CN117286274A - Dual real-time fluorescent PCR kit for identifying filamentous mycoplasma subspecies and mycoplasma bovis and special oligonucleotide combination thereof - Google Patents

Dual real-time fluorescent PCR kit for identifying filamentous mycoplasma subspecies and mycoplasma bovis and special oligonucleotide combination thereof Download PDF

Info

Publication number
CN117286274A
CN117286274A CN202311491950.4A CN202311491950A CN117286274A CN 117286274 A CN117286274 A CN 117286274A CN 202311491950 A CN202311491950 A CN 202311491950A CN 117286274 A CN117286274 A CN 117286274A
Authority
CN
China
Prior art keywords
mycoplasma
seq
bovis
subspecies
quality control
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202311491950.4A
Other languages
Chinese (zh)
Inventor
郑敏
闭璟珊
赵仲毅
辛佳亮
吴健皓
赵子欣
韦正吉
韦芳
钟华训
林斌
苏姣秀
张步娴
甘海霞
邹联斌
苏凯
吕思明
覃婉婷
韦慧琦
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangxi Zhuang Autonomous Region Animal Disease Prevention And Control Center Guangxi Zhuang Autonomous Region Slaughtering Technology Center
Original Assignee
Guangxi Zhuang Autonomous Region Animal Disease Prevention And Control Center Guangxi Zhuang Autonomous Region Slaughtering Technology Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangxi Zhuang Autonomous Region Animal Disease Prevention And Control Center Guangxi Zhuang Autonomous Region Slaughtering Technology Center filed Critical Guangxi Zhuang Autonomous Region Animal Disease Prevention And Control Center Guangxi Zhuang Autonomous Region Slaughtering Technology Center
Priority to CN202311491950.4A priority Critical patent/CN117286274A/en
Publication of CN117286274A publication Critical patent/CN117286274A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/35—Mycoplasma

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a dual real-time fluorescent PCR kit for identifying filamentous mycoplasma subspecies and mycoplasma bovis and a special oligonucleotide combination thereof, belonging to veterinary animal pathogen detection in the technical field of biological detection. The special primer and the probe in the kit provided by the invention are respectively optimized and designed aiming at the SC type of the mycoplasma filiformis subspecies and the specific conserved sequence of the mycoplasma bovis, so that the kit not only can be used for double detection of the mycoplasma filiformis subspecies and the mycoplasma bovis with high sensitivity, but also has strong specificity and good repeatability, and the amplified sequence fragments of the two can be used as positive quality control products for judging whether a sample to be detected is polluted or not after being slightly modified, thereby improving the accuracy of detection results, and being capable of playing a role in the fields of epidemic epidemiology investigation, epidemic disease monitoring purification and the like.

