in the ammonolysis solution is (1-2.5): (5-8), and may be, for example, 1:1:5, 1:1:8, 1:2.5:5, 1:2.5:8, 2.5:1:5, 1:1:8, 2.5:2.5:5, or 2.5:2.5:8, etc.

In a second aspect, the present invention provides a method for preparing the ammonolysis solution according to the first aspect, the method comprising: and mixing tert-butylamine, methanol and ammonia water to prepare the ammonolysis liquid.

In a third aspect, the present invention provides the use of an ammonolysis solution according to the first aspect in DNA solid-phase synthesis.

In a fourth aspect, the present invention provides a method for ammonolysis of a probe, comprising the steps of:

(1) Mixing the solid phase carrier combined with the target probe with the ammonolysis solution in the first aspect, performing heating reaction, and cooling after the heating reaction is completed;

(2) Centrifuging the cooled ammonolysis liquid, heating and centrifuging the filtrate obtained by centrifuging, and concentrating to obtain the liquid containing the target probe.

In the invention, the ammonolysis method is simple to operate, mild in condition and suitable for ammonolysis of most probes.

Preferably, in the step (1), the solid phase carrier is mixed with the ammonolysis solution in a ratio of 1nmol (1 to 3. Mu.L), for example, 1nmol to 1. Mu.L, 1nmol to 1.5. Mu.L, 1nmol to 2. Mu.L, 1nmol to 2.5. Mu.L, 1nmol to 3. Mu.L, or the like.

Preferably, in the step (1), the temperature of the heating reaction is 60 to 70 ℃, for example, 60 ℃, 65 ℃, 70 ℃ or the like.

Preferably, in the step (1), the heating reaction is performed for 2 to 4 hours, for example, 2, 3 or 4.

Preferably, in the step (1), the cooling temperature is-20 to-10 ℃, for example, -20 ℃, -15 ℃ or-10 ℃ and the like.

Preferably, in step (1), the cooling time is 10-15 minutes, for example, 10, 13 or 15.

Preferably, in step (2), the rotational speed of the centrifugation is 11000-13000rpm, for example, 11000rpm, 12000rpm, 13000rpm, or the like.

Preferably, in the step (2), the centrifugation time is 2 to 5 minutes, for example, 2, 3, 4 or 5, etc.

Preferably, in the step (2), the rotational speed of the heated centrifugal concentration is 11000-13000rpm, for example, 11000rpm, 12000rpm, 13000rpm, or the like.

Preferably, in the step (2), the time of heating, centrifuging and concentrating is 25-35 minutes, for example, 25, 30 or 35.

Preferably, in the step (2), the temperature of the heated centrifugal concentration is 60-70 ℃, for example, 60 ℃, 65 ℃ or 70 ℃ and the like.

The numerical ranges recited herein include not only the recited point values, but also any point values between the recited numerical ranges that are not recited, and are limited to, and for the sake of brevity, the invention is not intended to be exhaustive of the specific point values that the recited range includes.

Term interpretation:

an oligonucleotide: linear polynucleotide fragments of two to thirty nucleotide residues linked by phosphodiester bonds. Oligonucleotides can be synthesized automatically by the instrument and can be used as primers, gene probes, etc. for DNA synthesis.

Primer: two oligonucleotide sequences are synthesized artificially, one of which is complementary to one DNA template strand at one end of the target gene, and the other of which is complementary to the other DNA template strand at the other end of the target gene.

And (3) probe: a nucleic acid sequence which carries a detection label and is complementary to the target gene in a known sequence.

Ammonolysis: ammonolysis of oligonucleotides can be divided into three parts: cleavage, phosphate deprotection, and base deprotection. Cleavage refers to removal of the oligonucleotides from the support. Phosphate deprotection refers to the removal of the cyanoethyl protecting group from the phosphate backbone. Base deprotection refers to the removal of a protecting group on a base.

HEX: 6-carboxyhexachlorofluorescein, a common orange dye, is commonly used for fluorescent labeling of deoxyribonucleic acid probes.

