CN117327703B

CN117327703B - Agrin-shRNA of targeted smooth muscle cells and application of Agrin-shRNA in preparation of anti-atherosclerosis drugs

Info

Publication number: CN117327703B
Application number: CN202311564406.8A
Authority: CN
Inventors: 郭梦琪
Original assignee: Affiliated Hospital of University of Qingdao
Current assignee: Affiliated Hospital of University of Qingdao
Priority date: 2023-11-22
Filing date: 2023-11-22
Publication date: 2024-04-23
Anticipated expiration: 2043-11-22
Also published as: CN117327703A

Abstract

The invention discloses Agrin-shRNA of targeted smooth muscle cells and application thereof in preparation of anti-atherosclerosis drugs, and belongs to the field of biological medicines. The Agrin-shRNA includes a sense strand and an antisense strand; the nucleotide sequence of the sense strand is shown as SEQ ID NO. 1; the nucleotide sequence of the antisense strand is shown as SEQ ID NO. 3. The invention prepares the adeno-associated virus loaded with Agrin-shRNA, and can obviously relieve atherosclerosis by intravenous injection of Agrin-shRNA adeno-associated virus in the tail of a mouse, thereby providing a theoretical basis for preparing or screening a drug or preparation for inhibiting Agrin gene expression of smooth muscle cells as an alternative drug or preparation for resisting atherosclerosis; and has important significance for treating atherosclerosis.

Description

Agrin-shRNA of targeted smooth muscle cells and application of Agrin-shRNA in preparation of anti-atherosclerosis drugs

Technical Field

The invention relates to the field of biological medicine, in particular to Agrin-shRNA of targeted smooth muscle cells and application thereof in preparation of anti-atherosclerosis medicines.

Background

Atherosclerosis (AS) is a chronic inflammatory disease of the arterial wall. The data published in 2019 of the world health organization show that cardiovascular diseases such AS ischemic heart disease (ISCHEMIC HEART DISEASE, IHD) and cerebral apoplexy caused by AS are still the largest healthy killers worldwide, the first cause of death worldwide in the past 15 years, and the estimated cause of death accounts for 26% of all diseases in 2030. The pathogenesis of AS is not completely clear at present, and further elucidating the pathogenesis of AS and finding effective intervention is a major topic in the current cardiovascular disease field that needs to be solved.

Phenotypic transformation of Vascular Smooth Muscle Cells (VSMCs) is an important pathological process for the development and progression of AS plaques. VSMCs in normal vascular tissue are in a contracted phenotype (differentiated state), expressing a range of contractile proteins, maintaining arterial wall structure and regulating vascular tone. VSMCs can be transformed from a contractile phenotype to a synthetic phenotype (dedifferentiated state) under pathological stimuli such as inflammatory factors and oxidatively modified lipoproteins. Notch1/Hes1 pathway activation inhibits transcription and expression of a range of contractile proteins in VSMCs, resulting in reduced contractile performance of VSMCs, while enhanced secretion, migration and osteogenic performance are involved in the formation of fibrous caps of atheromatous plaques and potentially necrotic cores.

The aggregate protein (Agrin) is a heparan sulfate proteoglycan with a molecular weight of about 400kDa and consists of three domains, a carboxyl fragment, an amino fragment and an intermediate region, respectively. As an extracellular matrix (Extracellular matrix, ECM) protein, agrin is expressed in tissues such as neuromuscular junction, myocardium, kidney, blood vessel, etc. Studies have reported that Agrin in the mouse heart binds to the cardiomyocyte receptor myodystrophy proteoglycan (α -dystroglycan, DAG), activating the Hippo-Yap pathway to promote cardiomyocyte proliferation. The research shows that Agrin has higher content in cardiac ECM of the mice just born, and the expression is obviously down-regulated in 7 days, so that the regeneration and repair capacity of myocardial cells is weakened, and the exogenous injection Agrin in an adult mouse myocardial infarction model can promote the proliferation and angiogenesis of myocardial cells. Furthermore Agrin plays a key role in regulating angiogenesis in the tumor microenvironment. Agrin stabilize endothelial cell vascular endothelial growth factor receptor 2 (VEGFR 2) by interacting with its receptor complex, including lipoprotein-related receptor 4 (Lrp 4) and integrin β1, while activating cell adhesion kinase (FAK). Stabilization of VEGFR2 further activates endothelial cell nitric oxide synthase (eNOS) -Akt-ERK1/2 (extracellular signal-regulated kinase 1/2) signaling pathways, thereby continuously promoting vascular sprouting and angiogenesis in tumor tissue. Taken together, these findings indicate that Agrin has important functions in the cardiovascular system. However, the relationship and mechanism of Agrin to atherosclerosis is not yet understood.