Description

Dual real-time fluorescent PCR kit for identifying filamentous mycoplasma subspecies and mycoplasma bovis and special oligonucleotide combination thereof
Technical Field
The invention belongs to veterinary animal pathogen detection in the technical field of biological detection, and particularly relates to a dual real-time fluorescent PCR kit for identifying filamentous mycoplasma subspecies and mycoplasma bovis and a special oligonucleotide combination (comprising a primer, a probe and optional positive quality control) thereof.
Background
Mycoplasma filiform subspecies (Mycoplasma mycoides subsp. Mycoides SC, mmmSC) and Mycoplasma bovis (M.bovis) are members of the genus Mycoplasma of the family Mycoplasma.
Mmsc can cause a serious contagious disease, i.e., contagious bovine pleuropneumonia (also known as "bovine plague"). The pathogen can infect cattle of various ages, sexes and breeds. Both diseased and carrier (chronic infectious stage) cattle are the primary sources of infection for mmsc and, as cattle recovering from both acute and chronic stages often exhibit subclinical symptoms or become long-term carriers, this makes control and elimination of contagious pleuropneumonia very difficult.
M bovis can cause pneumonia, mastitis, arthritis, genital tract inflammation, keratoconjunctivitis in cattle, and even abortion and infertility in cattle. Currently, M bovis is an important pathogenic pathogen that jeopardizes calf health, has higher infection rate and mortality rate, and even though the calf can endure, most of the follow-up development retardation occurs, and the yield and quality are seriously affected. In addition, M bovis can cause secondary infection of other pathogens, and brings great loss to cattle raising industry in China.
Therefore, close attention and effective identification of the infection of mmsc and M bovis in cattle are particularly important for the development of cattle raising in China.
Since mmsc and m.bovis both have strong pathogenicity and similar clinical symptoms and pathological changes to cattle, which makes it difficult to distinguish between the two infections, the help of related detection methods or kits is necessary. For example Liu Yang et al (Liu Yang et al, establishment of a Mycoplasma bovis double PCR detection method)National preventive veterinary science report, volume 32, 8 th 2010, hereinafter literature) established a dual PCR assay method for identifying M.bovis and MmmSC, the sensitivity test results of which showed that the minimum concentrations of cultures of M.bovis and MmmSC were 10, respectively 6 cfu/mL and 10 5 cfu/mL. Li Dawei et al (Li Dawei et al, mycoplasma bovis, mycoplasma fumagma and Mycoplasma filiform subspecies) were established and initially applied, animal husbandry and veterinary school, 2011,42 (2): 306-310, hereinafter literature 2) established a triple PCR diagnostic method capable of distinguishing Mycoplasma bovis, mycoplasma filiform subspecies and Mycoplasma fumagma at one time, wherein the detection minimum limits of Mycoplasma bovis and Mycoplasma filiform subspecies are 0.8 ng/. Mu.L and 0.5 ng/. Mu.L, respectively. However, the methods of the above-mentioned documents 1 and 2 are both multiplex common PCR methods, which have low detection sensitivity against Mycoplasma bovis and Mycoplasma filiform subspecies, and have low detection efficiency. In addition, in the use process of the existing detection kit, the positive quality control product in the kit often causes the condition that a sample is polluted due to various factors and cannot be distinguished, so that an error or unreliable detection result is often caused, and effective prevention and control measures are disturbed in time.
Disclosure of Invention
In response to one or more of the problems of the prior art, one aspect of the present invention provides an oligonucleotide combination for identifying a mycoplasma filiform subspecies and mycoplasma bovis comprising dual real-time fluorescent PCR primers and TaqMan probes for detecting mycoplasma filiform subspecies and mycoplasma bovis, wherein:
the PCR primer comprises: an upstream primer (mmsc-F) and a downstream primer (mmsc-R) for detecting a filamentous subspecies of mycoplasma, wherein the nucleotide sequence of the upstream primer (mmsc-F) is as set ID NO:1, the nucleotide sequence of the downstream primer (mmsc-R) is as set forth in SED ID NO:2 is shown in the figure; and an upstream primer (M.Bovis-F) and a downstream primer (M.Bovis-R) for detecting Mycoplasma bovis, wherein the nucleotide sequence of the upstream primer (M.Bovis-F) is as set forth in SED ID NO:3, the nucleotide sequence of the downstream primer (M.Bovis-R) is as set forth in SED ID NO:4 is shown in the figure;
the TaqMan probe comprises: taqMan probes (MmmSC-P) for detecting filamentous mycoplasma subspecies, their nucleotide sequences such as SED ID NO:5 is shown in the figure; and TaqMan probes (M.Bovis-P) for detecting Mycoplasma bovis, which have nucleotide sequences such as SED ID NO: shown at 6.
In some embodiments, the TaqMan probe is fluorescently labeled, with a fluorescent reporter group at the 5 'end and a fluorescence quenching group at the 3' end; alternatively, the fluorescent reporter group may be selected from: FAM, HEX, ROX, JOE, TET, cy3, cy5 and TAMRA, the fluorescence quenching groups may be selected from: BHQ1, BHQ2, BHQ3, dabcyl and QYS, but the emission spectra of the TaqMan probe (mmsc-P) and the TaqMan probe (m.bovis-P) labeled fluorescent reporter should be far apart to avoid interference.
In some embodiments, the oligonucleotide combination further comprises a cationic control;
wherein the positive quality control comprises two positive quality controls for mycoplasma filiform subspecies and mycoplasma bovis respectively, wherein the positive quality control for mycoplasma filiform subspecies comprises the amino acid sequence of SEQ ID NO:9, and the positive quality control product for mycoplasma bovis contains the nucleotide sequence shown in SEQ ID NO:10, a nucleotide sequence shown in seq id no; or alternatively
The positive quality control product is a positive quality control product aiming at the mycoplasma filiform subspecies and the mycoplasma bovis simultaneously, and contains the amino acid sequence shown in SEQ ID NO:9 and SEQ ID NO:10, a nucleotide sequence shown in seq id no;
preferably, the nucleotide sequence of the positive quality control is of the general formula: R1-R2-R3-R4-R5-R6-R7; wherein:
R1 is null, or as set forth in SEQ ID NO:11, any fragment of length 1-118 in the sequence shown in seq id no;
r2 is SEQ ID NO: 9;
r3 is null, or as set forth in SEQ ID NO:12, any fragment of length 1-58 in the sequence set forth in seq id no;
r4 is null or is selected from the group consisting of a cleavage site other than a BglII cleavage site and an EcoRI cleavage site;
r5 is null, or as set forth in SEQ ID NO:13, any fragment of length 1-24 in the sequence shown in seq id no;
r6 is SEQ ID NO:10, a sequence shown in seq id no;
r7 is null, or as set forth in SEQ ID NO:14 is any fragment of length 1-30.
In another aspect, the invention provides a positive quality control for identifying a mycoplasma filiform subspecies and mycoplasma bovis, comprising two positive quality controls for the mycoplasma filiform subspecies and mycoplasma bovis, respectively, wherein the positive quality control for the mycoplasma filiform subspecies comprises the amino acid sequence of SEQ ID NO:9, and the positive quality control product for mycoplasma bovis contains the nucleotide sequence shown in SEQ ID NO:10, a nucleotide sequence shown in seq id no;
optionally, the nucleotide sequence of the positive quality control against a mycoplasma filis subspecies has the general formula: R1-R2-R3 (I);
the nucleotide sequence general formula of the cationic quality control substance for mycoplasma bovis is as follows: R5-R6-R7 (II);
Or alternatively
The positive quality control product is a positive quality control product aiming at the mycoplasma filiform subspecies and the mycoplasma bovis simultaneously, and contains the amino acid sequence shown in SEQ ID NO:9 and SEQ ID NO:10, a nucleotide sequence shown in seq id no;
optionally, the nucleotide sequence of the positive quality control substance has a general formula: R1-R2-R3-R4-R5-R6-R7 (III);
wherein in the general formula (I), the general formula (III) and/or the general formula (III),
r1 is null, or as set forth in SEQ ID NO:11, any fragment of length 1-118 in the sequence shown in seq id no;
r2 is SEQ ID NO: 9;
r3 is null, or as set forth in SEQ ID NO:12, any fragment of length 1-58 in the sequence set forth in seq id no;
r4 is null or is selected from the group consisting of a cleavage site other than a BglII cleavage site and an EcoRI cleavage site;
r5 is null, or as set forth in SEQ ID NO:13, any fragment of length 1-24 in the sequence shown in seq id no;
r6 is SEQ ID NO:10, a sequence shown in seq id no;
r7 is null, or as set forth in SEQ ID NO:14 is any fragment of length 1-30.
The application of the oligonucleotide combination or the positive quality control product in preparing detection products for identifying the mycoplasma bovis subspecies and the mycoplasma filis also belongs to the content of the invention.