AMA: a mixed solution consisting of aqueous ammonia/aqueous methylamine solution=1:1 (v/v).

CPG: controllable microporous glass beads are a commonly used solid phase carrier.

ACR derivative: hexachloroarylacridine derivatives, a nitrogen containing heterocyclic organic compound.

Compared with the prior art, the invention has the following beneficial effects:

(1) The invention suppresses the generation of this impurity by ammonia ammonolysis of ACR derivatives that are produced by HEX probes.

(2) The invention suppresses the formation of impurities in the case where the HEX probe is ammonolyzed by AMA, which produces spirolactone having a molecular weight of 13Da larger than the target molecular weight.

(3) The ammonolysis liquid provided by the invention has mild use conditions, and can be suitable for ammonolysis of most probes.

Drawings

FIG. 1 is a TIC spectrum of a crude 5-terminal FAM-modified 3-terminal MGB-modified probe having a length of 30 bases in example 1.

FIG. 2 is a TIC spectrum of a crude 5-terminal VIC-modified 3-terminal MGB-modified probe of 14 bases in length in example 2.

FIG. 3 is a TIC spectrum of a crude 5-terminal HEX-modified 3-terminal MGB-modified probe of 10 bases in length in example 3.

FIG. 4 is a TIC spectrum of a crude product of a 20 base long 5-terminal NH2 modified 3-terminal MGB modified probe in example 4.

FIG. 5 is a TIC spectrum of a crude product of a 20 base long 5-terminal FAM-modified 3-terminal BHQ 1-modified probe in example 5.

FIG. 6 is a TIC spectrum of a crude 5-terminal VIC-modified 3-terminal BHQ 1-modified probe of 23 bases in length in example 6.

FIG. 7 is a TIC spectrum of a crude 5-terminal HEX-modified 3-terminal BHQ 1-modified probe of 10 bases in length in example 7.

FIG. 8 is a TIC spectrum of a crude 5-terminal amino-modified 3-terminal BHQ 2-modified probe of 23 bases in length in example 8.

FIG. 9 is a TIC spectrum of a crude 5-terminal HEX-modified 3-terminal MGB-modified probe having a length of 10 bases in comparative example 1.

FIG. 10 is a TIC spectrum of a crude 5-terminal HEX-modified 3-terminal MGB-modified probe of comparative example 2, which was 10 bases in length.

FIG. 11 is a TIC spectrum of a crude 5-terminal HEX-modified 3-terminal BHQ 1-modified probe of 10 bases in length in comparative example 3.

FIG. 12 is a TIC spectrum of a crude 5-terminal HEX-modified 3-terminal BHQ 1-modified probe of comparative example 4 having a length of 10 bases.

Detailed Description

The technical scheme of the invention is further described by the following specific embodiments. It will be apparent to those skilled in the art that the examples are merely to aid in understanding the invention and are not to be construed as a specific limitation thereof.

The specific techniques or conditions are not identified in the examples and are described in the literature in this field or are carried out in accordance with the product specifications. The reagents or apparatus used were conventional products commercially available through regular channels, with no manufacturer noted.

Example 1

In this example, an ammonolysis reaction was performed on a probe modified with 30 bases in length by 5-terminal FAM modification 3-terminal MGB (3' -terminal of sequence): AACAGAATAACAGAACAAATGAACAAATCA (SEQ ID No. 1) with a target molecular weight of 10893.16Da. The steps of the ammonolysis reaction are as follows:

1. primer synthesis

Using a packed 200nmol MGB CPG synthesis column, the activator was an acetonitrile solution containing 0.25M 5-Ethylthiotetrazole (ETT), the deprotection reagent was a 3% trichloroacetic acid (TCA) in dichloromethane, the capping reagent was 10% acetic anhydride/acetonitrile and N-methylimidazole/pyridine/acetonitrile (volume ratio 14:10:76), the oxidation reagent was tetrahydrofuran/pyridine/water containing 0.05M iodine (volume ratio 70:20:10), and the synthesis reaction was performed on a dr.oligo 48 synthesizer.