Disclosure of Invention

The invention aims to provide Agrin-shRNA targeting smooth muscle cells and application thereof in preparation of anti-atherosclerosis drugs, so as to solve the problems in the prior art. The Agrin-shRNA provided by the invention can effectively silence Agrin genes in smooth muscle cells, so that atherosclerosis is relieved.

In order to achieve the above object, the present invention provides the following solutions:

The invention provides Agrin-shRNA of targeted smooth muscle cells, wherein the Agrin-shRNA comprises a sense strand and an antisense strand; the nucleotide sequence of the sense strand is shown as SEQ ID NO. 1; the nucleotide sequence of the antisense strand is shown as SEQ ID NO. 2.

The invention also provides a vector comprising the Agrin-shRNA.

Further, the vector comprises an adeno-associated viral vector.

The invention also provides a host comprising the vector.

Further, the host includes an adeno-associated virus.

The invention also provides application of Agrin-shRNA, the vector or the host in preparation and/or screening of anti-atherosclerosis drugs.

Furthermore, the Agrin-shRNA reduces the expression quantity of Notch-1 and Hes-1 proteins by inhibiting the expression of Agrin genes in smooth muscle cells, so that atherosclerosis is relieved.

Further, the target sequence of Agrin-shRNA is shown as SEQ ID NO. 3.

Further, the atherosclerosis is caused by a high fat diet.

Further, the drug includes a nucleic acid molecule, a lipid, a small molecule compound, an antibody, a polypeptide, a protein, or an adeno-associated virus.

The invention discloses the following technical effects:

The invention synthesizes shRNA capable of silencing Agrin gene in smooth muscle cells based on mouse Agrin gene, and prepares adeno-associated virus (AAV-Agrin-shRNA) taking Agrin gene silencing as an action target through slow virus packaging. The atherosclerosis model is constructed by continuously feeding ApoE-/-mice for 12 weeks with high fat, and the mice injected with adeno-associated virus can obviously relieve atherosclerosis, so that theoretical basis is provided for preparing or screening medicines or preparations for inhibiting smooth muscle cell Agrin gene expression as candidate medicines or preparations for resisting atherosclerosis.

According to analysis of the experimental results of the invention, agrin gene silencing can be used as an action target to prepare or screen anti-atherosclerosis drugs. The drug screening is mainly aimed at unknown drugs, the drugs act on target genes, and the drugs are screened to obtain anti-atherosclerosis drugs according to whether the drugs can inhibit the expression of the target genes; the preparation of the medicine is mainly based on target genes, and the anti-atherosclerosis medicine is prepared or constructed in a targeted way to inhibit the expression of the target genes, so that the medicine has important significance for treating atherosclerosis.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a map of an adeno-associated viral vector;

FIG. 2 is a graph showing aortic root atheromatous plaque burden in Control (Control) and experimental (AAV-agrin-shRNA) mice;

FIG. 3 shows the expression of Agrin, notch-1 and Hes1 proteins in mice of a Control group (Control) and an experimental group (AAV-Agrin-shRNA) for Western blot verification.

Detailed Description

Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples of the present invention are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.

EXAMPLE 1 packaging of mouse Agrin-shRNA adeno-associated Virus

1. Adeno-associated virus recombinant vector construction

1. Primer design

The Agrin-shRNA sequence of Agrin genes is designed and synthesized.