In yet another aspect, the invention provides a dual real-time fluorescent PCR kit for identifying a mycoplasma gallisepticum subspecies and mycoplasma bovis, comprising the oligonucleotide combination; preferably, the dual real-time fluorescent PCR kit further comprises the cationic control.
In yet another aspect, the present invention provides a method for identifying and detecting a non-disease diagnostic purpose of mycoplasma filiform subspecies and mycoplasma bovis, comprising the steps of:
s1: extracting genome DNA of a sample to be detected, and carrying out double real-time fluorescence PCR detection under the guidance of the oligonucleotide combination by taking the extracted genome DNA as a template;
s2: the specific amplification curve and Ct value are used to identify and detect the mycoplasma filiform subspecies and mycoplasma bovis.
In some embodiments, the system for performing dual real-time fluorescent PCR detection in step S1 comprises: 1-3. Mu.L of DNA template, 2 XPremix Ex Taq 8-12. Mu.L of real-time fluorescent PCR reaction solution, 0.5-1.0. Mu.L of each of the upstream primer (MmmSC-F) and the downstream primer (MmmSC-R), 0.5-1.0. Mu.L of each of the 10. Mu.mol/L TaqMan probe (MmmSC-P), 0.7-1.0. Mu.L of each of the 10. Mu.mol/L upstream primer (M.Bovis-F) and the 10. Mu.L of each of the downstream primer (M.Bovis-R), 0.8-1.0. Mu.L of each of the 10. Mu.mol/L TaqMan probe (M.Bovis-P), and ddH 2 O2-4. Mu.L; and/or
The PCR reaction conditions for performing the dual real-time fluorescent PCR detection in the step S1 are as follows: 95 ℃ for 30s; carrying out fluorescence signal detection at the end of annealing of each cycle for 40 cycles of 10s at 95 ℃ and 30s at 56 ℃; and/or
The principle of performing the identification detection in the step S2 is as follows:
if the sample to be detected only has a typical amplification curve in a signal channel marked by a TaqMan probe (MmmSC-P) and the Ct value is less than 40.0, judging that the result is positive for the filamentous mycoplasma subspecies nucleic acid;
if the sample to be detected only has a typical amplification curve in a signal channel marked by a TaqMan probe (M.Bovis-P) and the Ct value is less than 40.0, determining that the result is positive for mycoplasma bovis nucleic acid;
if the sample to be detected has typical amplification curves in signal channels marked by a TaqMan probe (MmmSC-P) and a TaqMan probe (M.Bovis-P), and Ct value is less than 40.0, judging that the result is positive for the mycoplasma filiform subspecies and the mycoplasma bovis nucleic acid;
if the sample to be detected has no Ct value or Ct value is more than or equal to 40 or no typical amplification curve, the result is judged to be negative for the mycoplasma filiform subspecies and the mycoplasma bovis nucleic acid.
In some embodiments, the method further comprises the steps of:
s3: performing gel recovery on qPCR products of nucleic acid determined to be positive by a fluorescence result, and performing enzyme digestion identification; wherein the enzyme digestion reaction system for the recovery product of the mycoplasma filis subspecies positive qPCR gel is as follows: 1-2. Mu.g of qPCR gel recovery product, 10U/. Mu.L of BglII of 0.2-1. Mu.L, 10 XH Buffer of 2. Mu.L, ddH 2 O makes up 20. Mu.L; the enzyme digestion reaction system for the mycoplasma bovis positive qPCR gel recovery product is as follows: qPCR gel recovery product 1-2. Mu.g, 15U/. Mu.L EcoRI 0.2-1. Mu.L 10 XHBuffer 2. Mu.L ddH 2 O makes up 20. Mu.L;
s4: judging whether the sample to be detected is polluted by the cationic quality control product according to the enzyme digestion identification result.
In some embodiments, the reaction conditions for performing the cleavage identification in step S3 are: the enzyme digestion reaction condition of the recovered product of the positive qPCR gel for the filamentous subspecies of the mycoplasma is 30+/-1 ℃ for 1-2h; the enzyme digestion reaction conditions of the recovered product of the mycoplasma bovis positive qPCR gel are 37+/-1 ℃ for 1-2h.
In some embodiments, the decision principle in step S4 is: if the enzyme digestion product of the positive qPCR gel recovery product of the filamentous mycoplasma subspecies appears 35bp and 64bp bands on agarose gel at the same time, judging that the sample to be detected is polluted by the positive quality control product; if the enzyme digestion product of the mycoplasma bovis positive qPCR gel recovery product has 63bp and 84bp bands on agarose gel at the same time, the sample to be detected is judged to be polluted by the positive quality control product.
The special primer and the probe for dual real-time fluorescence PCR for identifying the mycoplasma filiform subspecies and the mycoplasma bovis are respectively obtained by optimizing design aiming at the SC-type sequence of the mycoplasma filiform subspecies and the uvrC sequence of the mycoplasma bovis, and can be used for dual detection of the mycoplasma filiform subspecies and the mycoplasma bovis with high sensitivity, and have strong specificity and good repeatability, and an amplified product can be used as a positive quality control product for judging whether a sample to be detected is polluted or not through minor transformation, so that more accurate qualitative and quantitative detection is realized. Therefore, the kit comprising the primer, the probe and the optional positive quality control product can provide a powerful basis for investigation of main epidemic conditions of clinical pathogens, epidemic disease monitoring and purification and the like.
The invention has the following advantages:
(1) The sensitivity is high: the minimum detection limit of the method and the kit for MmmSC and M.Bovis nucleic acid can reach 11.495 copies/. Mu.L, and the sensitivity is 1000 times of that of the common PCR method; the specificity is good: corresponding fluorescent amplified signals were generated specifically for mmsc and m.bovis genomes. Proved by verification, the vaccine has no cross reaction to mycoplasma caprae seu ovis subspecies, mycoplasma ovis, bovine brucella A19 strain, clostridium perfringens, streptococcus suis type 2, infectious bovine rhinotracheitis virus, bovine viral diarrhea virus, bovine enterovirus, pungent virus and bovine Hunga virus related epidemic viruses.
(2) Fast high throughput: the detection speed is high, and the whole amplification detection process can be completed within 1.5 hours after the DNA nucleic acid of the sample to be detected is added. According to the different detection hole numbers of the fluorescent quantitative PCR instrument, the synchronous detection of 384 samples at most can be realized at one time.
(3) The operation is simple and convenient: the detection and the identification of 2 mycoplasma can be realized at the same time by one-time reaction, and the prepared TaqMan double fluorescence PCR reaction system is placed into a fluorescence quantitative PCR instrument, so that the whole amplification and the result judgment can be completed. Meanwhile, the nucleic acid fragment synthesized by artificial design is used as a cationic control product, is easy to obtain, is beneficial to biosafety, and can reduce pollution to test environment.
(4) Removing pollution of the positive quality control product: according to the positive quality control product provided by the invention, the sequences of the mycoplasma bovis subspecies and the mycoplasma bovis fragments are artificially modified, wherein a Bgl II enzyme cutting site exists in the modified mycoplasma bovis subspecies, and an EcoRI enzyme cutting site exists in the modified mycoplasma bovis fragment sequence, so that a qPCR product positive in fluorescence detection can be detected in an enzyme cutting identification mode, whether a sample to be detected is polluted by the positive quality control product or not can be determined, and the detection accuracy can be further improved.
Drawings
FIG. 1 is a sequence of SEQ ID NO:9 and SEQ ID NO: electrophoresis results of 10 positive plasmid, wherein lane 1 is 2000bp Marker; lane 2 shows SEQ ID NO:10 positive plasmid; lane 3 shows SEQ ID NO:9 positive plasmid.
FIGS. 2A and 2B are amplification curves of MmmSC and M.bovis in positive quality control of gradient concentration, respectively, for the dual fluorescence PCR method of the present invention, wherein 1: working standard 1;2: working standard 1;3: working standard 3;4: working standard 4;5: working standard 5;6: a working standard 6;7: a working standard 7;8: working standard 8;9: a working standard 9;10: a work standard 10;11: a working standard 11;12: h 2 O。
FIGS. 3A and 3B are electrophoretograms of the conventional PCR method for MmmSC and M.bovis, respectively, in positive quality control at gradient concentrations, wherein lane 1: working standard 1; lane 2: working standard 1; lane 3: working standard 3; lane 4: working standard 4; lane 5: working standard 5; lane 6: a working standard 6; lane 7: a working standard 7; lane 8: working standard 8; lane 9: a working standard 9; lane 10: a work standard 10; lane 11: a working standard 11; lane N: h 2 O。