2. Ammonolysis

(1) Mixing tert-butylamine, methanol and ammonia water to obtain an ammonolysis solution, wherein the ammonolysis solution comprises tert-butylamine: methanol: ammonia = 2:2:6 (v/v/v).

(2) CPG carrier with target probe bound thereto was taken out from the synthesis column and placed in a threaded tube, 500. Mu.L of an ammonolysis solution (ratio of ammonolysis solution to carrier 2.5. Mu.L: 1 nmol) was added thereto and the threaded cap was screwed.

(3) The threaded pipe is placed in a water bath kettle with the temperature of 65 ℃ for heating for 4 hours, and after the reaction is finished, the threaded pipe is placed in a refrigerator with the temperature of minus 20 ℃ for cooling for 10 minutes.

(4) The ammonolysis solution in the threaded tube was aspirated and added to the column and centrifuged at 13000rpm for 3 minutes.

(5) The filtrate from the centrifugation was transferred to a new threaded tube and placed in a 65 ℃ vacuum centrifugal dryer and concentrated by centrifugation at 13000rpm for 30 minutes.

(6) The concentrated liquid containing the target probe was collected and then analyzed by LC-MS.

The TIC spectrogram of the 5-end FAM modified 3-end MGB modified probe crude product with the length of 30 bases is shown in figure 1, the retention time of the probe crude product is 4.90 minutes, the molecular weight is 10892.5, the peak area occupation ratio is 73.90%, namely the purity of the probe crude product is 73.90%, and the ammonolysis solution and the ammonolysis method prove that the 5-end FAM modified 3-end MGB modified probe has better ammonolysis effect.

Example 2

In this example, a probe modified by 5-terminal VIC-modified 3-terminal MGB with a length of 14 bases was subjected to ammonolysis reaction, and the sequence was: CCCAGCGCTTCAGC (SEQ ID No. 2) with a target molecular weight of 6023.53Da. The method comprises the following steps:

1. primer synthesis

2. Ammonolysis

(1) Mixing tert-butylamine, methanol and ammonia water to obtain an ammonolysis solution, wherein the ammonolysis solution comprises tert-butylamine: methanol: ammonia = 1:1:8 (v/v/v).

The TIC spectrogram of the crude product of the 5-end VIC modified 3-end MGB modified probe with the length of 14 bases is shown in figure 2, the retention time of the crude product of the probe is 6.00 minutes, the molecular weight is 6022.5, the peak area occupation ratio is 82.41%, namely the purity of the crude product of the probe is 82.41%, and the ammonolysis solution and the ammonolysis method prove that the ammonolysis solution and the ammonolysis method have better ammonolysis effect on the 5-end VIC modified 3-end MGB modified probe.

Example 3

In this example, an ammonolysis reaction was performed on a probe modified with 10 bases in length by 5-terminal HEX modified with 3-terminal MGB, and the sequence is: TTTTTTTTTT (SEQ ID No. 3) with a target molecular weight of 4844.71Da.

The process parameters of the ammonolysis method are the same as in example 1.

The TIC spectrogram of the 10-base-long 5-end HEX-modified 3-end MGB-modified probe crude product is shown in FIG. 3, the retention time of the probe crude product is 6.24 minutes, the molecular weight is 4844.2, the peak area occupation ratio is 71.37%, namely the purity of the probe crude product is 71.37%, and the ammonolysis solution and the ammonolysis method prove that the 5-end HEX-modified 3-end MGB-modified probe has better ammonolysis effect.

Example 4

In this example, an ammonolysis reaction was performed on a probe modified with a 5-terminal NH 2-modified 3-terminal MGB having a length of 20 bases, and the sequence was: ACTTGCCCACGGCCACAGGA (SEQ ID No. 4) with a target molecular weight of 7371.62Da. The method comprises the following steps:

1. primer synthesis

2. Ammonolysis

(1) Mixing tert-butylamine, methanol and ammonia water to obtain an ammonolysis solution, wherein the ammonolysis solution comprises tert-butylamine: methanol: ammonia = 1.8:1.8:6.4 (v/v/v).