Agrin-shRNA sequence is as follows:

Sense strand:

AGCGAGCTCAGATGCTTCCACCTATATAGTGAAGCCACAGATGTATATAGGTGGAAGCATCTGAGCC(SEQ ID NO.1)；

Antisense strand:

GGCAGGCTCAGATGCTTCCACCTATATACATCTGTGGCTTCACTATATAGGTGGAAGCATCTGAGCT(SEQ ID NO.2)；

The target sequences of shRNA recognition are as follows:

5’-GCTCAGATGCTTCCACCTATA-3’(SEQ ID NO.3)

2. enzyme cutting of carrier

Adeno-associated virus vector pAV-Sm22a-GFP-miR30-shRNA plasmid (purchased from Shandong Uygur autonomous Biotechnology Co., ltd., plasmid map shown in FIG. 1) was digested with the digestion system shown in Table 1, and the vector was recovered.

TABLE 1 enzyme digestion system

Reaction liquid component	Volume of
		Plasmid (1. Mu.g/. Mu.L)	1μL
10×Buffer	5μL
		BpiI enzyme	1μL
Double distilled water	42μL
		Total volume of	50μL

And (3) adding the sample, mixing uniformly, placing the mixture in a 37 ℃ for enzyme digestion for 2 hours, removing the phosphorylation of the carrier for 20 minutes, detecting enzyme digestion by using 1% agarose gel electrophoresis after the reaction is finished, and recycling the carrier by using a gel recycling kit.

3. Annealing

The primers were diluted to a mother liquor of 100. Mu.M. The annealing reaction system is shown in Table 2.

TABLE 2 annealing reaction System

Reaction liquid component	Volume of
		Sense strand	1μL
Antisense strand	1μL
		Buffer	2μL
Double distilled water	15.5μL
		PNK enzyme	0.5
Total volume of	20μL

The annealing procedure is shown in table 3.

TABLE 3 annealing reaction procedure

Step (a)	Temperature/. Degree.C	Time of
			1	37	30min
2	98	3min
			3	98ramp25	0.1℃/s
4	25	20min

4. Connection

The annealed product was diluted 100-fold and ligated with the digested vector with the ligation system shown in Table 4:

Table 4 connection system

Composition of the components	Volume of
		Diluted annealed product	2μL
Enzyme cutting carrier	1μL
		10×T4 Buffer	0.5μL
T4 DNA ligase (10U/. Mu.L)	0.5μL
		Double distilled water	1μL
Total volume of	5μL

And (3) after mixing uniformly, carrying out instantaneous centrifugation, and connecting for 1h at 22 ℃ to obtain a connecting product.

5. Transformation

The ligation product transformed E.coli DH 5. Alpha. Competent cells were plated on LB plates with kanamycin resistance for selection.

The specific steps of the transformation are as follows:

taking out DH5 alpha competence prepared in advance from-80 ℃ and placing in ice bath;

After DH5 alpha competent cells are melted, taking 5 mu L of a connecting product into 20 mu L of DH5 alpha competent cells, fully and uniformly mixing, and standing in an ice bath for 15min;

Placing the centrifuge tube into a water bath kettle at 42 ℃ for 40s (the centrifuge tube is not required to be shaken during the period), then rapidly moving the centrifuge tube into an ice bath, and standing for 2min;

200. Mu.L of sterile LB medium (without antibiotics) was added to the centrifuge tube, mixed well and placed in a shaker at 37℃and 220rpm and shaken for 1h. The aim is to make the related resistance marker gene on the plasmid express and resuscitate the thalli;

plated onto a solid medium plate with kanamycin resistance;

the cells were incubated overnight at 37 ℃.

6. Sequencing

And picking single colony for culturing, extracting plasmids for enzyme digestion, identifying positive clones, and verifying sequencing, wherein the plasmids with correct verification are used for subsequent experiments after large extraction.

2. Packaging adeno-associated virus:

1. Cell resuscitation

1) 10ML of fresh DMEM medium was added to a 10cm diameter petri dish and the incubator was preheated to 37 ℃.

2) The freezing tube was removed from the liquid nitrogen and rapidly placed in a 37℃water bath for 2min to allow thawing.

3) After melting the solution in the freezer, it was centrifuged at 200 Xg for 5min, the liquid was discarded and 1mL of the preheated medium was aspirated to gently blow up the cell pellet, which was transferred to a10 cm diameter petri dish.

4) Shaking uniformly, and culturing in an incubator.

5) Cultured overnight, fresh medium was changed (removal of toxic effects of DMSO on cells in the frozen stock).