FIGS. 4 and 5 are standard curves for MmmSC and M.bovis, respectively, for the dual fluorescence PCR method of the present invention, wherein 1: working standard 1;2: working standard 1;3: working standard 3;4: working standard 4;5: working standard 5;6: a working standard 6;7: a working standard 7;8: working standard 8;9: working standard.
FIG. 6 is a graph showing the results of a specificity test of the dual fluorescent PCR method of the present invention, wherein 1: mmsc;2: bovis;3: a mycoplasma caprine subspecies; 4: mycoplasma ovipneumoniae; 5: niu Xingbu the A19 strain of Russell; 6: clostridium perfringens; 7: streptococcus suis type 2; 8: infectious bovine rhinotracheitis virus; 9: bovine viral diarrhea virus; 10: bovine enterovirus; 11: a hooning virus; 12: bovine Hungarus; 13: h 2 O。
Detailed Description
In view of the defects of the prior art that the method and the kit for identifying and detecting mycoplasma filiform subspecies and mycoplasma bovis have lower detection sensitivity and lower detection efficiency, the invention is based on the fluorescent quantitative PCR technology of TaqMan probes, by taking the differential region of the SC type 454115 to 454389 gene sequences (CP 002107.1) of the mycoplasma bovis subspecies and the uvrC gene 825959 to 827674 sequences (CP 042939.1) of the mycoplasma bovis subspecies as molecular markers, the primers and the probes which can be used for identifying and detecting the SC type of the mycoplasma filiform subspecies and mycoplasma bovis with high sensitivity and high throughput are designed and obtained by screening, and the inventor discovers that the base T at the 64 th position in the amplified fragment sequences (SEQ ID NO: 7) of the mycoplasma filiform subspecies is mutated into the base A, so that a glII enzyme cutting site (AGT) which does not exist in the original sequence (SEQ ID NO: 9) can be generated in the modified sequence (SEQ ID NO: 9), the amplified fragment of the mycoplasma filiform subspecies and the amplified fragment sequences (SEQ ID NO: 10) of the mycoplasma bovis subspecies can be obtained respectively, and the amplified fragment (EcoRI) of the mycoplasma bovis subspecies can be obtained after the amplified by respectively introducing the modified nucleotide T at the 64 th position into the amplified fragment sequence (SEQ ID NO: 7). Therefore, when the nucleic acid fragment synthesized according to the modified sequence is used as a positive quality control product for identifying and detecting the mycoplasma gallisepticum subspecies and mycoplasma bovis, the method of enzyme digestion identification can be used for judging whether the sample to be detected is polluted by the positive quality control product, so that the accuracy and the reliability of identifying and detecting the mycoplasma gallisepticum subspecies and mycoplasma bovis can be improved.
The present invention will be described in detail with reference to specific embodiments and drawings.
The methods used in the examples below are conventional methods unless otherwise specified, and specific steps can be found in: molecular cloning guidelines (Molecular Cloning: ALaboratory Manual) Sambrook, j., russell, david w., molecular Cloning: A Laboratory Manual,3rd edition,2001,NY,Cold Spring Harbor).
The various biomaterials described in the examples were obtained by merely providing an experimental route for achieving the objectives of the specific disclosure and should not be construed as limiting the source of biomaterials of the present invention. In fact, the source of the biological material used is broad, and any biological material that is available without violating law and ethics may be used instead as suggested in the examples.
The primers and probes used were synthesized by the company Shanghai, inc. of Biotechnology.
Examples detailed embodiments and specific operation procedures are given on the premise of the technical scheme of the present invention, and examples are helpful for understanding the present invention, but should not be construed as limiting the present invention.
Example 1 design and determination of primers and TaqMan probes for differential Dual real-time fluorescence PCR for detection of Mycoplasma filiform subspecies and Mycoplasma bovis
According to the recommendations of the world animal health organization, the SC-type sequence of the filamentous subspecies of mycoplasma and the uvrC sequence of mycoplasma bovis are respectively retrieved from a nucleic acid database GenBank (http:// www.ncbi.nlm.nih.gov) of NCBI, a plurality of primer and TaqMan probe combinations are designed for double real-time fluorescence PCR detection of the filamentous subspecies of mycoplasma and mycoplasma bovis according to the design principles of the primer and the TaqMan probe, but the following primer and TaqMan probe combinations are finally determined by the sensitivity and specificity verification of the designed plurality of primer and TaqMan probe combinations in double real-time fluorescence PCR detection of the filamentous subspecies of mycoplasma sp and mycoplasma bovis (detailed in the following example 4) and considering the suitability of amplified products thereof in preparing a positive quality control (detailed in the following example 2) which can judge whether a sample to be tested is polluted or not.
Specific primers and TaqMan probes for the filamentous mycoplasma subspecies SC type:
the upstream primer MmmSC-F: ATCCCATATTTTAGAATAAGAGT (SEQ ID NO: 1)
The downstream primer MmmSC-R: CAAAATATGAACTAACAAAGATG (SEQ ID NO: 2)
Detection probe MmmSC-P: cy5-ACTAGATATGGGGTTTTCGTAATTTCT-BHQ3 (SEQ ID NO: 5)
Specific primers and TaqMan probes for mycoplasma bovis uvrC sequence:
The upstream primer M.Bovis-F: ATCGCTATGGAATATTAATCA (SEQ ID NO: 3)
Downstream primer m.bovis-R: GTTTAAAAGTTCTTCCTGTAC (SEQ ID NO: 4)
Detection probe m.bovis-P: FAM-ATTCCACTAGGTTTAAGTGTTGATG-BHQ1 (SEQ ID NO: 6).
Example 2: design of positive quality control product for identifying and detecting mycoplasma filiform subspecies and mycoplasma bovis
The sequence of the amplified fragment of the specific primer for the SC type of the filamentous subspecies mycoplasma as defined in example 1 is as follows:
atcccatattttagaataagagtactagatatggggttttcgtaatttcttaattatttattcTgatctaaaatatcatctttgttagttcatattttg(SEQ ID NO：7)；
the sequence of the amplified fragment of the specific primer for mycoplasma bovis determined in example 1 is as follows:
atcgctatggaatattaatcaacaaggttaatttaacaattccactaggtttaagtgttgatgaatcacttagagttttctttgaacaattctatga ggataaaatactgccagataatttaattgtacaggaagaacttttaaac(SEQ ID NO：8)。
by comparison of the above sequence SEQ ID NO:7 and SEQ ID NO:8, the inventors found that if SEQ ID NO:7, the 64 th base T is mutated into a base A, and the minor modification can introduce a BglII cleavage site (AGATCT) which does not exist in the original sequence into the modified sequence (shown in SEQ ID NO:9 below); and if in SEQ ID NO:8, and a base T is introduced after position 66, this minor modification can introduce an EcoRI cleavage site (GAATTC) into the modified sequence (as shown in SEQ ID NO:10 below) that is not present in the original sequence, and the modification does not affect the amplification of the modified sequence by the specific primer pair, SEQ ID NO:9 and SEQ ID NO:10 are shown in FIG. 1 as lane 3 and lane 2, respectively. The minor modification mode on the amplified fragment can reduce the workload of test workers on one hand, and can avoid local generation of a plurality of enzyme cutting sites in the sequence on the other hand (the inventor finds that the direct insertion of the enzyme cutting sites in the sequence can cause local generation of a plurality of enzyme cutting sites), so that the difficulty of connecting the test workers to other carriers can be reduced, and the selection range of the carriers can be widened.
atcccatattttagaataagagtactagatatggggttttcgtaatttcttaattatttattcAgatctaaaatatcatctttgttagttcatattttg(SEQ ID NO：9)；
atcgctatggaatattaatcaacaaggttaatttaacaattccactaggtttaagtgttgatgaatTcacttagagttttctttgaacaattctatg aggataaaatactgccagataatttaattgtacaggaagaacttttaaac(SEQ ID NO：10)；
For the engineered sequence SEQ ID NO:9, when BglII is used for enzyme digestion and identification, two fragments of 64bp and 35bp (the two fragments are 29bp apart and can be obviously distinguished on gel electrophoresis images) can be obtained, and then the sequence SEQ ID NO:9, identifying; for the engineered sequence SEQ ID NO:10, when the EcoRI is used for enzyme digestion and identification, two fragments of 63bp and 84bp (the two fragments are 21bp apart and can be obviously distinguished on gel electrophoresis images) can be obtained, and then the sequence SEQ ID NO: 10. Thus, the above sequence SEQ ID NO:9 and SEQ ID NO:10 as a positive quality control for the differential detection of mycoplasma filiform subspecies and mycoplasma bovis, and whether the positive quality control contaminates the sample to be tested can be judged by means of enzyme digestion identification (specific enzyme digestion identification methods are detailed in example 3 below).