The TIC spectrogram of the 5-end NH2 modified 3-end MGB modified probe crude product with the length of 20 bases is shown in figure 4, the retention time of the probe crude product is 4.78 minutes, the molecular weight is 7373.1, the peak area occupation ratio is 65.50%, namely the purity of the probe crude product is 65.50%, and the ammonolysis solution and the ammonolysis method prove that the ammonolysis solution and the ammonolysis method have better ammonolysis effect on the 5-end NH2 modified 3-end MGB modified probe.

Example 5

In this example, a probe modified by 3-terminal BHQ1 modified by 5-terminal FAM with a length of 20 bases was subjected to ammonolysis reaction, and the sequence was: ACTTGCCCACGGCCACAGGA (SEQ ID No. 4) with a target molecular weight of 7163.93Da. The method comprises the following steps:

1. primer synthesis

Using a packed 200nmol BHQ1 CPG synthesis column, the activator was an acetonitrile solution containing 0.25M 5-Ethylthiotetrazole (ETT), the deprotection reagent was a 3% trichloroacetic acid (TCA) in dichloromethane, the capping reagent was 10% acetic anhydride/acetonitrile and N-methylimidazole/pyridine/acetonitrile (ratio 14:10:76), the oxidation reagent was tetrahydrofuran/pyridine/water (ratio 70:20:10) containing 0.05M iodine, and the synthesis reaction was performed on a dr.oligo 48 synthesizer.

2. Ammonolysis

(3) The threaded pipe is placed in a water bath kettle with the temperature of 65 ℃ for heating for 2 hours, and after the reaction is finished, the threaded pipe is placed in a refrigerator with the temperature of minus 20 ℃ for cooling for 10 minutes.

A TIC spectrogram of a 5-end FAM modified 3-end BHQ1 modified probe crude product with the length of 20 bases is shown in figure 5, the retention time of the probe crude product is 4.52 minutes, the molecular weight is 7163.1, the peak area occupation ratio is 79.81%, namely the purity of the probe crude product is 79.81%, and the ammonolysis solution and the ammonolysis method prove that the 5-end FAM modified 3-end BHQ1 modified probe has a good ammonolysis effect.

Example 6

In this example, a probe modified with 3-terminal BHQ1 modified with 23-base 5-terminal VIC was subjected to ammonolysis reaction, and the sequence was: AGCCCTGTTAGGGCCGCCTCTGG (SEQ ID No. 5) with a target molecular weight of 8305.31Da. The method comprises the following steps:

1. primer synthesis

Using a packed 200nmol BHQ1 CPG synthesis column, the activator was an acetonitrile solution containing 0.25M 5-Ethylthiotetrazole (ETT), the deprotection reagent was a 3% trichloroacetic acid (TCA) in dichloromethane, the capping reagent was 10% acetic anhydride/acetonitrile and N-methylimidazole/pyridine/acetonitrile (volume ratio 14:10:76), the oxidation reagent was tetrahydrofuran/pyridine/water (volume ratio 70:20:10) containing 0.05M iodine, and the synthesis reaction was performed on a dr.oligo 48 synthesizer.

2. Ammonolysis

(1) Mixing tert-butylamine, methanol and ammonia water to obtain an ammonolysis solution, wherein the ammonolysis solution comprises tert-butylamine: methanol: ammonia = 2.5:2.5:5 (v/v/v).

The TIC spectrogram of the crude product of the 5-end VIC modified 3-end BHQ1 modified probe with the length of 23 bases is shown in figure 6, the retention time of the crude product of the probe is 4.54 minutes, the molecular weight is 8305.7, the peak area ratio of the crude product of the probe is 80.07 percent, namely the purity of the crude product of the probe is 80.07 percent, and the ammonolysis solution and the ammonolysis method prove that the ammonolysis solution and the ammonolysis method have better ammonolysis effect on the 5-end VIC modified 3-end BHQ1 modified probe.