2. Cell passage (taking a culture dish with a diameter of 10cm as an example)

1) And the biological safety cabinet is sterilized by ultraviolet rays for 0.5h.

2) During sterilization, DMEM medium (10% fbs,1% green streptomycin mixed solution) and PBS were placed in a 37 ℃ water bath for preheating; 0.25% pancreatin was left at room temperature and was not heatable in water bath.

3) HEK293T cells with a confluency close to 100% and good activity were collected, medium in the culture dish was aspirated off, 5mL of 1 XPBS was added, and the PBS was aspirated off by shaking a few times.

4) 1ML of 0.25% pancreatin was added and digested in a biosafety cabinet for about 1min, and the mixture was allowed to stand in an incubator at low room temperature. The digestion time is not excessively long, otherwise, the cell re-adherence efficiency and activity are affected.

5) About 5mL of the pre-warmed medium was added to terminate digestion.

6) The pipette is used for blowing evenly (the unavailable force in the blowing process is excessive, otherwise, cells are blown and aimed), and the cells are passaged according to the proportion of 1:3. 2mL of each culture medium was placed in a new 10cm diameter dish, and 8mL of preheated DMEM medium was added.

Note that when the number of passage plates is large, the preheated DMEM medium is added to a culture dish having a diameter of 10cm before the cell-containing medium is added to avoid uneven cell distribution. The culture medium in the dish was gently mixed before placing in the incubator to uniformly disperse the cells in the culture medium.

AAV viral packaging (for example, a culture dish 10cm in diameter)

The first day: HEK293T cells with confluence above 90% were grown according to 1:3 ratio plates (approximately 2.5X10 ⁶ per plate) were prepared on Hydone high sugar DMEM medium (10% FBS, available from Hydone).

The following day: 2h before transfection, the medium was changed to serum-free medium.

Transfection reagents were formulated in the proportions shown in table 4:

TABLE 5 transfection reagent formulation System

After Mix1 and Mix2 were prepared, they were left to stand at room temperature for 10min, mix1 and Mix2 were mixed, left to stand at room temperature for 20min, and added dropwise to a culture dish having a diameter of 10 cm.

Third day: after 24h of plasmid transfection, new serum-free medium was exchanged.

Fifth day: transfecting for 72h for virus collection, collecting the toxigenic cells together with the culture medium into a 50mL centrifuge tube, centrifuging, and respectively harvesting the culture medium supernatant and cell sediment, wherein the viruses in the PEG8000 sediment culture medium supernatant; lysing the cell pellet and detoxifying; AAV obtained from cell pellet and supernatant were pooled.

AAV Virus purification and concentration

4.1 Purification-Density gradient centrifugation of iodixanol

① Preparing iodixanol with different concentrations;

② Taking a super-separation tube, and slowly adding iodixanol with different concentrations layer by using an electric pipette;

③ Adding the treated virus liquid to the uppermost layer;

④ Overspeed after trimming, 18 ℃, 48000rpm, and centrifugation for 2.5h.

4.2 Concentration

① After centrifugation, puncturing the bottom of the ultrafiltration tube by a needle head, and collecting the layer of adeno-associated virus into a 15mL tube;

② Injecting the collected virus liquid into a concentration column, adding PBS+0.001% PF68 (poloxamer 188) until the virus liquid is full, and uniformly mixing;

③ 4000rpm,10 ℃, and centrifuging for 1h;

④ Repeatedly blowing the liquid left in the ultrafiltration tube, sucking the liquid into a virus storage tube, and finally adding the virus storage liquid;

⑤ The collected viruses are vortex-vibrated, uniformly mixed and centrifuged, and 10 mu L of virus liquid is absorbed for titer detection.

5. Virus titer detection method

The real-time quantitative PCR method is a simple method for measuring the quantity of adeno-associated virus particles in a purified virus sample in high yield. The Ct value of each template has a linear relation with the logarithm of the initial copy number of the template, a standard curve can be made by using a standard substance with known initial copy number, and finally, the unknown template is quantitatively analyzed through the standard curve.

5.1 Removal of free DNA molecules

The virus was diluted 10-fold to ensure adequate degradation of free DNA in the sample: mu.L of virus was taken into 45 mu LPBS buffer and mixed well. Mix was formulated as per Table 5 system:

TABLE 6Mixture preparation System

Incubation was carried out at 37℃for 30min and heating at 95℃for 5min to inactivate DNase.