Therefore, the invention provides a positive quality control product which can be used for identifying and detecting mycoplasma filiform subspecies and mycoplasma bovis, and can be used as a DNA template of a standard product, and can also be used for identifying and detecting whether a sample to be detected is polluted by the DNA template. The nucleotide sequence of the positive quality control provided by the invention can contain the sequence SEQ ID NO:9 and SEQ ID NO:10, which can be of the formula: R1-R2-R3-R4-R5-R6-R7; wherein: r1 may be empty, or as set forth in SEQ ID NO:11 (e.g., 1, 2, 3, 4, … …, 118) and R2 is any one of the fragments of SEQ ID NOs: 9, R3 may be null, or a sequence as set forth in SEQ ID NO:12 (e.g., 1, 2, 3, 4, … …, 58), R4 may be empty, or a cleavage site selected from the group consisting of a BglII cleavage site and an EcoRI cleavage site (e.g., salI cleavage site: GTCGAC, which can be cleaved into a positive control having a Mycoplasma filiform subspecies nucleic acid fragment alone (e.g., having a nucleotide sequence of the formula R1-R2-R3) and a positive control having a Mycoplasma bovis nucleic acid fragment alone (e.g., having a nucleotide sequence of the formula R5-R6-R7)), R5 may be empty, or as set forth in SEQ ID NO:13 (e.g., 1, 2, 3, 4, … …, 24) and R6 is any one of the fragments of SEQ ID NOs: 10, R7 may be null, or a sequence as set forth in SEQ ID NO:14 (e.g., 1, 2, 3, 4, … …, 30) in sequence length;
ctgattatgatgacagtggtcatattctaaatctttaatttttattagaagaacataaaatatattgagtttattgtaataagatattcttaaaaaattt tcttatttttaattttaa (SEQ ID NO: 11), which is derived from the Mycoplasma filiform subspecies SC sequence, is the sequence SEQ ID NO: 7;
attttttctttattaatgtattctataagattaaatcatattactagaacagaagtat (SEQ ID NO: 12), which is derived from the Mycoplasma filiform subspecies SC sequence, is the sequence SEQ ID NO: 7;
taatttttgctacagttttgttct (SEQ ID NO: 13), which is derived from the Mycoplasma bovis uvrC sequence, is the sequence SEQ ID NO:8, an upstream fragment of 8;
tttgatctaaacctatcaagtgaatataaa (SEQ ID NO: 14), which is derived from the Mycoplasma bovis uvrC sequence, is the sequence SEQ ID NO: 8.
Alternatively, for convenience of use of the cationic control (e.g., in conjunction with other plasmids), one cleavage site other than the BglII cleavage site and the EcoRI cleavage site may be added upstream of R1 and downstream of R7, respectively, and the two cleavage sites added may be different, e.g., one BamHI cleavage site may be added upstream of R1 and one HindIII cleavage site may be added downstream of R7.
In the following examples, as examples, the following SEQ ID NOs: 15 as a positive quality control synthesized by the division of bioengineering (Shanghai) Co., ltd:
GGATCCctgattatgatgacagtggtcatattctaaatctttaatttttattagaagaacataaaatatattgagtttattgtaataagatattcttaaaaaattttcttatttttaattttaaatcccatattttagaataagagtactagatatggggttttcgtaatttcttaattatttattcAgatctaaaatatcatctttgttagttcatattttgattttttctttattaatgtattctataagattaaatcatattactagaacagaagtatGTCGACtaatttttgctacagttttgttctatcgctatggaatattaatcaacaaggttaatttaacaattccactaggtttaagtgttgatgaatTcacttagagttttctttgaacaattctatgaggataaaatactgccagataatttaattgtacaggaagaacttttaaactttgatctaaacctatcaagtgaatataaaAAGCTT(SEQ ID NO：15)。
Example 3: method for identifying and detecting mycoplasma filiform subspecies and mycoplasma bovis
3.1, establishing a double real-time fluorescence PCR standard curve for identifying and detecting the filamentous subspecies of the mycoplasma and the mycoplasma bovis
(1) By gradient concentration (11.495X 10) 9 copies/μL～11.495×10 -1 copies/. Mu.L, positive quality control (in SEQ ID NO:15 as an example) as a standard DNA template, qPCR amplification was performed on DNA templates of different concentrations using the primers and probes determined in example 1, respectively, wherein a 20 μl PCR reaction system comprises: mmmSC-F and MmmSC-R primers with 2 XPremix Ex Taq of 10. Mu.L, 10. Mu. Mol/L0.7. Mu.L, 10. Mu. Mol/L MmmSC-P of 0.5. Mu.L, 10. Mu. Mol/L M.Bovis-F and M.Bovis-R primers each of 0.8. Mu.L, 10. Mu. Mol/L M.Bovis-P of 0.9. Mu.L, DNA template of 2. Mu.L, ddH 2 O makes up 20. Mu.L; the qPCR reaction conditions were: 95 ℃ for 30s;95℃for 10s and 56℃for 30s, 40 cycles total. At the end of each cycle annealing, cy5 and FAM signals were simultaneously collected and amplification curves for mycoplasma filis subspecies and mycoplasma bovis were obtained, respectively, as shown in fig. 2A and 2B.
(2) In standard DNA template copy number (10 respectively 9 -10 -1 cobies/. Mu.L) is plotted on the abscissa, the Ct value is measured on the ordinate, and a standard curve is drawn.
The results shown in FIG. 2A and FIG. 2B show that the lowest detection limit of the method for detecting the mycoplasma filis the working standard 10, namely the sensitivity is 11.495 copies/. Mu.L, and the working standard 1-9 is used for drawing a standard curve, and the result is shown in FIG. 4, wherein the linear equation of the standard curve is y= -3.419x+38.561, R 2 =0.999, amplification efficiency e= 96.091%; the lowest detection limit of the method for detecting mycoplasma bovis is working standard 10, the sensitivity is 11.495 copies/. Mu.L, standard curves are drawn by adopting working standard 1-9, the result is shown in figure 5, the linear equation of the standard curves is y= -3.404x+38.636, R is shown in figure 5 2 =1, amplification efficiency e= 96.701%. The standard curves can be used for carrying out dual real-time fluorescent quantitative PCR detection on the mycoplasma bovis subspecies and the mycoplasma filis respectively.
3.2 Dual real-time fluorescent quantitative PCR detection of Mycoplasma filiform subspecies and Mycoplasma bovis
(1) Extracting DNA nucleic acid of a sample to be detected according to the instruction of the kit by adopting TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0, and storing for later use.
(2) The extracted DNA nucleic acid of the sample to be tested is used as a template, with SEQ ID NO provided in example 2: 15 as a positive quality control, taking non-enzymatic water as a negative control, judging the mycoplasma filiform subspecies and mycoplasma bovis in the sample to be tested according to the double real-time fluorescence quantitative PCR detection results of the mycoplasma filiform subspecies and mycoplasma bovis, and quantifying the copy numbers of the mycoplasma filiform subspecies and mycoplasma bovis in the positive sample to be tested. Optionally, it is also possible to detect and determine whether the positive test sample is contaminated by the positive quality control.
The specific detection method comprises the following steps:
1) A double real-time fluorescent quantitative PCR assay was performed with the primers and probes determined in example 1, using DNA nucleic acid extracted from the sample to be tested as a template, and a 20. Mu.L PCR reaction system and PCR reaction procedure were as described in test 3.1 above. Fluorescence signal detection is performed at the end of each cycle of annealing.
2) Qualitative detection of the mycoplasma filiform subspecies and the mycoplasma bovis is realized by using the obtained Ct value or the change of fluorescent signals, and typical amplification curves appear in different fluorescent channels, so that the sample to be detected contains the mycoplasma filiform subspecies nucleic acid and/or mycoplasma bovis nucleic acid, and then the copy number of the mycoplasma filiform subspecies nucleic acid and/or mycoplasma bovis nucleic acid contained in the sample to be detected is obtained according to the Ct value and the standard curve in the test 3.1, so that quantitative detection is realized.
3) The specific judging method comprises the following steps:
if the sample to be detected only has a typical amplification curve in a Cy5 channel and the Ct value is less than 40.0, judging that the result is positive for the filamentous mycoplasma subspecies nucleic acid;
if the sample to be detected only has a typical amplification curve in the FAM channel and the Ct value is less than 40.0, the result is judged to be positive for mycoplasma bovis nucleic acid;
If the sample to be detected has typical amplification curves in the FAM channel and the Cy5 channel and the Ct value is less than 40.0, judging that the result is positive for the mycoplasma filiform subspecies and the mycoplasma bovis nucleic acid;
if the sample to be detected has no Ct value or Ct value is more than or equal to 40 or no typical amplification curve, the result is judged to be negative for the mycoplasma filiform subspecies and the mycoplasma bovis nucleic acid.
4) For the sample to be detected, which is judged to be positive in nucleic acid, whether the sample to be detected is polluted by the positive quality control product can be judged through the following steps, so that the mycoplasma bovis and/or the mycoplasma filiform subspecies contained in the positive sample to be detected can be identified and detected more accurately:
4.1 Performing gel recovery on qPCR products of nucleic acid determined to be positive by a fluorescence result, and performing enzyme digestion identification; wherein the enzyme digestion reaction system for the recovery product of the mycoplasma filis subspecies positive qPCR gel is as follows: 1-2. Mu.g of qPCR gel recovery product, 10U/. Mu.L of BglII of 0.2-1. Mu.L, 10 XH Buffer of 2. Mu.L, ddH 2 O makes up 20. Mu.L; the enzyme digestion reaction system for the mycoplasma bovis positive qPCR gel recovery product is as follows: qPCR gel recovery product 1-2. Mu.g, 15U/. Mu.L EcoRI 0.2-1. Mu.L 10 XHBuffer 2. Mu.L ddH 2 O makes up 20. Mu.L; the reaction conditions for enzyme digestion identification are as follows: the enzyme digestion reaction condition of the recovered product of the positive qPCR gel for the filamentous subspecies of the mycoplasma is 30+/-1 ℃ for 1-2h; the enzyme digestion reaction conditions of the recovered products of the mycoplasma bovis positive qPCR glue are 37+/-1 ℃ for 1-2h;
4.2 Judging whether the sample to be tested is polluted by the cationic quality control product according to the enzyme digestion identification result; the judgment principle is as follows: if the enzyme digestion product of the positive qPCR gel recovery product of the filamentous mycoplasma subspecies appears 35bp and 64bp bands on agarose gel at the same time, judging that the sample to be detected is polluted by the positive quality control product; if the enzyme digestion product of the mycoplasma bovis positive qPCR gel recovery product has 63bp and 84bp bands on agarose gel at the same time, the sample to be detected is judged to be polluted by the positive quality control product.
Example 4: specificity, sensitivity and repeatability tests of methods for identifying and detecting filamentous mycoplasma subspecies and mycoplasma bovis
4.1 specificity test
(1) Test materials: pathogen nucleic acid
Adopting TaKaRa MiniBEST Viral RNA/DNAExtraction Kit Ver.5.0 to extract DNA nucleic acid, goat pox virus nucleic acid, mycoplasma caprae seu ovis nucleic acid, mycoplasma ovis nucleic acid, bovine Brucella A19 strain nucleic acid, clostridium perfringens nucleic acid, streptococcus suis type 2 nucleic acid, bovine infectious rhinotracheitis virus nucleic acid, bovine viral diarrhea virus nucleic acid, bovine enterovirus nucleic acid, pungent virus nucleic acid and bovine Hunga virus nucleic acid from the SC type deactivation of the mycoplasma caprae seu ovis subspecies and the bovine mycoplasma positive disease material respectively;
(2) The specificity of the method was verified by performing double fluorescence qPCR amplification of the pathogen nucleic acid of (1) above, respectively, according to the method of test 3.2 in example 3.
As shown in FIG. 6, only the nucleic acid of the mycoplasma filiform subspecies SC type (curve 1 in FIG. 6) and the mycoplasma bovis (curve 2 in FIG. 6) are tested positive, and the detection results of the nucleic acid of other pathogens are judged negative, which indicates that the double fluorescence qPCR method established by the invention has good detection specificity for the mycoplasma filiform subspecies and the mycoplasma bovis.
4.2 sensitivity test
qPCR amplification was performed on positive quality control with gradient concentrations as described in experiment 3.1 above in example 3. In addition, a double common PCR method (wherein the primers used are MmmSC-F, mmmSC-R, M.Bovis-F and M.Bovis-R primers obtained in example 1) was also used for PCR detection of positive quality control products of gradient concentration in the test.
As shown in FIGS. 2A and 2B, the results of qPCR amplification detection of the mycoplasma filiform subspecies SC and mycoplasma bovis show that the minimum detection limit of the mycoplasma filiform subspecies by the method is the working standard 10, namely the sensitivity is 11.495 copies/. Mu.L, and the minimum detection limit of the mycoplasma bovis is the working standard 10, namely the sensitivity is 11.495 copies/. Mu.L. The results of common PCR amplification detection on the SC type of the mycoplasma filiformis subspecies and the mycoplasma bovis are shown in FIG. 3A and FIG. 3B, and the lowest detection limit of the mycoplasma filiformis subspecies detected by adopting the common PCR method is the working standard 7, namely the sensitivity is 11.495 multiplied by 10 3 The lowest detection limit of the copies/. Mu.L on mycoplasma bovis is working standard 7, namely the sensitivity is 11.495 multiplied by 10 3 COPies/. Mu.L. The result shows that the double fluorescence qPCR method for identifying and detecting the mycoplasma filiform subspecies and the mycoplasma bovis has higher detection sensitivity which is 1000 times of that of the common PCR method.
4.3 repeatability test
Performing three fluorescence PCR repeated detection on the working standard substances 2, 4 and 6 of the mycoplasma bovis subspecies and the mycoplasma filis respectively by using the method of the test 3.2 in the embodiment 3, and calculating the variation coefficient between batches; the detection was repeated three times in the same-time fluorescence PCR, and the intra-batch variation coefficient was calculated. The coefficient of variation of the repeated Ct values between and within the batch was calculated as CV% = (standard deviation SD/Mean) ×100%.
As a result, as shown in Table 1 below, it was found that the variation coefficient in batch of the Ct value detected for the Mycoplasma species nucleic acid at different concentrations was between 0.56% and 1.61%; the in-batch variation coefficient of Ct value of detection of mycoplasma bovis nucleic acid with different concentrations is 1.06% -1.77%, which indicates that the double fluorescence qPCR method established by the invention has good repeatability for detection of mycoplasma bovis subspecies and mycoplasma filis.
Table 1: results of repeated detection of Mycoplasma filiformis subspecies and Mycoplasma bovis between groups of samples
Example 5: dual fluorescence PCR detection kit for identifying mycoplasma filiform subspecies and mycoplasma bovis
The dual fluorescence PCR detection kit for identifying the mycoplasma filiform subspecies and the mycoplasma bovis provided by the embodiment comprises:
primers (MmmSC-F, mmmSC-R, M.Bovis-F and M.Bovis-R primers) and TaqMan probes (MmmSC-P, M.Bovis-P) determined in example 1 for the differential detection of Mycoplasma filiform subspecies and Mycoplasma bovis.
In order to facilitate and accurately detect, the PCR detection kit provided in this embodiment further includes the positive quality control product obtained in the foregoing embodiment 2, where the positive quality control product may be two positive quality control products respectively for a mycoplasma filiform subspecies and mycoplasma bovis, where the positive quality control product for the mycoplasma filiform subspecies contains the sequence of SEQ ID NO:9, and the positive quality control product for mycoplasma bovis contains the nucleotide sequence shown in SEQ ID NO:10, a nucleotide sequence shown in seq id no; the positive quality control product can also be a positive quality control product aiming at the mycoplasma bovis subspecies and the mycoplasma filis simultaneously, and the positive quality control product simultaneously contains SEQ ID NO:9 and SEQ ID NO:10, in particular as described in example 2 above.
For ease of detection, the standard curve obtained in example 3 and instructions for use are also included in the kit.
Example 6 use of Dual fluorescence PCR detection kit for discriminating filamentous Mycoplasma subspecies and Mycoplasma bovis
10 cow dung samples (numbered 1-10 respectively) provided by Guangxi Zhuang animal epidemic prevention control centers were tested by using the kit of example 5, and the test method was the same as that of test 3.2 in example 3 (wherein the positive quality control product used is SEQ ID NO: 15). The results of the test are shown in Table 2 below, wherein 4 samples positive for only Mycoplasma reeand subspecies of the filamentous species were obtained, 3 samples positive for only Mycoplasma bovis nucleic acid were obtained, 1 sample positive for both Mycoplasma reeand Mycoplasma bovis nucleic acid was obtained, and 2 samples negative for the nucleic acid were obtained. In addition, whether the positive sample of nucleic acid is contaminated with a positive control was also tested, and the specific test method was performed as in test 3.2 of example 3. The results of the test are shown in Table 2 below, where 2 samples (sample 2 and sample 8) were contaminated with a cationic control. The results of the embodiment show that the kit for carrying out double real-time fluorescence quantitative PCR detection on the mycoplasma filiform subspecies and the mycoplasma bovis provided by the invention can detect the mycoplasma filiform subspecies and the mycoplasma bovis in clinical samples, can judge whether the clinical samples are polluted by positive quality control substances, and can provide powerful basis for environmental monitoring, pathogen identification detection and the like.
Table 2:10 sample test results
Finally, it should be noted that: the foregoing description is only a preferred embodiment of the present invention, and the present invention is not limited thereto, but it is to be understood that modifications and equivalents of some of the technical features described in the foregoing embodiments may be made by those skilled in the art, although the present invention has been described in detail with reference to the foregoing embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims (10)