Example 7

In this example, a 10-base-long 5-terminal HEX-modified 3-terminal BHQ 1-modified probe was subjected to an ammonolysis reaction, and the sequence was: TTTTTTTTTT (SEQ ID No. 3) with a target molecular weight of 4278.66Da.

The process parameters of the ammonolysis method are the same as in example 5.

The TIC spectrum of the crude product of the 5-end HEX modified 3-end BHQ1 modified probe with the length of 10 bases is shown in figure 7, the retention time of the crude product of the probe is 5.73 minutes, the molecular weight of the crude product of the probe is 4279.1, the peak area ratio of the crude product of the probe is 89.01%, namely the purity of the crude product of the probe is 89.01%, the retention time of the ACR derivative is 5.64 minutes, the molecular weight of the ACR derivative is 4278.7, the peak area ratio of the ACR derivative (molecular weight 4278.7) is only 3.85%, and the ammonolysis solution and the ammonolysis method prove that the ammonolysis solution and the ammonolysis method have better ammonolysis effect on the probe modified by the 3-end HEX modified probe with the length of 10 bases.

Example 8

In this example, a probe modified with 3-terminal BHQ2 modified with 23-base 5-terminal amino group was subjected to ammonolysis reaction, and the sequence was: AGCCCTGTTAGGGCCGCCTCTGG (SEQ ID No. 5) with a target molecular weight of 7768.15Da.

The process parameters of the ammonolysis method are the same as those of example 5

A TIC spectrogram of a crude product of the 5-end amino modified 3-end BHQ2 modified probe with the length of 23 bases is shown in figure 8, the retention time of the crude product of the probe is 3.21 minutes, the molecular weight is 7769.9, the peak area occupation ratio is 74.61%, namely the purity of the crude product of the probe is 74.61%, and the ammonolysis solution and the ammonolysis method prove that the 5-end amino modified 3-end BHQ2 modified probe has better ammonolysis effect.

Comparative example 1

In this example, an ammonolysis reaction was performed on a probe modified with 10 bases in length by 5-terminal HEX modified with 3-terminal MGB, and the sequence is: TTTTTTTTTT (SEQ ID No. 3) with a target molecular weight of 4844.71Da. The method comprises the following steps:

1. primer synthesis

2. Ammonolysis

(1) The CPG carrier with the target probe bound thereto was taken out from the synthesis column and placed in a threaded tube, to which 600. Mu.L of ammonia water (ratio of ammonolysis solution to carrier 3. Mu.L: 1 nmol) was added and the threaded tube cap was screwed.

(2) The threaded pipe is placed in a water bath kettle with the temperature of 65 ℃ for heating for 4 hours, and after the reaction is finished, the threaded pipe is placed in a refrigerator with the temperature of minus 20 ℃ for cooling for 10 minutes.

(3) The ammonolysis solution in the threaded tube was aspirated and added to the column and centrifuged at 13000rpm for 3 minutes.

(4) The filtrate from the centrifugation was transferred to a new threaded tube and placed in a 65 ℃ vacuum centrifugal dryer and concentrated by centrifugation at 13000rpm for 30 minutes.

(5) The concentrated liquid containing the target probe was collected and then analyzed by LC-MS.

A TIC spectrum of a crude probe modified by 5-end HEX modified 3-end MGB with a length of 10 bases is shown in FIG. 9, the retention time of the crude probe is 6.23 minutes, the molecular weight of the crude probe is 4844.6, the peak area ratio of the crude probe is 42.00%, namely the purity of the crude probe is 42.00%, the retention time of an ACR derivative is 6.16 minutes, the molecular weight of the crude probe is 4843.5, and the peak area ratio of the crude probe is 28.42%. Compared with comparative example 1, the purity of the crude probe product in example 3 is 71.37%, and no ACR derivative is found, which proves that the novel ammonolysis solution can inhibit the generation of ACR derivative and has better ammonolysis effect on the probe modified by 3-end MGB modified by 5-end HEX.