5.2 Removal of viral protein coat

1. Mu.L of proteinase K (5. Mu.g/. Mu.L) was added to the above-mentioned system and incubated at 37℃for 30min; then, 30. Mu.L of ultrapure water was added to dilute to 40. Mu.L (100-fold dilution of the virus stock was performed), proteinase K was inactivated by heating at 95℃for 5min, and then centrifuged at 12000rpm for 2min, and the supernatant was subjected to qPCR detection.

5.3qPCR

The supernatant obtained in 5.2 was subjected to 10-fold gradient dilution with 5. Mu.L, i.e., 1000-fold dilution of the virus stock. And respectively taking 2 mu L of sample to be detected and standard substances as templates for qPCR detection.

QPCR reaction system: 2 XSYBR Green mix 10. Mu.L, primers-F0.8. Mu.L, primers-R7.2. Mu.L, DNA 2. Mu.L, total 20. Mu.L. Primers-F is shown as SEQ ID NO. 1; primers-R is shown as SEQ ID NO. 2.

QPCR reaction procedure: pre-denaturation at 95℃for 3min, 5s at 95℃for 15s at 60℃for 15s at 72℃for 39 cycles.

Example 2 effect of Agrin Gene adeno-associated Virus on atherosclerosis

ApoE-/-mice (purchased from Beijing velarihua laboratory animal technologies Co., ltd.) were divided into two groups of 6 mice each, treated at 10 weeks of age, and the adeno-associated virus AAV-Agrin-shRNA obtained in example 1 and a control AAV empty vector (AAV-GFP) were injected tail vein respectively, and the two groups of mice and the treatment were as follows:

Experimental group: apoE-/-mice, tail vein injected AAV-Agrin-shRNA;

Control group: apoE-/-mice, tail vein injection of AAV-GFP.

After continuous 12-week high-fat feeding, the mice are euthanized, the aortic root sections of the mice are taken, the aortic root atheromatous plaque load condition of the mice is shown in figure 2, the mice in the control group generate severe aortic root atheromatous phenomenon, and the mice in the test group can obviously relieve the aortic root atheromatous disease after intravenous injection of adeno-associated virus AAV-Agrin-shRNA into the tail of the mice in the test group.

Taking the mouse aorta, respectively stripping off the outer membrane of the aorta, adding protein lysate to grind the sample, respectively taking 40 mu g of protein to sample for Western blot verification, respectively detecting the expression conditions of Agrin, notch-1 and Hes1 proteins by using Agrin, notch-1 and Hes1 antibodies, and finding that the mouse tail intravenous injection of adeno-associated virus AAV-Agrin-shRNA can inhibit Agrin protein expression and reduce the expression quantity of Notch-1 and Hes-1 proteins, thereby relieving atherosclerosis of the root of the aorta, as shown in a result of figure 3.

The above results prove that Agrin genes play a key role in regulating Notch-1/Hes-1 pathway, the atherosclerosis plaque of the aortic root of a control group mouse is obvious in progress, the expression level of Agrin genes is increased, and the atherosclerosis of the aortic root of the mouse can be relieved by treating the mice by intravenous injection of Agrin-shRNA adeno-associated virus into the tail of an apoE-/-mouse.

The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.

Claims

1. Use of Agrin-shRNA targeting smooth muscle cells or a vector comprising said Agrin-shRNA for the preparation of an anti-atherosclerosis medicament, wherein said Agrin-shRNA comprises a sense strand and an antisense strand; the nucleotide sequence of the sense strand is shown as SEQ ID NO. 1; the nucleotide sequence of the antisense strand is shown as SEQ ID NO. 2.

2. The use according to claim 1, wherein Agrin-shRNA reduces the expression of Notch-1 and Hes-1 proteins by inhibiting the expression of Agrin gene in smooth muscle cells, thereby alleviating atherosclerosis.

3. The use according to claim 2, wherein the target sequence of Agrin-shRNA is shown as SEQ ID No. 3.

4. The use according to claim 1, wherein the atherosclerosis is caused by a high fat diet.