1. An oligonucleotide combination for identifying a mycoplasma filiform subspecies and mycoplasma bovis comprising dual real-time fluorescent PCR primers and TaqMan probes for detecting the mycoplasma filiform subspecies and mycoplasma bovis, wherein:
the PCR primer comprises: an upstream primer (mmsc-F) and a downstream primer (mmsc-R) for detecting a filamentous subspecies of mycoplasma, wherein the nucleotide sequence of the upstream primer (mmsc-F) is as set ID NO:1, the nucleotide sequence of the downstream primer (mmsc-R) is as set forth in SED ID NO:2 is shown in the figure; and an upstream primer (M.Bovis-F) and a downstream primer (M.Bovis-R) for detecting Mycoplasma bovis, wherein the nucleotide sequence of the upstream primer (M.Bovis-F) is as set forth in SED ID NO:3, the nucleotide sequence of the downstream primer (M.Bovis-R) is as set forth in SED ID NO:4 is shown in the figure;
The TaqMan probe comprises: taqMan probes (MmmSC-P) for detecting filamentous mycoplasma subspecies, their nucleotide sequences such as SED ID NO:5 is shown in the figure; and TaqMan probes (M.Bovis-P) for detecting Mycoplasma bovis, which have nucleotide sequences such as SED ID NO: shown at 6.
2. The oligonucleotide combination of claim 1, wherein the TaqMan probe is fluorescently labeled with a fluorescent reporter group at the 5 'end and a fluorescent quenching group at the 3' end.
3. The oligonucleotide combination of claim 1 or 2, further comprising a cationic control;
wherein the positive quality control comprises two positive quality controls for mycoplasma filiform subspecies and mycoplasma bovis respectively, wherein the positive quality control for mycoplasma filiform subspecies comprises the amino acid sequence of SEQ ID NO:9, and the positive quality control product for mycoplasma bovis contains the nucleotide sequence shown in SEQ ID NO:10, a nucleotide sequence shown in seq id no; or alternatively
The positive quality control product is a positive quality control product aiming at the mycoplasma filiform subspecies and the mycoplasma bovis simultaneously, and contains the amino acid sequence shown in SEQ ID NO:9 and SEQ ID NO:10, a nucleotide sequence shown in seq id no;
preferably, the nucleotide sequence of the positive quality control is of the general formula: R1-R2-R3-R4-R5-R6-R7; wherein:
R1 is null, or as set forth in SEQ ID NO:11, any fragment of length 1-118 in the sequence shown in seq id no;
r2 is SEQ ID NO: 9;
r3 is null, or as set forth in SEQ ID NO:12, any fragment of length 1-58 in the sequence set forth in seq id no;
r4 is null or is selected from the group consisting of a cleavage site other than a BglII cleavage site and an EcoRI cleavage site;
r5 is null, or as set forth in SEQ ID NO:13, any fragment of length 1-24 in the sequence shown in seq id no;
r6 is SEQ ID NO:10, a sequence shown in seq id no;
r7 is null, or as set forth in SEQ ID NO:14 is any fragment of length 1-30.
4. A positive quality control for identifying a mycoplasma filiform subspecies and mycoplasma bovis comprising two positive quality controls for the mycoplasma filiform subspecies and mycoplasma bovis, respectively, wherein the positive quality control for the mycoplasma filiform subspecies comprises the amino acid sequence of SEQ ID NO:9, and the positive quality control product for mycoplasma bovis contains the nucleotide sequence shown in SEQ ID NO:10, a nucleotide sequence shown in seq id no;
optionally, the nucleotide sequence of the positive quality control against a mycoplasma filis subspecies has the general formula: R1-R2-R3 (I);
the nucleotide sequence general formula of the cationic quality control substance for mycoplasma bovis is as follows: R5-R6-R7 (II);
Or alternatively
The positive quality control product is a positive quality control product aiming at the mycoplasma filiform subspecies and the mycoplasma bovis simultaneously, and contains the amino acid sequence shown in SEQ ID NO:9 and SEQ ID NO:10, a nucleotide sequence shown in seq id no;
optionally, the nucleotide sequence of the positive quality control substance has a general formula: R1-R2-R3-R4-R5-R6-R7 (III);
wherein in the general formula (I), the general formula (III) and/or the general formula (III),
r1 is null, or as set forth in SEQ ID NO:11, any fragment of length 1-118 in the sequence shown in seq id no;
r2 is SEQ ID NO: 9;
r3 is null, or as set forth in SEQ ID NO:12, any fragment of length 1-58 in the sequence set forth in seq id no;
r4 is null or is selected from the group consisting of a cleavage site other than a BglII cleavage site and an EcoRI cleavage site;
r5 is null, or as set forth in SEQ ID NO:13, any fragment of length 1-24 in the sequence shown in seq id no;
r6 is SEQ ID NO:10, a sequence shown in seq id no;
r7 is null, or as set forth in SEQ ID NO:14 is any fragment of length 1-30.
5. Use of the oligonucleotide combination of any one of claims 1-3 or the positive quality control of claim 4 for the preparation of a detection article for identifying mycoplasma filis subspecies and mycoplasma bovis.
6. A dual real-time fluorescent PCR kit for identifying mycoplasma filis subspecies and mycoplasma bovis comprising the oligonucleotide combination of claim 1 or 2; preferably, the dual real-time fluorescent PCR kit further comprises the positive quality control of claim 4.
7. A method for identifying a non-disease diagnostic purpose for detecting mycoplasma filis subspecies and mycoplasma bovis comprising the steps of:
s1: extracting genome DNA of a sample to be detected, and carrying out double real-time fluorescence PCR detection under the guidance of the oligonucleotide combination of claim 1 or 2 by taking the extracted genome DNA as a template;
s2: the specific amplification curve and Ct value are used to identify and detect the mycoplasma filiform subspecies and mycoplasma bovis.
8. The method of claim 7, wherein the system for performing dual real-time fluorescent PCR detection in step S1 comprises: 1-3. Mu.L of DNA template, 2 XPremix Ex Taq 8-12. Mu.L of real-time fluorescent PCR reaction solution, 0.5-1.0. Mu.L of each of the upstream primer (MmmSC-F) and the downstream primer (MmmSC-R), 0.5-1.0. Mu.L of each of the 10. Mu.mol/L TaqMan probe (MmmSC-P), 0.7-1.0. Mu.L of each of the 10. Mu.mol/L upstream primer (M.Bovis-F) and the 10. Mu.L of each of the downstream primer (M.Bovis-R), 0.8-1.0. Mu.L of each of the 10. Mu.mol/L TaqMan probe (M.Bovis-P), and ddH 2 O2-4. Mu.L; and/or
The PCR reaction conditions for performing the dual real-time fluorescent PCR detection in the step S1 are as follows: 95 ℃ for 30s; carrying out fluorescence signal detection at the end of annealing of each cycle for 40 cycles of 10s at 95 ℃ and 30s at 56 ℃; and/or
The principle of performing the identification detection in the step S2 is as follows:
if the sample to be detected only has a typical amplification curve in a signal channel marked by a TaqMan probe (MmmSC-P) and the Ct value is less than 40.0, judging that the result is positive for the filamentous mycoplasma subspecies nucleic acid;
if the sample to be detected only has a typical amplification curve in a signal channel marked by a TaqMan probe (M.Bovis-P) and the Ct value is less than 40.0, determining that the result is positive for mycoplasma bovis nucleic acid;
if the sample to be detected has typical amplification curves in signal channels marked by a TaqMan probe (MmmSC-P) and a TaqMan probe (M.Bovis-P), and Ct value is less than 40.0, judging that the result is positive for the mycoplasma filiform subspecies and the mycoplasma bovis nucleic acid;
if the sample to be detected has no Ct value or Ct value is more than or equal to 40 or no typical amplification curve, the result is judged to be negative for the mycoplasma filiform subspecies and the mycoplasma bovis nucleic acid.
9. The method according to claim 7 or 8, further comprising the step of:
s3: performing gel recovery on qPCR products of nucleic acid determined to be positive by a fluorescence result, and performing enzyme digestion identification; wherein the enzyme digestion reaction system for the recovery product of the mycoplasma filis subspecies positive qPCR gel is as follows: qPCR gel recovery product 1-2. Mu.g, 10U/. Mu.L Bgl II is 0.2-1. Mu.L, 10 XH Buffer is 2. Mu.L, ddH 2 O makes up 20. Mu.L; the enzyme digestion reaction system for the mycoplasma bovis positive qPCR gel recovery product is as follows: qPCR gel recovery product 1-2. Mu.g, 15U/. Mu.L EcoRI 0.2-1. Mu.L 10 XHBuffer 2. Mu.L ddH 2 O makes up 20. Mu.L;
s4: judging whether the sample to be detected is polluted by the cationic quality control product according to the enzyme digestion identification result.
10. The method according to claim 9, wherein the reaction conditions for performing the cleavage assay in step S3 are: the enzyme digestion reaction condition of the recovered product of the positive qPCR gel for the filamentous subspecies of the mycoplasma is 30+/-1 ℃ for 1-2h; the enzyme digestion reaction conditions of the recovered products of the mycoplasma bovis positive qPCR glue are 37+/-1 ℃ for 1-2h; and/or
The decision principle in step S4 is: if the enzyme digestion product of the positive qPCR gel recovery product of the filamentous mycoplasma subspecies appears 35bp and 64bp bands on agarose gel at the same time, judging that the sample to be detected is polluted by the positive quality control product; if the enzyme digestion product of the mycoplasma bovis positive qPCR gel recovery product has 63bp and 84bp bands on agarose gel at the same time, the sample to be detected is judged to be polluted by the positive quality control product.
CN202311491950.4A 2023-11-10 2023-11-10 Dual real-time fluorescent PCR kit for identifying filamentous mycoplasma subspecies and mycoplasma bovis and special oligonucleotide combination thereof Pending CN117286274A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311491950.4A CN117286274A (en) 2023-11-10 2023-11-10 Dual real-time fluorescent PCR kit for identifying filamentous mycoplasma subspecies and mycoplasma bovis and special oligonucleotide combination thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311491950.4A CN117286274A (en) 2023-11-10 2023-11-10 Dual real-time fluorescent PCR kit for identifying filamentous mycoplasma subspecies and mycoplasma bovis and special oligonucleotide combination thereof