Comparative example 2

1. primer synthesis

2. Ammonolysis

(1) CPG carrier with target probe bound was taken out from the synthesis column and placed in a threaded tube, to which 210. Mu.LAMA ammonolysis solution (ammonia/methylamine aqueous solution=1:1) (carrier to ammonolysis solution ratio 1nmol: 1.05. Mu.L) was added, and the threaded cap was screwed.

(2) The threaded pipe is placed in a water bath kettle with the temperature of 65 ℃ for heating for 30 minutes, and after the reaction is finished, the threaded pipe is placed in a refrigerator with the temperature of minus 20 ℃ for cooling for 10 minutes.

As shown in FIG. 10, the TIC spectrum of the crude 5-end HEX-modified 3-end MGB-modified probe product with the length of 10 bases has a retention time of 5.50 minutes, a molecular weight of 4844.8, a peak area ratio of 68.90%, namely, the purity of the crude probe product is 68.90%, a retention time of spirolactone 13Da larger than the target molecular weight of 6.00 minutes, a molecular weight of 4857.8, a peak area ratio of 17.44% as compared with comparative example 2, the purity of the crude probe product in example 3 is 71.37%, no spirolactone 13Da larger than the target molecular weight is found, and it is proved that the novel ammonolysis solution can inhibit the production of spirolactone 13Da larger than the target molecular weight and has a better ammonolysis effect on the 5-end HEX-modified 3-end MGB-modified probe.

Comparative example 3

In this example, a 10-base-long 5-terminal HEX-modified 3-terminal BHQ 1-modified probe was subjected to an ammonolysis reaction, and the sequence was: TTTTTTTTTT (SEQ ID No. 3) with a target molecular weight of 4278.66Da. The method comprises the following steps:

1. primer synthesis

2. Ammonolysis

(1) The CPG carrier with the probe attached thereto was taken out of the synthesis column and placed in a threaded tube, to which 600. Mu.L of ammonia water (ammonia water to carrier ratio: 3. Mu.L: 1 nmol) was added and the threaded cap was screwed.

(2) The threaded pipe is placed in a water bath kettle with the temperature of 65 ℃ for heating for 2 hours, and after the reaction is finished, the threaded pipe is placed in a refrigerator with the temperature of minus 20 ℃ for cooling for 10 minutes.

(3) The ammonolysis solution in the threaded tube is sucked out and added into a centrifugal column, and the mixture is centrifuged at 13000rpm for 3 minutes

The TIC spectrum of the crude probe product modified by 5-end HEX modified 3-end BHQ1 with the length of 10 bases is shown in FIG. 11, the retention time of the crude probe product is 5.73 min, the molecular weight of the crude probe product is 4278.8, the peak area ratio of the crude probe product is 69.59%, namely the purity of the crude probe product is 69.59%, the retention time of the ACR derivative is 5.64 min, the molecular weight of the crude probe product is 4277.8, and the peak area ratio of the crude probe product is 23.41%. Compared with comparative example 3, the purity of the crude product of the probe in example 7 is 89.01%, and meanwhile, the peak area ratio of the ACR derivative is only 3.85%, which proves that the novel ammonolysis solution can inhibit the generation of the ACR derivative and has better ammonolysis effect on the probe modified by 3-end BHQ1 modified by 5-end HEX.

Comparative example 4

1. primer synthesis

2. Ammonolysis

(1) CPG carrier with target probe bound thereto was taken out from the synthesis column and placed in a threaded tube, to which 210. Mu.LAMA ammonolysis solution (ammonia/methylamine aqueous solution=1:1) (AMA ammonolysis solution to carrier ratio: 1.05. Mu.L: 1 nmol) was added, and the threaded cap was screwed.

(3) The ammonolysis solution in the threaded tube was sucked out and added to the centrifuge column, and centrifuged at 13000rpm for 3min.

(4) The filtrate from the centrifugation was transferred to a new threaded tube and placed in a 65 ℃ vacuum centrifugal dryer and concentrated by centrifugation at 13000rpm for 30min.

A TIC spectrum of a crude 5-terminal HEX-modified 3-terminal BHQ 1-modified probe of 10 bases in length is shown in FIG. 12, the retention time of the crude probe is 5.29 minutes, the molecular weight is 4278.7, the peak area ratio thereof is 67.32%, namely the purity of the crude probe is 67.32%, the retention time of spirolactone of 13Da larger than the target molecular weight is 5.73 minutes, the molecular weight is 4291.9, and the peak area ratio thereof is 16.59%. Compared with comparative example 4, the purity of the crude product of the probe in example 7 is 89.01%, and no spirolactone with the molecular weight being 13Da larger than the target molecular weight is found, which proves that the novel ammonolysis solution can inhibit the generation of spirolactone with the molecular weight being 13Da larger than the target molecular weight, and has better ammonolysis effect on the probe modified by 3-end BHQ1 modified by 5-end HEX.

The purity of the crude primers of examples 1 to 8 and comparative examples 1 to 4 is shown in Table 1.

TABLE 1

As can be seen from the combination of the probe purities of examples 1-8 in the above table, the ammonolysis solution and ammonolysis method provided by the invention can be applied to ammonolysis of most probes. Compared with comparative example 1 and comparative example 2, the novel ammonolysis solution can be found to inhibit HEX from generating spirolactone and ACR derivative with the molecular weight of 13Da larger than the target molecular weight, and meanwhile, the crude product of the 5-end HEX modified 3-end MGB modified probe obtained by ammonolysis has higher purity. Compared with comparative example 3 and comparative example 4, the novel ammonolysis solution can be found to inhibit HEX from generating spirolactone and ACR derivative with the molecular weight of 13Da larger than the target molecular weight, and meanwhile, the crude product of the 5-end HEX modified 3-end BHQ1 modified probe obtained by ammonolysis has higher purity.

The applicant declares that the above is only a specific embodiment of the present invention, but the scope of the present invention is not limited thereto, and it should be apparent to those skilled in the art that any changes or substitutions that are easily conceivable within the technical scope of the present invention disclosed by the present invention fall within the scope of the present invention and the disclosure.

Claims

1. An ammonolysis solution, comprising: tert-butylamine, methanol and aqueous ammonia.

2. The ammonolysis solution according to claim 1, wherein the volume ratio of tert-butylamine, methanol and ammonia water in the ammonolysis solution is (1-2.5): 5-8.

3. A method of preparing the ammonolysis liquid of claim 1 or 2, comprising: and mixing tert-butylamine, methanol and ammonia water to prepare the ammonolysis liquid.

4. Use of the ammonolysis solution of claim 1 or 2 in DNA solid-phase synthesis.

5. A method of ammonolysis of a probe, comprising the steps of:

(1) Mixing the solid phase carrier combined with the target probe with the ammonolysis liquid according to claim 1 or 2, heating for reaction, and cooling after the heating reaction is completed;

6. The method according to claim 5, wherein in the step (1), the solid phase carrier is mixed with the ammonolysis solution in a ratio of 1nmol (1 to 3. Mu.L).

7. The method for ammonolysis of a probe according to claim 5 or 6, wherein in step (1), the temperature of the heating reaction is 60 to 70 ℃;

preferably, in step (1), the heating reaction is carried out for a period of 2 to 4 hours.

8. The method according to any one of claims 5 to 7, wherein in the step (1), the cooling temperature is-20 to-10 ℃;

preferably, in step (1), the cooling time is 10-15 minutes.

9. The method of ammonolysis of a probe according to any one of claims 5 to 8, wherein in step (2), the rotational speed of the centrifugation is 11000 to 13000rpm;

preferably, in step (2), the centrifugation time is 2-5 minutes.

10. The method of ammonolysis of a probe according to any one of claims 5 to 9, characterized in that in step (2), the rotational speed of the heated centrifugal concentration is 11000 to 13000rpm;

preferably, in the step (2), the time of heating, centrifuging and concentrating is 25-35 minutes;

preferably, in the step (2), the temperature of the heated centrifugal concentration is 60-70 ℃.