Publications (1)

Publication Number Publication Date
CN117286274A true CN117286274A (en) 2023-12-26

Family

ID=89248221

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311491950.4A Pending CN117286274A (en) 2023-11-10 2023-11-10 Dual real-time fluorescent PCR kit for identifying filamentous mycoplasma subspecies and mycoplasma bovis and special oligonucleotide combination thereof

Country Status (1)

Country Link
CN (1) CN117286274A (en)

Similar Documents

Publication Publication Date Title
EP4159875A1 (en) Novel coronavirus rapid detection kit based on thermal convection pcr
CN106048094B (en) Dual real-time fluorescent quantitative PCR (polymerase chain reaction) detection kit, primers and probe for porcine pseudorabies wild strains and gene-deleted strains
CN110846438A (en) Quadruple real-time fluorescent quantitative PCR (polymerase chain reaction) detection of canine adenovirus type II, canine distemper virus, canine parvovirus and canine parainfluenza virus
CN113718045B (en) DNA fragment, primer, probe and kit for detecting 4 kinds of Bordetella pertussis and specifically detecting Bordetella pertussis and application
CN105603123B (en) Real-time fluorescent RPA kit and test strip RPA kit for rapidly detecting porcine parvovirus and application thereof
CN116024208B (en) Kit capable of simultaneously detecting 26 pig epidemic diseases through single reaction
CN111471797B (en) RT-RPA primer pair, probe, kit and detection method for detecting cat coronavirus
CN113774168A (en) 2019 novel coronavirus, Deltay and lambda variant strain typing nucleic acid detection kit and detection method thereof
CN113462820A (en) Multiplex RT-PCR primer probe set for real-time fluorescent quantitative detection of four porcine diarrhea viruses, kit and detection method thereof
CN113151590A (en) Novel coronavirus 2019-nCoVORF1ab and N, E gene detection kit and preparation and detection methods thereof
CN113025734A (en) Primer and probe for identifying Brucella vaccine strain A19 and wild strain and application
CN113930547A (en) RT-RAA fluorescence method detection primer pair, kit and detection method for porcine epidemic diarrhea virus N gene
CN112538550A (en) RT-RPA and CRISPR/Cas-based DHAV-1 and DHAV-3 detection system and application
CN111518955A (en) HRM primer pair, kit and method for rapidly identifying feline enterocoronavirus and feline infectious peritonitis virus
CN110878381A (en) Primer composition, kit and method for detecting mycoplasma bovis and infectious bovine rhinotracheitis virus
CN116814859A (en) Primer probe composition, kit and method for identifying African swine fever virus genes I and II
CN105838826B (en) Double-color fluorescent PCR primer, probe and method for rapidly distinguishing canine parvovirus vaccine strain and wild strain
CN111876506A (en) Multiple fluorescent quantitative PCR primer, probe and kit for detecting toxigenic clostridium difficile
CN114634996B (en) Primer probe combination and kit for detecting bovine respiratory disease and application of primer probe combination and kit
Hammond et al. Differentiation of closely related but biologically distinct cherry isolates of Prunus necrotic ringspot virus by polymerase chain reaction
CN117286274A (en) Dual real-time fluorescent PCR kit for identifying filamentous mycoplasma subspecies and mycoplasma bovis and special oligonucleotide combination thereof
CN112899385A (en) Primer group and probe for identifying Brucella S2 vaccine strain and wild strain and application of primer group and probe
CN112501321A (en) Molecular typing method of mycobacterium tuberculosis
CN105002299B (en) Detect specific primer, probe and the kit of Echovirus30 viruses
CN116144836B (en) Quadruple fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection primer set for PRRSV (porcine reproductive and respiratory syndrome virus) and detection method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination