CN117286155A - Preparation and application of circular virus 3-type annular RNA molecule and vaccine - Google Patents

Abstract

The invention discloses a preparation and application of a circular virus 3-type annular RNA molecule and a vaccine; the vaccine comprises a circular RNA molecule encoding a ring virus 3 type Cap protein and a pharmaceutically acceptable carrier. Further, the coding element of the circular RNA encodes a Cap truncation plus mutein. Further, the coding elements encode an optimized nucleotide sequence for a Cap truncated plus mutein. Further, circular RNAs are constructed and prepared by optimized translation initiation elements, optimized intronic elements, and optimized insertion elements. Studies show that the injection of low-dose annular RNA vaccine (80 mug/dose) to the ring virus 3-positive pig group successfully induces the virus specific humoral immune response and cellular immune response, reduces the pathogenic infection rate from the initial 100% to 3%, and effectively realizes the virus elimination. The vaccine has good effectiveness, safety and stability, and provides a basis for the industrialized preparation and application of the circular virus 3 type RNA vaccine.

Description

Preparation and application of circular virus 3-type annular RNA molecule and vaccine

Technical Field

The invention belongs to the field of biotechnology, relates to preparation and application of a circular virus 3-type annular RNA molecule and a vaccine, and in particular relates to preparation of a circular virus 3-type Cap protein-encoding annular RNA molecule and a vaccine; comprising annular RNA, linear RNA, recombinant plasmid, recombinant escherichia coli engineering bacteria which code for a 3-type Cap truncated mutant protein sequence of the circovirus and a preparation method of the annular RNA vaccine.

Background

Porcine circovirus disease (porcine circovirus diseases, PCVD) is a multi-systemic disease caused by circovirus, mainly manifested by dysfunction of respiration, urinary, intestinal, lymphatic, cardiovascular, nervous, reproductive systems and skin, and can cause immunosuppression, thereby causing secondary or mixed infection, resulting in a great economic loss to the global pig industry. The circovirus belongs to a member of the genus circoviridae (circoviridae), which is one of the smallest viruses known to date to infect mammals. To date, 4 circovirus genotypes have been found and identified: circular virus type 1 (PCV 1), circular virus type 2 (PCV 2), circular virus type 3 (PCV 3) and circular virus type 4 (PCV 4). PCV3 was first reported in China in 2016, and then is widely popular in China, and has been reported in 27 provinces (markets) successively, so that the PCV3 has strong pathogenicity and high infection rate, and brings great difficulty to disease prevention and control.

PCV3 virus particles are in an icosahedral symmetrical structure, have no envelope, are single strand forward link-shaped DNA viruses, have a total length of 2000bp, and have two main open reading frames, namely ORF1 and ORF2.ORF1 mainly encodes a Rep protein consisting of 297 amino acids, involved in viral replication; ORF2 encodes mainly the Cap protein consisting of 214 amino acids, the major structural and immune-related proteins of PCV 3.

At present, no effective treatment method and commercialized vaccine for PCV 3-induced diseases exist. Although the commercial PCV2 vaccine plays an important role in the prevention and control of PCV2 viruses, the similarity of the amino acid sequences of Cap proteins of PCV3 and PCV2 is lower by only 30%, so that the commercial PCV2 vaccine is not reported to cross-protect PCV3. Based on the current trend in PCV3, there is an urgent need to develop effective vaccines.

RNA vaccine is to introduce RNA containing coded antigen protein directly into organism to make it translate directly in vivo to complete the expression of target protein, so as to induce specific immune reaction of organism and to play important role in preventing important respiratory tract infectious diseases. At present, RNA applied clinically or preclinically is mainly linear RNA, and compared with linear RNA, the circular RNA molecule has longer half-life, better stability and important application prospect in protein expression and clinical treatment. The most efficient technique for constructing circular RNAs in vitro is currently the self-cleaving loop system design technique (patent CN 114574483A). The preparation process for designing the circular RNA based on the self-shearing and ring-forming system is simpler and has lower process cost, and only ring forming treatment is carried out after transcription, so that expensive capping enzyme and tailing enzyme are not required to be used for carrying out additional modification of a 5 'cap structure and a 3' polyadenylation tail structure, and additional ring forming process which is common to the traditional circular RNA is not required to be carried out by using T4 RNA ligase. In addition, the introduction of additional exon sequences into the circular RNA can be avoided, and the sequence accuracy of the circular RNA molecule can be improved.

At present, the optimal design and application of the circular virus 3-type circular RNA molecule are not yet reported. At present, the research and development of the genetic engineering vaccine aiming at the circovirus type 3 mainly surround Cap, but the high-efficiency expression of Cap protein is an industrial difficulty: cap protein structures such as PCV3 contain abundant hydrophobic amino acids, and thus virus nanoparticles tend to aggregate, and are not uniform in structure; furthermore, the N-terminal 32 amino acid of PCV3 is rich in arginine as a nuclear localization signal, which increases the difficulty of Cap protein expression, and the full-length Cap protein of PCV3 can be expressed by optimizing codons (doi: 10.1186/s 13568-019-0940-0) or the truncated Cap protein of PCV3 can be expressed by removing the N-terminal nuclear localization signal (doi: 10.1186/s 13568-020-01163-8), but the proteins expressed in the above manner are liable to form inclusion bodies requiring an optimization process, and furthermore, whether the proteins correctly retain immunogenicity is unknown. On the other hand, virus neutralizing antibodies and cellular immune responses are critical for the immunoprotection of circovirus, and are positively correlated with viral clearance (doi: 10.1089/vim.2005.18.333), whereas RNA vaccine development and design often have been found to be ineffective in eliciting cellular immune responses (doi: 10.1016/j.vetmic.2020.108886). The problems to be solved in the design of circular virus 3-type circular RNA vaccines include: the design of the circular virus 3-type circular RNA molecule can efficiently express target proteins in pig somatic cells; the vaccine production process is efficient and can realize large-scale amplification; the vaccine can induce high-level humoral immune response and cellular immune response; the vaccine is safe and stable.

Disclosure of Invention

At present, no vaccine of PCV3 is clinically applied, and the invention provides a circular ring virus 3 type annular RNA molecule, and preparation and application of the vaccine. The circular RNA molecule contains an optimized coding element for coding the circovirus type 3 Cap protein and an optimized translation initiation element, solves the problems that the RNA molecule and vaccine designed by using the wild Cap protein have low antibody level, low cellular immune response level and can not effectively remove viruses, and the process is efficient and can realize large-scale amplification. The vaccine has good effectiveness, safety and stability, and provides a basis for the industrialized preparation and application of the circular RNA vaccine of the circular virus 3 type.

Solution for solving the problem:

< circular RNA >

The present invention provides a circular RNA comprising a coding element that encodes a polypeptide comprising a Cap protein of circovirus type 3. Further, in the case of a Cap wild-type protein, a Cap truncated protein, a Cap mutein, and a Cap truncated plus mutein, it is preferable that the coding element encodes the Cap truncated plus mutein. The circular RNA can be prepared by a traditional PIE system or by a clean PIE system.

In some embodiments, the coding element encodes an amino acid sequence of a Cap protein of circovirus type 3 comprising a sequence as set forth in SEQ ID No.3, or a sequence having at least 90% sequence identity to a sequence set forth in SEQ ID No.3 and having or partially having Cap protein activity.

In some embodiments, the coding element encodes a polypeptide comprising any one of: the circular virus 3-type Cap protein is truncated by 32 amino acids at the N end, 8 amino acids at the C end, 9 amino acids at the C end, W115P containing mutation, W115K containing mutation, Y176E containing mutation, Y176K containing mutation, R143P containing mutation, 8 amino acids at the N end of W115P/Y176E, C containing mutation/9 amino acids at the N end of W115P/Y176E, C containing mutation/W115P/Y176E containing mutation, and wild-type Cap protein.

As a preferred embodiment, the coding element comprises a C-terminally truncated 8 amino acids/comprises the mutation W115P/Y176E and has the amino acid sequence shown in SEQ ID NO. 10.

In some embodiments, the coding element encodes a nucleotide sequence that encodes a type 3 Cap protein of circovirus that comprises a sequence as set forth in SEQ ID No.4, or that has at least 90% sequence identity to a sequence set forth in SEQ ID No.4, and that encodes a polypeptide having or partially having activity of a type 3 Cap protein of circovirus.

In some embodiments, the coding element comprises a nucleotide sequence encoding any one of: the circular virus 3-type Cap protein is truncated by 32 amino acids at the N end, 8 amino acids at the C end, 9 amino acids at the C end, W115P containing mutation, W115K containing mutation, Y176E containing mutation, Y176K containing mutation, R143P containing mutation, 8 amino acids at the N end of W115P/Y176E, C containing mutation/9 amino acids at the N end of W115P/Y176E, C containing mutation/W115P/Y176E containing mutation, and wild-type Cap protein.

In some embodiments, the coding element comprises any one of: nucleotide sequence shown as SEQ ID NO.11, nucleotide sequence 1 shown as SEQ ID NO.12, nucleotide sequence 2 shown as SEQ ID NO.13, and nucleotide sequence 3 shown as SEQ ID NO. 14.

As a preferred embodiment, the coding element comprises the nucleotide sequence 1 (SEQ ID NO. 12) encoding 8 amino acids C-terminally truncated to the Cap protein of the circovirus type 3/comprising the mutation W115P/Y176E.

In some embodiments, the circular RNAs of the invention are prepared by a conventional PIE system, under conditions wherein the circular RNAs comprise elements in the order shown in (a) or (b):

(a) A first exon, a second exon, a 5 'spacer, a translation initiation element, a coding element, and a 3' spacer;

(b) A first exon, a second exon, a translation initiation element, and a coding element.

For the first exon, the second exon, the 5 'spacer, the 3' spacer, reference may be made to patent applications CN202011408937.4, CN202210200112.6 and CN202210200186.X, the entire contents of which are incorporated herein by reference.

In other embodiments, the circular RNAs of the invention are prepared by a clean PIE system, under conditions wherein the circular RNAs comprise elements in the order of arrangement shown in (c) or (d):

(c) A translation initiation element and a coding element;

(d) Translation initiation elements, coding elements, and insertion elements.

In some preferred embodiments, the circular RNA of the present invention is prepared by a clean PIE system, and comprises elements in the order of arrangement shown in (d) above. The clean PIE system for preparing circular RNAs can be found in patents CN202210200112.6, CN202210200186.X, the entire contents of which are incorporated herein by reference.

In some embodiments, the translation initiation element described herein may be any type of element capable of initiating translation of the coding element in the circular RNA.

In some embodiments, the translation initiation elements of the present invention include one or both of the followingSequences having translation initiation activity: IRES sequence, 5' UTR sequence, kozak sequence, m-containing ⁶ A modified (N (6) methyladenosine modified) sequence, a complement of ribosomal 18S rRNA.

In some preferred embodiments, the translation initiation element of the present invention comprises an IRES sequence. Exemplary IRES sequences include, but are not limited to, IRES sequences derived from Echovirus, human poliovirus, human Enterovirus, coxsackie virus, human rhinovirus, canine picornavirus, turdivirus 3, hepatovirus, passerivirus, picornaviridae, tremovirus A, feline kobuvirus, murine kobuvirus, kobuvirus sewage Kathmandu, ferset kobuvirus, marmot kobuvirus, human parechovirus, chicken picornavirus, falcon picornavirus, feline picornavirus, french Guiana picornavirus, and the like.

In some embodiments, the insertion elements described herein can be used to regulate transcription of recombinant nucleic acid molecules, to regulate translation of circular RNAs, to achieve specific expression of circular RNAs between different tissues, or to purify circular RNAs, and the like.

In some embodiments, the insertion elements of the present invention comprise one or more of the sequences shown below: an untranslated region sequence, a polyN sequence, an aptamer sequence, a ribosome switching sequence, and a sequence that binds a transcriptional regulator; wherein the polyN sequence, wherein N is selected from at least one of A, T, G, C.

In some preferred embodiments, the insertion elements of the present invention comprise a polyAC sequence; preferably, the polyAC sequence comprises the sequence a-polyAC as shown in SEQ ID No.5 and the sequence B-polyAC as shown in SEQ ID No. 25.

In some preferred embodiments, the circular RNA of the present invention has a nucleotide sequence as set forth in any one of SEQ ID NOS.8-9, SEQ ID NOS.15-18, SEQ ID NO.26, SEQ ID NO. 29.

In some more preferred embodiments, the circular RNA of the present invention has a nucleotide sequence as shown in SEQ ID NO.26 or SEQ ID NO. 29.

< Linear RNA >

The present invention provides a linear RNA which is cyclized to form the circular RNA after self-cleavage reaction. Correspondingly, the linear RNA is also called circularized precursor RNA.

In some embodiments, the linear RNAs of the invention are derived from a traditional PIE system, under conditions wherein the linear RNAs comprise elements in the order shown in (e) or (f):

(e) A 5 'homology arm, intron fragment II, a second exon, a 5' spacer, a translation initiation element, a coding element, a 3 'spacer, a first exon, intron fragment I, and a 3' homology arm;

(f) A 5 'homology arm, an intron fragment II, a second exon, a translation initiation element, a coding element, a first exon, an intron fragment I and a 3' homology arm.

The linear RNA molecule having the above structure can be subjected to self-cleavage cyclization in vitro by utilizing the ribozyme activity of the class I intron to obtain a circular RNA. Specifically, under the initiation of GTP, the junction of the 5' intron and the first exon is broken; the ribozyme cleavage of the first exon further attacks the junction of the 3 'intron and the second exon, causing cleavage at this point, dissociation of the 3' intron, and ligation of the first exon and the second exon to give a circular RNA.

In other embodiments, the linear RNAs of the invention are derived from a clean PIE system, under conditions wherein the linear RNAs comprise elements in the order of arrangement as shown in (g), (h) or (i):

(g) An intron fragment II, a translation initiation element truncation fragment II, a coding element, a translation initiation element truncation fragment I, an intron fragment I;

(h) An intron fragment II, a translation initiation element fragment II, a coding element, an insertion element, a translation initiation element fragment I, an intron fragment I;

(i) Intron fragment II, translation initiation element fragment II, coding element, polyAC, translation initiation element fragment I, intron fragment I.

When the linear RNA molecule with the structure is used for preparing the circular RNA, the connection position of the ribozyme recognition translation initiation element truncated fragment I (IRES fragment I) and the intron fragment I is firstly broken, so that the intron fragment I is released; then, cleavage of the cleavage site of the translation initiation element fragment II (IRES fragment II) from the intron fragment II is recognized by the ribozyme, and the intron fragment II is released. The 3 '-end of the translation initiation element fragment I is linked to the 5' -end of the translation initiation element fragment II to form a circular molecule.

In some preferred embodiments, the linear RNAs of the invention are derived from a clean PIE system, comprising elements in the order of arrangement shown in (i) above.

In some specific embodiments, the translation initiation element fragment II of the present invention comprises a sequence as set forth in any one of SEQ ID NO.19, SEQ ID NO.2, SEQ ID NO. 27. In some specific embodiments, the translation initiation element fragment I of the present invention comprises a sequence as set forth in any one of SEQ ID NO.20, SEQ ID NO.6, SEQ ID NO. 28. The nucleotide sequence of translation initiation element fragment I is ligated to the nucleotide sequence of translation initiation element fragment II to obtain the translation initiation element sequence.

In some preferred embodiments, the translation initiation element fragment II of the present invention is the sequence shown in SEQ ID NO. 27; the truncated fragment I of the translation initiation element is a sequence shown as SEQ ID NO. 28.

In some specific embodiments, the stop codon of the invention is as shown in (TAA) x (TAG) y (TGA) z, wherein x+y+z.gtoreq.1, x, y, z are each independently integers greater than or equal to 0, preferably the sequence is TGA.

In some specific embodiments, the polyacs of the present invention are the sequence A-polyacs shown as SEQ ID No.5 and the sequence B-polyacs shown as SEQ ID No. 25.

< recombinant nucleic acid molecule >

The present invention provides a recombinant nucleic acid molecule which, upon transcription, forms the above-described linear RNA.

In some embodiments, the recombinant nucleic acid molecules of the invention may comprise regulatory sequences in the recombinant nucleic acid molecules in addition to the elements contained in the linear RNAs described above. Illustratively, the regulatory sequence is a T7 promoter.

< recombinant E.coli engineering bacterium >

The invention provides a recombinant escherichia coli engineering bacterium, which is obtained by converting the recombinant nucleic acid molecule into E.coli.

< nucleic acid lipid nanoparticle composition >

The present invention provides a nucleic acid lipid nanoparticle composition comprising a lipid nanoparticle and the above-described circular RNA.

Through the entrapment of the annular RNA into the lipid nanoparticle, the uptake efficiency of the organism on the annular RNA can be improved, and meanwhile, the storage stability of the annular RNA is improved, thereby providing assistance for the development and application of the annular virus 3 type vaccine.

The invention provides a circular virus 3 type vaccine containing the circular RNA, wherein the circular virus 3 type vaccine contains a circular RNA molecule for encoding circular virus 3 type Cap truncated mutant protein and a pharmaceutically acceptable carrier.

As one embodiment of the invention, the amino acid sequence of the circular virus type 3 Cap truncated plus mutant protein is shown as SEQ ID No.10 or a degenerate sequence thereof.

As one embodiment of the invention, the optimized nucleotide sequence of the circular virus type 3 Cap truncated plus mutant protein is shown as SEQ ID No.12 or a degenerate sequence thereof.

As one embodiment of the invention, the circular RNA molecule comprises: the (SVDV-Cap-454) nucleotide sequence shown as SEQ ID No.26, and the (SVDV 2-Cap-454) nucleotide sequence shown as SEQ ID No. 29.

In some preferred embodiments, the circular RNA molecule is as shown in SEQ ID No. 29.

As one embodiment of the present invention, the circular RNA molecule encoding a Cap truncated mutein of a circovirus type 3 virus is formed by transcriptional cyclization of a vector DNA comprising the elements of the order of arrangement as set forth in any one of (1) to (2):

(1) An intron fragment II shown as SEQ ID NO.1, a translation initiation element fragment II shown as SEQ ID NO.27, a coding element shown as SEQ ID NO.12, a polyAC shown as SEQ ID NO.5, a translation initiation element fragment I shown as SEQ ID NO.28, and an intron fragment I shown as SEQ ID NO. 7;

(2) An intron fragment II shown as SEQ ID NO.23, a translation initiation element fragment II shown as SEQ ID NO.27, a coding element shown as SEQ ID NO.12, a polyAC shown as SEQ ID NO.25, a translation initiation element fragment I shown as SEQ ID NO.28, and an intron fragment I shown as SEQ ID NO. 24.

As a preferred embodiment, the linear RNA comprises the following elements: an intron fragment II shown as SEQ ID NO.23, a translation initiation element fragment II shown as SEQ ID NO.27, a coding element shown as SEQ ID NO.12, a polyAC shown as SEQ ID NO.25, a translation initiation element fragment I shown as SEQ ID NO.28, and an intron fragment I shown as SEQ ID NO. 24.

As one embodiment of the present invention, the amount of circular RNA molecule (SVDV 2-Cap-454) used in the circular virus type 3 vaccine is 30-200. Mu.g/vaccine. Including 30-60 mug/serving, 60-90 mug/serving, 90-120 mug/serving, 120-150 mug/serving, 150-180 mug/serving, 180-200 mug/serving; preferably 60-100. Mu.g/min.

As one embodiment of the invention, the pharmaceutically acceptable carrier comprises a lipid nanoparticle.

As one embodiment of the invention, the ratio of lipid nanoparticles to circular RNA molecules in the circular virus type 3 vaccine is 1:1-1:3 (V/V).

As an embodiment of the present invention, the raw material composition of the lipid nanoparticle comprises, in mole percent: 45% -55% of cationic lipid, 35% -44% of cholesterol, 3% -10% of neutral lipid and 0.8% -1.8% of PEG modified lipid.

As an embodiment of the invention, the cationic lipid is CMAX4 (butyl 4- [ (3- { [3- ({ 3- [ bis (3- {4- [ (2-butyloctanoyl) oxy ] butoxy } -3-oxopropyl) amino ] propyl } (meth) amino) propyl ] (3- {4- [ (2-butyloctanoyl) oxy ] butoxy } -3-oxopropyl) amino } propoxy) oxy ] butyl 2-octanoate) or SM-102 (1-octylnonyl 8- [ (2-hydroxyethyl) [6-O-6- (undecyloxy) hexyl ] amino ] -octanoate.

As an embodiment of the present invention, the cholesterol is 5-cholesten-3 beta-ol.

As an embodiment of the present invention, the neutral lipid is DSPC (distearoyl phosphatidylcholine) or DOPE (dioleoyl phosphatidylethanolamine).

As an embodiment of the present invention, the PEG-modified lipid is PEG-DMG (polyethylene glycol-dimyristate glyceride), PEG-DSG (distearoyl-rac-glycerol-polyethylene glycol), or PEG-DPG (diglycidylester).

As an embodiment of the present invention, the preparation method of the lipid nanoparticle comprises, in mole percent: 45% -55% of cationic lipid, 35% -44% of cholesterol, 3% -10% of neutral lipid and 0.8% -1.8% of PEG modified lipid are dissolved in ethanol.

As one embodiment of the present invention, the cationic lipid is CMAX4; the cholesterol is 5-cholesten-3 beta-ol; the neutral lipid is DSPC; the PEG modified lipid is PEG-DMG; CMAX 4:5-cholesten-3 beta-ol DSPC to PEG-DMG molar ratio is 45.7:42.5:9.2:1.5.

The invention also provides a preparation method of the circovirus type 3 vaccine, which comprises the following steps:

s1, synthesizing a ring virus 3-type Cap truncated mutant protein gene and a ring forming element, and cloning the ring virus 3-type Cap truncated mutant protein gene and the ring forming element into a recombinant vector to obtain the recombinant vector containing the ring virus 3-type Cap truncated mutant protein gene and the ring forming element;

s2, transforming or transducing the recombinant vector containing the ring virus 3-type Cap truncated mutant protein gene and the loop-forming element obtained in the step S1 into a host to obtain a recombinant containing the recombinant vector;

s3, culturing the recombinants obtained in the step S2, and preparing plasmids containing the ring virus 3 type Cap truncated mutant protein genes and the ring-forming elements;

S4, preparing a circular RNA for encoding the ring virus 3 type Cap truncated mutant protein by using the plasmid containing the ring virus 3 type Cap truncated mutant protein gene and the ring element obtained in the step S3;

s5, adding a pharmaceutically acceptable carrier into the annular RNA for encoding the Cap truncated mutant protein of the circovirus type 3 virus obtained in the step S4 to obtain the circovirus type 3 vaccine.

As one embodiment of the present invention, the loop-forming element of the present invention comprises intron fragments I and II, translation initiation element fragments I and II, and an insertion element.

< pharmaceutical use >

The invention provides application of the annular RNA, the linear RNA, the recombinant nucleic acid molecule, the recombinant escherichia coli engineering bacteria and/or the nucleic acid lipid nanoparticle composition (vaccine) in preparation of drugs for preventing and/or treating the type 3 circovirus.

The present invention provides a method for preventing and/or treating circovirus type 3, comprising administering to a subject an effective amount of the above-described circular RNA, linear RNA, recombinant nucleic acid molecule and/or nucleic acid lipid nanoparticle composition; preferably, administration is by injection.

Compared with the prior art, the invention has the following beneficial effects:

1) At present, no RNA vaccine for the circular virus 3 type virus is reported, and the invention adopts a circular RNA molecule for encoding the truncated mutant protein of the circular virus 3 type virus Cap, an optimized RNA preparation and an optimized vaccine preparation process to prepare the circular virus 3 type circular RNA vaccine, has the advantages of simple process, safety, effectiveness and the like, and provides a basis for the industrialized preparation and application of the vaccine.

2) Firstly, the invention provides a truncated mutant protein sequence (the amino acid sequence is shown as SEQ ID NO. 10) of a preferred circular virus type 3 Cap protein and a circular RNA molecule (the serial number CKV-Cap-293, the nucleotide sequence is shown as SEQ ID NO. 9) for encoding the protein, wherein the vaccine corresponding to the preferred RNA molecule successfully improves the circular virus type 3 specific antibody reaction in a mouse body.

3) Further, the invention provides a preferred nucleotide sequence (see SEQ ID NO. 12) and a circular RNA molecule (numbered CKV-Cap-454, nucleotide sequence see SEQ ID NO. 15) encoding the preferred nucleotide sequence, aiming at Cap truncated muteins, wherein the preferred RNA molecule successfully improves the expression quantity and the expression duration of target proteins in pig cells.

4) Further, the present invention provides a circular RNA molecule (numbered SVDV-Cap-454, nucleotide sequence shown in SEQ ID NO. 26) constructed with a preferred translation initiation element for the preferred nucleotide sequence of Cap truncated plus muteins (see SEQ ID NO. 12). For PCV3 pathogenic positive pig preliminary test, RNA molecules and vaccines designed by using wild Cap proteins are ineffective, while the preferred RNA molecules and vaccines provided by the research improve the antibody positive rate from 20% to 90% at the initial stage of infection, and increase the number of PCV3 specific IFN-gamma secretion cells in unit PBMC from 44 to 112, so that the cell immune response is obviously activated, and a foundation is provided for developing the circular virus 3 type RNA vaccine.

5) Further, the present invention provides a circular RNA molecule (numbered SVDV2-Cap-454, nucleotide sequence see SEQ ID NO. 29) prepared with a more preferred combination of elements (including preferred translation initiation elements, preferred intronic elements, preferred insertion elements) for the preferred nucleotide sequence of the Cap truncated mutein (see SEQ ID NO. 12). Compared with SVDV-Cap-454, the total yield of the annular RNA molecules corresponding to SVDV2-Cap-454 molecules is improved, and the expression quantity of target proteins in pig cells is further improved.

6) The vaccine effect corresponding to RNA molecules designed by using wild Cap proteins and a disclosed method is not obvious (CKV-Cap-56 group) for immunization of a porcine circovirus type 3 antigen positive group, but for an optimized RNA vaccine (SVDV 2-Cap-454 group), the positive rate of Cap protein antibodies can be improved from the initial infection stage to 20% to 96% by only low-dose injection (containing 80 mug/serving as RNA), the number of PCV3 specific IFN-gamma secretion cells in unit PBMC cells is improved by 3.3 times, and the pathogenic positive rate is improved from 100% to 3% at the initial infection stage, so that viruses are effectively removed.

7) The circular virus 3 type annular RNA vaccine provided by the invention is safe to be applied to piglets and sows.

8) The circular virus 3-type annular RNA vaccine prepared by the optimized process is stable in storage at the temperature of-20 ℃ for 6 months.

Drawings

Other features, objects and advantages of the present invention will become more apparent upon reading of the detailed description of non-limiting embodiments, given with reference to the accompanying drawings in which:

FIG. 1 is a schematic diagram of a precursor sequence and a schematic diagram of a circular RNA sequence for generating circular virus 3-type circular RNA;

FIG. 2 is a capillary electrophoresis analysis of RNA molecules in example 4.

Detailed Description

The invention will now be described in detail with reference to the drawings and specific examples. The following examples, which are presented to provide those of ordinary skill in the art with a detailed description of the invention and to provide a further understanding of the invention, are presented in terms of implementation and operation. It should be noted that the protection scope of the present invention is not limited to the following embodiments, and several adjustments and improvements made on the premise of the inventive concept are all within the protection scope of the present invention.

In the present invention, the terms "a" or "an" or "the" may mean "one" or "one or more", "at least one", and "one or more".

In the present disclosure, the terms "comprising," "having," "including," or "containing" may be used to specify the presence of stated features, integers, steps, or groups thereof, but do not preclude the presence or addition of other features, integers, steps, or groups thereof. In the meantime, "comprising," "having," "including," or "containing" may also mean enclosed, excluding additional, unrecited elements or method steps.

In the present invention, the meaning of "can" includes both the meaning of performing a certain process and the meaning of not performing a certain process.

In the present invention, "optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where the event occurs and instances where it does not.

In the present invention, the term "about" may mean: one value includes the standard deviation of the error of the device or method used to determine the value. Unless explicitly stated otherwise, it is to be understood that all ranges, amounts, values and percentages used herein are modified by "about".

In the present invention, the terms "polypeptide", "peptide" and "protein" are used interchangeably herein and are polymers of amino acids of any length. The polymer may be linear or branched, it may contain modified amino acids, and it may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).

In the present invention, the term "circular RNA" refers to RNA molecules that are in the form of closed loops. In the present invention, the circular RNA used has protein translation activity, and may be referred to as "circular RNA".

In the present invention, the term "linear RNA" refers to an RNA precursor capable of circularizing to form a circular RNA, which is generally transcribed from a linear DNA molecule, and may also be referred to as "linear RNA".

In the present invention, the term "linear RNA" refers to RNA having a translation function including a 5' cap structure (5 ' cap), a 3' polyadenylation tail (PolyA tail), a 5' untranslated sequence (5'untranslational region,5'UTR), a 3' untranslated sequence (3'untranslational region,3'UTR) and an open reading frame (Open reading frame, ORF), and the like, which may also be referred to as "linear RNA".

In the present invention, the term "recombinant nucleic acid molecule" refers to a polynucleotide having sequences that are not linked together in nature. The recombinant polynucleotide may be included in a suitable vector, and the vector may be used for transformation into a suitable host cell. The polynucleotide is then expressed in a recombinant host cell to produce, for example, "recombinant polypeptides," "recombinant proteins," "fusion proteins," and the like. In the present invention, a recombinant nucleic acid molecule comprises a coding element encoding a polypeptide of interest, and a translation initiation element linked upstream of the coding element.

In the present invention, the term "translation initiation element" refers to any sequence capable of recruiting ribosomes to initiate the translation process of an RNA molecule. Illustratively, the translation initiation element includes an IRES sequence, an m6A modified sequence, or a rolling circle translated initiation sequence, and the like.

In the present invention, the term "IRES" (Internal ribosome entry site, IRES), also known as internal ribosome entry site, "internal ribosome entry site" (IRES), belongs to a translational control sequence, typically located 5' of a gene of interest, and allows RNA to be translated in a cap-independent manner. The transcribed IRES may bind directly to the ribosomal subunit so that the RNA start codon is properly oriented in the ribosome for translation. The IRES sequence is typically located in the 5' UTR of the RNA (immediately upstream of the start codon). IRES functionally replaces the need for a variety of protein factors that interact with eukaryotic translation mechanisms.

In the present invention, the term "expression" includes any step involving the production of a polypeptide, including, but not limited to: transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

In the present invention, the term "wild type" is synonymous with "naturally occurring" and refers to an object that can be found in nature and that has not been modified by man.

In the present invention, the terms "variant," "mutant," and "mutant" are used interchangeably to refer to a nucleotide or amino acid comprising a change (i.e., substitution, insertion, and/or deletion) at one or more (e.g., several) positions relative to a "wild-type" polynucleotide or polypeptide, wherein substitution refers to the replacement of a nucleotide/amino acid occupying a position with a different nucleotide/amino acid.

In the present invention, the terms "sequence identity" and "percent identity" refer to the percentage of nucleotides or amino acids that are identical (i.e., identical) between two or more polynucleotides or polypeptides. Sequence identity between two or more polynucleotides or polypeptides may be determined by: the nucleotide or amino acid sequences of the polynucleotides or polypeptides are aligned and the number of positions in the aligned polynucleotides or polypeptides that contain the same nucleotide or amino acid residue is scored and compared to the number of positions in the aligned polynucleotides or polypeptides that contain a different nucleotide or amino acid residue. Polynucleotides may differ at one position, for example, by containing different nucleotides (i.e., substitutions or mutations) or by deleting nucleotides (i.e., nucleotide insertions or nucleotide deletions in one or both polynucleotides). The polypeptides may differ at one position, for example, by containing different amino acids (i.e., substitutions or mutations) or by deleting amino acids (i.e., amino acid insertions or amino acid deletions in one or both polypeptides). Sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of amino acid residues in the polynucleotide or polypeptide. For example, percent identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of nucleotide or amino acid residues in the polynucleotide or polypeptide and multiplying by 100.

In the present invention, the term "individual", "patient" or "subject" includes mammals. Mammals include, but are not limited to, domesticated animals (e.g., cattle, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats).

In the present invention, "treatment" means: after suffering from a disease, the subject is contacted (e.g., administered) with an RNA molecule described in the present invention, thereby alleviating the symptoms of the disease compared to when not contacted, and does not mean that the symptoms of the disease must be completely inhibited. The suffering from the disease is: the body develops symptoms of the disease.

In the present invention, "prevention" means: by contacting a subject with an RNA molecule as described in the invention prior to the onset of a disease, thereby reducing the probability of the onset of the disease and/or alleviating the symptoms after the onset of the disease as compared to the absence of the contacting is not meant to necessarily inhibit the disease entirely.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Unless otherwise indicated, all units used in this specification are units of international standard, and the numerical values and numerical ranges appearing in the present invention are understood to include unavoidable systematic errors.

The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. All reagents or equipment were commercially available as conventional products without the manufacturer's attention. Numerous specific details are set forth in the following description in order to provide a better understanding of the invention. It will be understood by those skilled in the art that the present invention may be practiced without some of these specific details. In other embodiments, methods, means, apparatus and steps well known to those skilled in the art have not been described in detail in order to not obscure the present invention.

Example 1 design and amino acid sequence optimization of circular viral 3-type circular RNA

The Cap protein is the main antigen protein on the surface of the circular virus 3-type particle, is rich in hydrophobic amino acid and is easy to aggregate (doi: 10.1186/s 13568-019-0940-0), so that the expression efficiency of the direct expression wild-type Cap protein is low, and an error folding structure such as inclusion body is easy to form.

1.1 Gene design and Synthesis

The circular virus 3 Cap protein is designed into a carrier DNA of circular RNA, and the design is mainly referred to patent CN 114574483A, wherein a translation initiation element is a mutant sequence (numbered CKV) obtained by mutating the 80 th G of Caprine kobuvirus IRES sequence into T, mutating the 81 st A into C and mutating the 82 nd G into T. Specifically, each DNA vector comprises the following elements in the 5 'to 3' direction: intron fragment II, translation initiation element fragment II (CKV-II, respectively), protein coding element, insertion element, translation initiation element fragment I (CKV-I, respectively), and intron fragment I. Wherein:

the nucleotide sequence of the intron fragment II (A-II) is shown as SEQ ID NO. 1;

the nucleotide sequence of the truncated fragment II (CKV-II) of the translation initiation element is shown as SEQ ID NO. 2;

the protein coding element comprises: nucleotide sequence encoding a wild-type Cap protein of circovirus type 3 (as shown in SEQ ID NO. 4) or other 12 Cap protein mutants obtained by pre-screening (corresponding nucleotide information is shown in Table 1), and a stop codon (as shown in (TAA) x (TAG) y (TGA) z, wherein x+y+z is equal to or greater than 1, x, y, z are each independently integers of 0 or greater, preferably the stop codon is TGA);

The nucleotide sequence of the insertion element (A-polyAC) is shown in SEQ ID NO. 5;

the nucleotide sequence of the truncated fragment I (CKV-I) of the translation initiation element is shown in SEQ ID NO. 6;

the nucleotide sequence of the intron fragment I (A-I) is shown as SEQ ID NO. 7.

Vector DNA numbers comprising the above elements and gene fragments are shown in table 1, and linear RNAs are obtained by transcription of each vector DNA, respectively, from which circular RNAs are further formed by the following mechanism: cleavage is first generated at the connection position of the truncated segment I (IRES segment I) of the ribozyme recognition translation initiation element and the intron segment I, so that the intron segment I is released; then, cleavage of the cleavage site of the translation initiation element fragment II (IRES fragment II) from the intron fragment II is recognized by the ribozyme, and the intron fragment II is released. The 3 '-end of the translation initiation element fragment I was ligated to the 5' -end of the translation initiation element fragment II to form a circular molecule (FIG. 1).

The gene fragment is synthesized by Suzhou gold only biotechnology limited company and cloned into pUC57 vector, and is verified to be correct by gene sequencing.

TABLE 1 optimization of amino acid sequences of DNA vectors and Cap proteins

1.2 preparation of circular RNA

The DNA vector obtained in step 1.1 of this example was prepared as a circular RNA.

(1) Test method

a) Preparing strains: the synthesized DNA carrier is respectively transformed into DH5 alpha competent cells, the DH5 alpha competent cells are coated on LB culture medium plates containing 100 mu g/ml ampicillin of the antibiotic, when colonies on the plates are clearly visible, the culture is carried out at 37 ℃, single colonies are picked up on 3ml LB liquid culture medium containing 100 mu g/ml ampicillin of the antibiotic, the culture is carried out at 37 ℃, 1ml bacterial liquid is taken from the culture, glycerol with the final concentration of 8 percent is added, and the engineering bacteria are respectively obtained after freezing and preservation at-80 ℃, and are used as seeds for subsequent experiments.

b) Plasmid extraction: activating the externally constructed puncture bacteria for 3-4 hours at 37 ℃/220 rpm; and (3) taking activated bacterial liquid for expansion culture, wherein the culture conditions are as follows: shaking overnight at 37 ℃/220rpm for culture; plasmid extraction was performed by commercial kit (Tiangen endotoless plasmid extraction kit).

c) Plasmid enzyme digestion and purification: plasmid cleavage was performed by restriction endonuclease BsaI (near shore protein)/BsaI (Takara) as follows: 10 Xbuffer (buffer): 100 μl, plasmid: 5mg, bsaI:150 μl (5000U) was made up to 1000 μl with water and digested overnight at 37deg.C. After cleavage, the cleaved product was column purified using a commercial DNA recovery kit (tengen) to obtain linearized plasmids.

d) In vitro transcription: the configuration transcription system is shown in table 2 below:

TABLE 2

Reagent(s)	Volume of
		10 Xreaction Buffer (Reaction Buffer)	2ml
ATP(100mM)	2ml
		CTP(100mM)	2ml
UTP(100mM)	2ml
		GTP(100mM)	2ml
Linearization plasmid (1.5 mg/ml)	600μl
		T7 RNA Polymerase (RNA Polymerase) (25U/. Mu.l)	2ml
RNase inhibitor (RNase inhibitor) (10U/. Mu.l)	2ml
		Nuclease-free water (Nuclease free water)	Totaling 20ml

Reaction conditions: 2ml of DNaseI (DNaseI) is added into the post-transcription system and the reaction is carried out for 15min at the constant temperature of 37 ℃/220 rpm.

e) Transcript RNA precipitation: adding LiCl solution into the transcription product obtained in the step a), and standing at-20 ℃ for overnight precipitation; centrifuging the overnight treatment solution to obtain RNA precipitate, drying at room temperature, and re-suspending the precipitate with enzyme-free water to obtain linear RNA aqueous solution.

f) RNA cyclization and concentration: the cyclisation system and conditions are shown in Table 3 below

TABLE 3 Table 3

Mixing the above solutions, and heating at 55deg.C for 15min. Concentrating the cyclized RNA product by ultrafiltration tube centrifugation, and discarding the filtrate; and transferring the ultrafiltered liquid to a new centrifuge tube.

g) Cyclic RNA HPLC purification: a certain amount of circular RNA was separated by column SEC-1000 (SEPAX) in 150mM phosphate buffer mobile phase, and the main peak component was collected.

h) After purification, the cyclic RNA is concentrated by ultrafiltration: carrying out ultrafiltration tube centrifugal concentration on the annular RNA tube, and discarding filtrate; adding enzyme-free water into the ultrafiltration tube, repeatedly cleaning the annular RNA for two times, and concentrating the annular RNA to the required concentration; the ultrafiltered liquid was transferred to a new centrifuge tube.

(2) Test results

Each circular RNA molecule (see Table 4) was successfully prepared by the above procedure, wherein the nucleotide sequence of CKV-Cap-56 was shown as SEQ ID NO.8, and the other groups were obtained by replacing the nucleotide sequence of wild-type Cap protein in CKV-Cap-56 (see SEQ ID NO. 4) with the nucleotide sequence of each mutant protein in Table 1, respectively.

TABLE 4 circular RNA molecules and amino acid sequence optimization

1.3 in vitro expression validation

The circular RNAs prepared in step 1.2 of the present example were respectively transfected into PK15 cells, and after 48 hours of transfection, the antigens in the cell supernatants were quantitatively detected by using His tag ELISA detection kit to evaluate the expression and secretion of the circular RNAs in the cells.

(1) Test method

1) Cell culture: PK15 cells at 1X 10 ⁵ The cells/wells were inoculated into 24-well cell culture plates using DMEM high-sugar medium containing 10% fetal bovine serum and 1% diabody at 37℃with 5% CO ₂ Culturing in an incubator. Cell transfection was performed until the cells reached 70% confluence.

2) Cell transfection: each well was diluted to 25. Mu.L with 0.75-1.5. Mu.L MessengerMax (Thermo Fisher Scientific) using Opti-MEM (Thermo Fisher Scientific) and reacted at room temperature for 10min. Each circular RNA was diluted to 25. Mu.L with Opti-MEM at 0.5. Mu.g per well. mu.L of the room temperature reacted Messenger Max/Opti-MEM dilution was mixed with 25. Mu.L of the circular RNA/Opti-MEM dilution 1:1 and incubated at room temperature for 5min.

50. Mu.L of the incubated mixed reagent is added to each 24-well cell culture plate, and the mixture is subjected to 5% CO at 37 DEG C ₂ Culturing in an incubator. Cell supernatants cultured for 48 hours were collected and frozen at-80 ℃.

PK15 cell supernatants not transfected with circular RNA were used as negative control (NC group).

3) His tag ELISA detection kit detects antigen content: the antigen content of the supernatant of each cell in step 2) was quantitatively detected by using His tag ELISA detection kit (Nanjing Jinsri Biotechnology Co., ltd., cat# L00436) according to the method of the specification.

(2) Test results

The results are shown in Table 5. After 24h transfection, all groups except CKV-Cap-291 had obvious target protein expression.

TABLE 5 Cap protein expression validation/ng/ml

Group of	Mean value of	SD value	Group of	Mean value of	SD value
						CKV-Cap-56	9.6	2.4	CKV-Cap-289	19.4	4.7
CKV-Cap-284	10.3	5.2	CKV-Cap-290	13.5	3.2
						CKV-Cap-285	13.2	5.1	CKV-Cap-291	4.4	1.2
CKV-Cap-286	12.2	2.9	CKV-Cap-292	20.4	5.9
						CKV-Cap-287	20.4	3.5	CKV-Cap-293	25.9	7.3
CKV-Cap-288	17.6	3.6	CKV-Cap-294	26.4	6.4
						Untransfected control	1.6	0.9	\	\	\

1.4 LNP-RNA preparation

Each circular RNA molecule obtained in step 1.3 was prepared as LNP-coated RNA with commercial LNP, providing for further animal testing.

(1) Test method

LNP-RNA preparation main reference DOI:10.1016/j.cell.2022.03.044, the specific procedure is as follows:

a) The circular RNA was diluted to a final concentration of 170. Mu.g/mL with PNI formulation buffer (Precision NanoSystems, cat. No. NWW 0043).

b) Commercial LNP (company Precision NanoSystems, genVoy-ILM) was mixed with circular RNA at a volume ratio of 1 to 3 using Ignite NxGen Cartridge (company Precision NanoSystems, cat# NIT 0002) on NanoAssembler Ignite (Precision NanoSystems).

c) The buffer environment is replaced by PBS with pH7.4 by using a tangential flow technology to remove ethanol, LNP-RNA is prepared, and after filtration and sterilization and quantification, 12 groups of test vaccines are obtained, wherein the numbers of the test vaccines are LNP/CKV-Cap-56, LNP/CKV-Cap-284, LNP/CKV-Cap-285, LNP/CKV-Cap-286, LNP/CKV-Cap-287, LNP/CKV-Cap-288, LNP/CKV-Cap-289, LNP/CKV-Cap-290, LNP/CKV-Cap-291, LNP/CKV-Cap-292, LNP/CKV-Cap-293 and LNP/CKV-Cap-294 respectively.

d) With Quant-iT ^TM RiboGreen ^TM RNA Assay Kit(Invitrogen ^TM R11490) the encapsulation efficiency was determined. The particle size, PDI, surface potential of the LNP particles were measured on a Zeta potential-laser particle sizer Malvern Zetasizer Nano-ZEN 3600 (Malvern) using dynamic light scattering.

(2) Test results

LNP test of the entrapped RNA prepared in the step is qualified: the particle size distribution is uniform (average 72 nm), the encapsulation rate is more than 90%, the surface potential is electronegative, the cytotoxicity caused by positively charged surfaces of nano particles is avoided, and the biological safety is good.

1.5 mouse immunization and antibody determination

(1) Experimental method

Female BABL/c mice of 6-8 weeks old are randomly divided into 13 groups, 4 groups each, the 12 groups of LNP-coated circular RNA vaccine prepared in the step 1.4 of the embodiment are subjected to muscle immunization, the inoculation dose is 10 mug/mouse, meanwhile, the LNP-inoculated mice are used as negative control, the mice are boosted on 14 days after immunization, blood separation serum is collected on 14 days after immunization and 28 days after final immunization respectively, and circular virus type 3 antibody detection is carried out respectively. The circovirus type 3 antibodies were determined using a circovirus type 3 antibody detection kit (biostone corporation).

(2) Experimental results

The results are shown in Table 6. No antibody was produced in the control group, the encoded wild-type Cap group produced only weak positives (S/P value of 0.4), and no significant improvement was found by removing the N-terminal nuclear localization signal (CKV-Cap-284 group) (S/P value of 0.6). In contrast, the present study unexpectedly found that the C-terminal truncation of 8 amino acids/W115P/Y176E (CKV-Cap-293 group) significantly improved antibody responses in mice by a factor of 3.7 compared to wild-type Cap (CKV-Cap-56 group). The C-terminal truncates 8 amino acids and contains mutation W115P/Y176E, so that the expression level in pig somatic cells is obviously increased, the related truncations and mutations can effectively reduce the surface hydrophobicity of Cap protein to improve the expression efficiency, and the improvement of antibody values indicates that the mutation still maintains the correct and uniform protein conformation. In contrast, the C-terminal truncated 9 amino acids and the mutation W115P/Y176E are included, and the expression level is obviously improved, but the antibody value is obviously reduced, and protein misfolding can be caused by structural disturbance.

The nucleotide sequence of the corresponding RNA molecule of the CKV-Cap-293 group is shown as SEQ ID NO.9, the amino acid sequence of the coded protein is shown as SEQ ID NO.10, and the nucleotide sequence of the coded protein is shown as SEQ ID NO.11; the nucleotide sequence of the corresponding RNA molecule of the CKV-Cap-56 group is shown as SEQ ID NO.8, the amino acid sequence of the coded protein is shown as SEQ ID NO.3, and the nucleotide sequence of the coded protein is shown as SEQ ID NO.4.

TABLE 6 in vivo antibody response/Cap protein specific IgG (S/P value) S/P value greater than or equal to 0.3 positive in mice

Example 2 nucleotide sequence optimization

A protein can theoretically be encoded by numerous nucleotides, from which it is difficult to pick the preferred nucleotide sequence. The research analyzes the higher structure of RNA by molecular dynamics calculation and other methods, so that the nucleotide sequence for encoding the target protein is correctly designed.

2.1 Gene design, circular RNA preparation

The Cap protein truncating mutation obtained in example 1 (C-terminal truncating 8 amino acids/W115P/Y176E, the amino acid sequence is shown in SEQ ID NO.10, the nucleotide sequence is shown in SEQ ID NO. 11) was selected to obtain 3 nucleotide sequences according to calculation: nucleotide sequence (SEQ ID NO. 12), nucleotide sequence (SEQ ID NO. 13), nucleotide sequence (SEQ ID NO. 14) corresponding DNA vectors were designed as described in step 1.1 of example 1. Each DNA vector was synthesized and cloned by Souzhou gold intellectual Biotechnology Co., ltd, and the corresponding circular RNA was obtained by the method of step 1.2 of example 1 (see Table 7).

TABLE 7 circular RNA molecules and nucleotide sequence optimization

2.2 in vitro expression validation

The circular RNA molecules are respectively transfected into PK15 cells, and His tag ELISA detection kits are respectively adopted for quantitative detection of each antigen in cell supernatants at 1 day, 2 days, 3 days, 4 days and 5 days of transfection so as to evaluate the continuous condition of expression and secretion of each circular RNA in each cell. The operation is described in example 1, step 1.3.

The results are shown in Table 8, and compared with the control CKV-Cap-293, both CKV-Cap-454 and CKV-Cap-455 significantly improved the expression amount and the expression duration of the target protein, wherein the maximum lifting amplitude of the group CKV-Cap-454 is preferable, which indicates that nucleotide optimization is necessary and effective.

TABLE 8Cap protein expression validation/ng/ml

Example 3 translation initiation element optimization

The circular RNA molecules disclosed in the prior art use preferred translation initiation elements including Caprine kobuvirus IRES sequences (numbered CKV in the present invention) and the like, and the circular RNAs comprising these translation initiation elements are expressed at high levels in human cell lines (lung cancer human alveolar basal epithelial a549 cells or human renal epithelial 293T cells), but the effect in porcine cells is unknown. On the other hand, at least thousands of translation initiation elements are known, from which it is very difficult to adapt the elements. The method of designing a combinatorial library, a nucleotide site-directed mutation modification library and the like analyzes and compares the sequences of translation initiation elements, so that the optimized nucleotide sequence of the 3-Cap protein of the circovirus is matched with better translation initiation elements.

3.1 design of translation initiation element and circular RNA preparation

Candidate translation initiation elements (numbered PPV and SVDV, respectively) were obtained by pre-screening. Vector DNA was prepared as in example 2, step 2.1, specifically by replacing the translation initiation elements (numbered CKV) in the preferred circular RNA molecule (numbered CKV-Cap-454, nucleotide sequence SEQ ID NO. 16) with candidate translation initiation elements (numbered PPV or SVDV), respectively, and further preparing the resulting circular RNA molecule (see Table 9).

TABLE 9 optimization of circular RNA molecules and translation initiation elements

The nucleotide sequence of the truncated fragment II (PPV-II) of the translation initiation element is shown as SEQ ID NO. 19;

the nucleotide sequence of the truncated fragment I (PPV-I) of the translation initiation element is shown as SEQ ID NO. 20;

the nucleotide sequence of the truncated segment II (SVDV-II) of the translation initiation element is shown in SEQ ID NO. 27;

the nucleotide sequence of the truncated segment I (SVDV-I) of the translation initiation element is shown as SEQ ID NO. 28;

the nucleotide sequence of the insertion element (A-polyAC) is shown in SEQ ID NO. 5.

In order to compare the effect of the circular RNA prepared in this study with the effect of a molecule constructed from commercial circular RNA elements, a control circular RNA molecule (numbered cRNA-Cap-454) was prepared using a circular RNA cloning construction kit (Shanghai Uygur-Kao), which encodes a circular virus 3-Cap truncated mutein (amino acid sequence see SEQ ID NO.10, nucleotide sequence see SEQ ID NO. 12) and was described in the kit specification.

3.2LNP-RNA preparation

The preparation of lipid nanoparticle/RNA composition from each circular RNA molecule prepared in this example was carried out by commercial LNP, and the specific steps are shown in step 1.4 of example 1, and LNP-coated CKV-Cap-454, LNP-coated PPV-Cap-454, LNP-coated SVDV-Cap-454 and LNP-coated cRNA-Cap-454 were obtained, respectively. The test meets the requirements: the LNP particle size distribution of each group of entrapped RNA is uniform, and the entrapment rate is more than 90%; the surface potential is electronegative, so that cytotoxicity caused by positive charge on the surface of the nanoparticle is avoided, and the biological safety is good.

3.3 animal immunization and Effect assessment

PCV3 antigen positive pig farms were selected for animal immunization and efficacy assessment. 50 weaned pigs with PCV3 antigen positive and 4-6 weeks old were randomly drawn, and the average of the weaned pigs was divided into 5 groups, 10 weaned pigs in each group were subjected to neck muscle immunization, and after preliminary dose searching, the RNA vaccination dose was set to 100 mug/weaned pigs in the test:

group 1: LNP-coated CKV-Cap-454 was inoculated at an immunization dose of 100 μg/dose.

Group 2: LNP-coated CKV-Cap-56 was inoculated at an immunization dose of 100 μg/dose.

Group 3: LNP-coated PPV-Cap-454 was inoculated at an immunization dose of 100. Mu.g/dose.

Group 4: LNP-coated cRNA-Cap-454 was inoculated at an immunization dose of 100. Mu.g/dose.

Group 5: the LNP-coated SVDV-Cap-454 was inoculated at an immunization dose of 100. Mu.g/dose.

Group 6: sterile PBS was inoculated at an immunizing dose of 1 ml/hr.

The RNA groups were boosted once at the same dose on day14 (day 14) after the initial immunization (day 0). Serum is collected before immunization and after 42 days of secondary immunization, nucleic acid is extracted to perform PCV3 specific PCR detection so as to evaluate the prevention and control effect on virus infection; serum was collected separately to detect the amount of PCV 2-specific IFN-gamma secreting cells in the circovirus type 3 antibodies and PBMC cells to assess humoral and cellular immune responses. PCV 3-specific PCR detection reference (preparation of porcine circovirus 3 Cap protein Virus-like particles and immunogenicity Studies [ D ], 2022), wherein the upstream and downstream primers are respectively: f4: TTGAACGGTGGGGTCGTATG (see SEQ ID NO. 21), R4: CAAGACGACCCTTATGCGGA (see SEQ ID NO. 22). The circovirus type 3 antibodies were detected using the circovirus type 3 antibody detection kit (biostone corporation). The specific IFN-gamma secreting cell content of PCV3 was measured by the ELISPOT method, specific operating reference (PMID: 28725106) in which the stimulatory antigen of PCV3 is a pool of Cap protein polypeptides of PCV3 (15 mers of 11 amino acid overlaps, cap protein spanning the entire PCV3, more than 85% pure polypeptide, by Shen's biosynthesis and supplied). Each result is represented as a mean value.

The results are shown in tables 10 to 11. The PCR positive rate of the blood virus nucleic acid of each group before immunization/at the early infection stage is 100 percent, and the positive rate of the blood antibody is 20 percent, which shows that the humoral immunity and the cellular immune response of the wild virus infection cannot resist virus infection. After immunization, the positive rate of the PBS group antibody is 30%, and the number of IFN-gamma secreting cells in unit PBMC is 44, which corresponds to 100% of the PCR positive rate of the blood virus nucleic acid, indicating no beneficial progress without intervention. The SVDV-Cap-454 group antibody positive rate is improved to 95%, the IFN-gamma secretion cell number is improved to 112, and the PCR positive rate of corresponding blood virus nucleic acid is reduced to 5%, which shows that the pig humoral immunity and cell immune response are successfully stimulated, and the application effect on virus elimination is good. And the SVDV-Cap-454 group effect is obviously better than the CKV-Cap-56 group (the ring-packaged RNA molecule is designed by the disclosed method to encode Cap wild type protein), the cRNA-Cap-454 group (the ring-packaged RNA molecule is prepared by the commercial kit to encode Cap truncated mutant protein) and the CKV-Cap-454 group (the ring-packaged RNA molecule is designed by the disclosed method to encode Cap truncated mutant protein). The invention provides the initially effective annular RNA molecules with optimal design, and provides a basis for developing vaccines for preventing the infection of the type 3 circular viruses.

TABLE 10 humoral and cellular immune responses

TABLE 11 PCV3 Virus nucleic acid PCR in pig

Example 4 design and optimization of circovirus type 3 vaccine

4.1 vector DNA design and construction

Different vector DNA plasmids were designed for the circovirus type 3 virus Cap protein (see table 12). The vector DNA comprises loop-forming elements in the 5 'to 3' direction in the following order: an intron fragment II, a translation initiation element fragment-II, a protein coding element, an insertion element, a translation initiation element fragment-I, and an intron fragment I.

TABLE 12 design and construction of vector DNA

Wherein, the intron fragment II (number B-II), the intron fragment I (number B-I) and the insertion element (B-polyAC) are obtained through design optimization screening, and the specific information is as follows:

the nucleotide sequence of the intron fragment II (SEQ ID NO. 23) is shown.

The nucleotide sequence of the intron fragment I (numbering B-I) is shown as SEQ ID NO. 24.

The nucleotide sequence of the insertion element (B-polyAC) is shown in SEQ ID NO. 25.

The gene is synthesized and cloned by Suzhou gold intelligence biotechnology limited company. The obtained gene fragment was ligated into BsaI restriction enzyme cleavage site of pUC57 vector, and was confirmed to be correct by gene sequencing.

4.2 construction of recombinant bacteria

4.2.1 construction of primordial seeds. E.coli DH 5. Alpha. Competent cells were transformed with the vector DNA molecules pSVDV-Cap-454 and pSVDV2-Cap-454, respectively, and the cells were plated on LB medium plates containing the corresponding antibiotics (100. Mu.g/ml ampicillin), cultured at 37℃until colonies on the plates were clearly visible, single colonies containing high copies of the plasmids were picked up on 3ml of liquid LB medium containing the corresponding antibiotics (100. Mu.g/ml ampicillin), cultured at 37℃and 1ml of the bacterial solution was added with glycerol at a final concentration of 8% from the culture medium, and frozen and stored at-80℃to obtain recombinant engineering bacteria (serial numbers of b-pSVDV-Cap-454 and b-pSVDV2-Cap-454, respectively) as the original seed stock.

4.2.2 identification of original seeds.

(1) Morphology and biochemical properties: the engineering bacteria are gram negative short bacillus. Can ferment and decompose glucose, and produce acid and gas; the indole test and the methyl red test are positive; the Voges-Proskauer two-test (V.P test) and the citrate test were negative.

(2) Culture characteristics: round, clean-edged, raised, milky and glossy smooth colonies were grown on LB solid medium.

(3) Pure test: the test is carried out according to the pure test method in the annex of the beast pharmacopoeia of the people's republic of China, and the result is pure.

(4) And (3) identification: sequencing analysis is carried out, and the nucleotide sequence is consistent with the target sequence.

4.3 fermentation of recombinant bacteria

b-pSVDV-Cap-454 and b-pSVDV2-Cap-454 strains are inoculated into 500mL LB culture medium containing corresponding antibiotics (100 mug/mL ampicillin), shake culture is carried out at 28-32 ℃ until the OD600 value is about 2.0-4.0, seed solution is inoculated into a 5L fermentation tank according to the inoculation amount of 0.5-3%, and fermentation culture is carried out when the cell OD600 value is about 80-100. The wet weight of the cells was collected by centrifugation and about 1000g.

4.4 preparation and examination of plasmid DNA

4.4.1 cell lysis

(1) 200g of the E.coli fermentation cells obtained in the step 4.3 are taken, 1.6L of solution I stored at 4 ℃ is added according to the mass-volume ratio of the cells to the solution I (50 mM Tris-Hl,10mM EDTA, pH 8.0) of 1:8, and the solution I is stirred until the solution I is dissolved.

(2) After dissolution, 1.6L of solution II (0.2M NaOH,1.0% SDS) was added, stirred slowly, and then left to stand for reaction for 3-10min.

(3) After the reaction is completed, 1.6L of solution III (3M KAC, pH5.5, pre-cooling at 4 ℃) is added, the mixture is shaken uniformly, and the mixture is left to stand still for reaction for 30min.

(4) After the reaction is finished, adding 2M CaCl ₂ 1.6L of solution, shaking gently, standing still for reaction for 1h, separating the cracking solution into two layers, wherein the upper layer is solid, the lower layer is liquid, leading out the liquid by a peristaltic pump, and filtering and removing impurities by a filter element with the aperture of 1.0 mu m.

4.4.2 Ultrafiltration concentration

Passing the lysate through a Quickstand ultrafiltration separation system, and using 300KD hollow fiber ultrafiltration membrane (GE Healthcare Life Science, USA, membrane area 850 cm) ² Membrane fiber tube diameter 1 mm), membrane negative pressure (TMP) of 1psi, operating time of 1.5h, and concentration multiple of 5-10 times volume.

4.4.3 ion exchange chromatography

Plasmid by AKTA purifier ^TM 100 purification systemPurifying with Capto ^TM DEAE (GE Healthcare Life Science, USA) was used to purify plasmids, 5 column volumes were equilibrated with a wash solution (0.55M NaCl,50Mm Tris-HCL,10mm EDTA,pH 8.0) before purification, and after the sample was applied, the column was washed with a wash solution (0.55M NaCl,50Mm Tris-HCL,10mm EDTA,pH 8.0); gradient eluting with eluent (0.65M NaCl,50Mm Tris-HCl,10Mm EDTA,pH 8.0) and collecting the eluted sample; then, the mixture was regenerated by washing with CIP (2M NaCl,0.5M NaOH) and equilibrated with a equilibration solution.

4.4.4 gel filtration chromatography

Capto is firstly taken ^TM The core 700 (GE Healthcare Life Science, USA) column was run with PBS (NaCl 8.5g/L, na ₂ HPO ₄ ·12H ₂ O 2.9g/L，KH ₂ PO ₄ 0.25g/L, pH 7.4) was equilibrated for 3 column volumes, and the sample collected by ion exchange column purification was loaded onto Capto ^TM core 700, after sample loading was completed, eluted with PBS and eluted samples were collected.

4.4.5 Ultrafiltration and diafiltration

The membrane was separated by a Quickstand ultrafiltration system using a 100KD hollow fiber ultrafiltration membrane (GE Healthcare Life Science, USA, membrane area 500 cm) ² Membrane fiber tube diameter 1 mm), concentration and diafiltration, membrane negative pressure (TMP) at 1psi, concentration factor 5-10 volume, diafiltration factor 4-12.

4.4.6 plasmid DNA yield and yield/impurity removal Effect

The process of plasmid DNA (pSVDV 2-Cap-454) was confirmed by spectrophotometry to determine the concentration of plasmid DNA, horseshoe crab reagent gel method to detect endotoxin residues of bacteria, agarose gel electrophoresis to detect RNA residues, and BCA method to test protein residues according to the guidelines of preclinical study of DNA vaccine for prevention.

And (3) performing amplification culture on the escherichia coli DH5 alpha strain through optimized culture medium and culture conditions to obtain bacterial cells. The method adopts a cracking method, and macromolecular RNA and protein impurities are removed by adding calcium chloride, so that a plasmid DNA crude extraction sample is obtained, and the impurities can be further removed by ultrafiltration, chromatography and the like.

The quality inspection results are shown in Table 13. Aiming at pSVDV2-Cap-454 plasmid, the optimized process is used, the yields of cleavage, ultrafiltration concentration, ion exchange chromatography, gel filtration chromatography and ultrafiltration and diafiltration reach 77%, 86%, 92%, 93% and 87%, respectively, the total yield reaches 49%, and the production process meets the requirements.

TABLE 13 plasmid DNA yield (pSVDV 2-Cap-454)

4.4.7 plasmid test

Plasmids (pSVDV-Cap-454, pSVDV 2-Cap-454) were examined according to Analytical Procedures for mRNA Vaccine Quality rd USP, and each index was satisfactory.

(1) And (3) identification: the plasmid was sequenced and the sequence was identical to the target sequence.

(2) Concentration analysis: the plasmid concentration was determined by UV spectrophotometry and the results are shown in Table 14.

(3) Purity analysis: A260/A280, supercoiled content and impurity residue are analyzed according to the method specified by the rule, wherein the A260/A280 is between 1.8 and 2.0, the supercoiled content is not less than 90%, the host RNA residue is less than 100pg/ml, the host DNA is less than 1ng/ml, the host protein residue is less than 100pg/ml, and the residual activity of antibiotics is negative.

(4) Safety: endotoxin content was less than 10EU/ml by analysis of endotoxin examination according to the methods specified by the regulations.

(5) Other: the appearance and pH are analyzed according to the method specified by the regulations, and the appearance inspection is free of foreign matters and the pH value is 6.5-7.5.

TABLE 14 DNA plasmid yield and purity

4.5 preparation and examination of circular RNA

4.5.1 preparation of circular RNA

(1) Plasmid enzyme digestion and purification: plasmid cleavage was performed by restriction endonuclease Bsa I (near shore protein)/Bsa I (Takara) as follows: 10 Xbuffer (buffer): 2ml, plasmid: 100mg, bsaI:3ml, water was made up to 20ml and digested overnight at 37 ℃. After cleavage, the linearized plasmid was obtained by chromatographic purification using Capto Q ImpRes (Source 30Q) (Cytiva).

(2) In vitro transcription: the configuration transcription system is shown in table 15 below:

TABLE 15

Reagent(s)	Volume of
		10 Xreaction Buffer (Reaction Buffer)	100ml
ATP	100ml
		CTP	100ml
UTP	100ml
		GTP	100ml
Linearization plasmid	30ml
		T7 RNA Polymerase (RNA Polymerase)	100ml
RNase inhibitor (RNase inhibitor) (40U/. Mu.l)	100ml
		Nuclease-free water (Nuclease free water)	Totaling 1000ml

Reaction conditions: and (3) carrying out constant-temperature shaking reaction for 1-4 h at 20-40 ℃/220rpm, adding 100ml of DNaseI (1000U/ml) into a post-transcription system, and carrying out constant-temperature shaking reaction for 15min at 37 ℃/220 rpm.

The long linear RNA is difficult to obtain stable and complete RNA molecules by using a conventional in-vitro transcription reaction system, and the following conditions are respectively and sequentially optimized one by one aiming at the plasmid pSVDV2-Cap-454 so as to obtain optimal transcription conditions:

1) Linearized plasmid template concentration optimization: the final concentration of the plasmid template in the system is 25mg, 50mg, 75mg and 100mg respectively.

2) Nucleotide concentration optimization: the final concentrations of GTP/ATP/CTP/UTP in the system were set to 8mM/8mM/8mM, 32mM/8mM/8mM, 16mM/16mM/8mM/8mM, respectively.

3) T7 RNA Polymerase (RNA Polymerase) concentration optimization: the concentrations of T7 RNA Polymerase (RNA Polymerase) in the system were set to 750KU, 900KU, 1000KU, 1250KU, respectively.

4) Enzymatic reaction temperature optimization: the enzymatic reaction temperature was set to 20 ℃, 30 ℃, 37 ℃ and 40 ℃ in order.

5) Optimization of enzymatic reaction duration: the enzymatic reaction time is sequentially 1h, 2h, 3h and 4h.

RNA content was determined by UV spectrophotometry and RNA integrity was analyzed by capillary electrophoresis.

The conditions have great influence on the RNA in-vitro transcription result, and the RNA content obtained by in-vitro transcription of plasmid pSVDV2-Cap-454 is lower than 0.5g/1000ml and contains more incomplete RNA without condition optimization.

Optimal in vitro transcription conditions were obtained by experimental screening: the linearized plasmid template concentration was 50mg, GTP/ATP/CTP/UTP final concentration was 16mM/32mM/8mM/8mM, the final concentration of T7 RNA Polymerase (RNA Polymerase) was 1000KU, the enzymatic reaction temperature was 37℃and the enzymatic reaction time period was 2 hours. Under the condition, the RNA content obtained by in vitro transcription of plasmid pSVDV2-Cap-454 can be increased to 3.7g/1000ml, and the production process meets the requirements.

(3) Transcript RNA precipitation: adding LiCl solution into the transcription product, and standing at-20deg.C overnight for precipitation; centrifuging the overnight treatment solution to obtain RNA precipitate, drying at room temperature, and re-suspending the precipitate with enzyme-free water to obtain linear RNA aqueous solution.

(4) RNA cyclization and concentration: the cyclisation system and conditions are shown in table 16 below:

table 16

The solution is fully and evenly mixed and heated for 8 to 20 minutes at the temperature of 48 to 60 ℃. Concentrating the cyclized RNA product by ultrafiltration tube centrifugation, and discarding the filtrate; and transferring the ultrafiltered liquid to a new centrifuge tube.

The stable and complete RNA molecules are difficult to obtain by using a conventional reaction system, and the following conditions are respectively and sequentially optimized one by one aiming at the plasmid pSVDV2-Cap-454 so as to obtain optimal cyclization conditions:

(1) Linear RNA concentration optimization: the final concentration of the linear RNA in the system is set to be 3g, 3.5g and 4g respectively.

(2) Magnesium ion concentration optimization: the final concentration of magnesium ions in the system was set to 5mM, 8mM, 10mM, 12mM and 15mM, respectively.

(3) And (3) optimizing cyclization reaction temperature: the reaction temperature was set to 48 ℃, 52 ℃, 55 ℃, 58 ℃, 62 ℃ in this order.

(4) And (3) optimizing the cyclization reaction time: the reaction time is set to be 8min, 10min, 12min, 15min and 20min in sequence.

The above conditions have a great influence on the RNA circularization results, and complete circular RNA cannot be prepared without optimization. Optimal cyclisation conditions were obtained by experimental screening: the linear RNA concentration was 3.5g, the magnesium ion concentration was 8mM, the cyclization reaction temperature was 52℃and the cyclization reaction time was 15min. Under the condition, the plasmid pSVDV2-Cap-454 is subjected to in vitro transcription and cyclization to obtain the reaction with the content of the circular RNA reaching 3.3g/1000ml, and the production process meets the requirements.

(5) Cyclic RNA HPLC purification: a certain amount of circular RNA was separated by column SEC-1000 (SEPAX) in 150mM phosphate buffer mobile phase, and the main peak component was collected.

(6) After purification, the circular RNA is concentrated: the circular RNA tube was concentrated to the desired concentration by TFF Capsule (LV Centramate, PALL Co.) with a TFF Capsule membrane area of 0.02m ² The flow rate was 120mL/min, and the ultrafiltered liquid was sterilized and filtered before transferring to a new sample bottle.

Through the optimization process, the circular RNA containing the following sequence structure is successfully prepared and obtained:

the circular RNA is named as SVDV-Cap-454 and has the sequence shown in SEQ ID NO. 26.

The circular RNA prepared from the DNA plasmid pSVDV2-Cap-454 is named SVDV2-Cap-454, and the sequence is shown as SEQ ID NO. 29.

4.5.2RNA inspection

The circular RNA was tested according to Analytical Procedures for mRNA Vaccine Quality rd USP, and each index met the requirements.

(1) And (3) identification: and sequencing the RNA, wherein the sequence is consistent with the target sequence.

(2) Concentration analysis: the concentration of RNA was measured by an ultraviolet spectrophotometer, and the results are shown in Table 17.

(3) Integrity analysis: RNA integrity was determined by Capillary Gel Electrophoresis (CGE) to be not less than 80% and the results are shown in Table 17 and FIG. 2.

(4) Purity analysis: each impurity residue was analyzed by the prescribed method, with a dsRNA content of less than 0.5%, a DNA template residue of less than 100pg/mg RNA, a free nucleotide residue of less than 100pg/mg RNA, and a T7 RNA polymerase residue of less than 50ppm.

(5) Efficacy analysis: PK15 cells are transfected according to a specified method, target protein expression is detected according to a conventional Cap protein detection method, and after 48 hours of transfection, the expression quantity of SVDV-Cap-454 and SVDV2-Cap-454 group target proteins respectively reaches 212.4ng/ml and 220.8ng/ml, and the expression quantity of SVDV2-Cap-454 group proteins is obviously higher than that of SVDV-Cap-454, so that the optimization of coding elements, translation initiation elements, insertion elements and the like is effective, and the expression efficiency of target proteins in pig somatic cells is greatly improved.

(6) Safety: endotoxin was analyzed as specified, with endotoxin content less than 0.1EU/ml.

(7) Other: the appearance and pH were analyzed by a predetermined method, and the appearance was examined to be free from foreign matter and to have a pH of 6.5 to 7.5.

The 1.9-fold increase in the yield of SVDV2-Cap-454 group circular RNA compared to the SVDV-Cap-454 group encoding the same protein sequence, indicates that optimization of the non-coding region is efficient and necessary, and successfully increases yield. Thus, a corresponding set of circular RNA molecules (numbered SVDV 2-Cap-454), plasmid DNA molecules (numbered pSVDV 2-Cap-454) and E.coli strains (numbered b-SVDV 2-Cap-454) comprising the plasmid DNA molecules are preferred.

TABLE 17 Cyclic RNA molecule yield and purity

/>

4.6LNP-RNA production Process study

This section investigated the process of LNP-coated RNA production.

4.6.1LNP-RNA preparation

(1) Preparing a solution I: dissolving cationic lipid, cholesterol, neutral lipid and PEG modified lipid in ethanol to obtain solution I.

(2) Preparing a solution II: the preferred circular RNA of step 4.5 (numbered SVDV 2-Cap-454) was dissolved in 10mM citrate buffered saline solution at pH 4.0.

(3) LNP-RNA was prepared using microfluidic techniques to rapidly mix the two phases and tangential flow techniques to replace the buffer environment with PBS at pH 7.4 to remove ethanol. In this section, liposome preparation and vaccine preparation processes are optimized, specifically involving liposome components and ratios of components, LNP to RNA ratios, as follows:

3.1 Liposome components and proportioning condition screening: solutions I were prepared with different compositions and ratios, specifically comprising cationic lipids (set CMAX4 (4- [ (3- { [3- ({ 3- [ bis (3- {4- [ (2-butyloctanoyl) oxy ] butoxy } -3-oxopropyl) amino ] propyl } (methyl) amino) propyl ] (3- {4- [ (2-butyloctanoyl) oxy ] butoxy } -3-oxopropyl) amino } propoxy) butyl ] octoate) or SM-102 (1-octylnonyl 8- [ (2-hydroxyethyl) [6-O-6- (undecyloxy) hexyl ] amino ] -octoate)) set 45% -55%, cholesterol (5-cholesten-3 beta-ol) set 35% -44%, neutral lipids (set DSPC (distearoyl phosphatidylcholine) or DOPE (dioleoyl phosphatidylethanolamine)) set 3% -10%, PEG-DMG (polyethylene glycol-dimyristate glycerol) or PEG-DSG (distearoyl-glycerol) set) or PEG-digluc-8% of PEG-8.c) were purchased from the same technology as 0.4% of the department of biological scid pharmaceutical sciences, the remaining lipids were purchased from Ai Weita (Shanghai) pharmaceutical technologies Inc. and LNP-coated cyclic RAN molecules were prepared at a 1 to 1 ratio of LNP/cyclic RNA (number SVDV 2-Cap-454) volume ratio and the particle size and encapsulation efficiency of each group were compared.

The results show that the liposome components and the proportion have larger influence on the results: if the combination ratio of CMAX 4/cholesterol/DOPE/PEG-DPG is 54.5:36.5:9.2:1.8, the coating is ineffective, and the encapsulation efficiency is lower than 10%.

The preferred liposome component obtained through experiments is CMAX 4/cholesterol/DSPC/PEG-DMG, the preferred proportion of the components is 45.7:42.5:9.2:1.5, the molecular particle size is the most uniform (average 74 nm), the encapsulation rate reaches 93%, and the production process meets the requirements.

3.2 LNP/RNA ratio optimization: LNP and circular RNA (numbered SVDV 2-Cap-454) were mixed in different ratios (volume ratio of solution I: II 1:1, 1:2, 1:3, 1:4, 1:5, 1:6), and gel blocking experiments were used to verify optimal LNP/RNA ratios. The results show that when the volume ratio of Liposome Nanomaterial (LNP) to circular RNA molecule (numbered SVDV 2-Cap-454) is greater than 1:3, migration of SVDV2-Cap-454 can be completely blocked. Thus, the volume ratio of LNP/circular RNA molecule was set to 1:3.

(4) The circular RNA molecule (numbered SVDV 2-Cap-454) was coated with LNP under the above-described preferred conditions, then sucrose was added to a final concentration of 8%, and the RNA vaccine, numbered LNP/SVDV2-Cap-454, was obtained by aseptic filtration.

(5) With Quant-iT ^TM RiboGreen ^TM RNA Assay Kit(Invitrogen ^TM R11490) and the particle size, polydispersity index PDI, surface potential of the LNP particles were measured on a Zeta potential-laser particle sizer Malvern Zetasizer Nano-ZEN 3600 (Malvern) using dynamic light scattering.

4.6.2 experimental results

The results are shown in Table 18, and each index of LNP-coated RNA was checked to be acceptable: wherein the particle size is lower than 80nm, the PDI is lower than 0.15, and the encapsulation efficiency is higher than 90%; the surface potential is electronegative. The overall particle size is smaller and uniformly distributed, the surface electronegativity avoids cytotoxicity caused by positively charged surfaces of the nano particles, the biological safety is good, and a feasibility basis is provided for large-scale preparation of vaccines.

TABLE 18 LNP-RNA sample characterization

Numbering device	Particle size (nm)	PDI	Surface potential (mV)	Encapsulation efficiency (%)
					LNP/SVDV2-Cap-454	74	0.14	-6.8	93

4.7 LNP-coated RNA immune effect assessment

For the vaccine prepared in step 4.6 with the preferred LNP, the immune effect was evaluated and the immune dose was determined

4.7.1 mouse immunization and antibody determination

(1) Experimental method

Female C57BL/6 mice of 6-8 weeks old are randomly divided into 3 groups of 5 mice, LNP/SVDV2-Cap-454 prepared by preferential LNP in the step and C-LNP/SVDV2-Cap-454 prepared by commercial LNP (the preparation method is shown in step 1.4 of example 1) are immunized by 10 mug/mouse, meanwhile, the LNP-inoculated mice are used as negative control, the immunity is enhanced on 14 days after immunization, blood separation serum is collected on 14 days and 28 days after last immunization respectively, and the detection of the type 3 antibody of the circular virus is carried out respectively. The circovirus type 3 antibodies were determined using a circovirus type 3 antibody detection kit (biostone corporation).

(2) Experimental results

The results are shown in Table 19. The LNP prepared by the preferred process is superior to commercial LNP, successfully improves the antibody level in mice, and provides a feasible basis for further research.

TABLE 19 in vivo antibody response/Cap protein specific IgG (S/P value) S/P value greater than or equal to 0.3 positive in mice

	Immunization for 14 days	Second immunization for 28 days
			LNP/SVDV2-Cap-454	1.5	2.8
c-LNP/SVDV2-Cap-454	1.2	2.5
			LNP	Without any means for	Without any means for

4.7.2 pig immunization and immunization route, and determination of immunization dose

The experimental pig screening criteria are shown in table 20 below, and 28 piglets are screened altogether.

Table 20 Experimental pig screening criteria

The experimental animals were equally divided into 4 groups of 7 animals each.

Group 1: step 4.6 the LNP/SVDV2-Cap-454 vaccinated pigs (neck muscle), at an immunizing dose of 60. Mu.g/mouse, numbered SVDV 2-Cap-454-60. Mu.g.

Group 2: step 4.6 the LNP/SVDV2-Cap-454 vaccinated pigs (neck muscle) were vaccinated with an immunizing dose of 80. Mu.g/mouse, numbered SVDV 2-Cap-454-80. Mu.g.

Group 3: step 4.6 the LNP/SVDV2-Cap-454 vaccinated pigs (neck muscle) were immunized at 100. Mu.g/dose, numbered SVDV 2-Cap-454-100. Mu.g.

Group 4: immunization with PBS alone, immunization dose 1 ml/mouse, PBS group numbered.

And boost once on day 14 after primary immunization. Serum was collected 28 days from the second immunization to prepare serum for detection of the circovirus type 3 antibodies. Blood was collected 14 days after the second immunization to prepare serum, and IFN-. Gamma.and IL-4 content in each of the serum groups was examined using a MILLIPLEX MAP Porcine Cytokine and Chemokine Magnetic Bead Panel-Immunology Multiplex Assay kit (MERCK Co., product number PCYTAG-23K-09) to preliminarily evaluate the cellular immune response. The specific operation is carried out according to the operation instruction of the kit.

(2) Test results

The results of the pig blood antibody detection are shown in Table 21. The PBS group has no antibody production, and the SVDV2-Cap-454 group can effectively induce pigs to produce high-level antibodies by low-dose immunization (80 mug), thereby indicating that the vaccine is efficient.

The cytokine content of each pig blood is shown in table 22. Compared with the PBS group, the SVDV2-Cap-454 group can effectively improve the IFN-gamma and IL-4 content in pig serum, and the method prompts effective activation of cellular immune response, further improves the protective effect of the vaccine and provides basis for further research.

Table 21 pig in vivo antibody response/Cap protein specific IgG (S/P value) S/P value greater than or equal to 0.3 positive

TABLE 22 IFN-. Gamma.and IL-4 content (mean.+ -. SD value) in pig serum (pg/ml)

Group of	IFN-γ	IL-4
			SVDV2-Cap-454-60μg	7156.9±724.4	796.4±211.3
SVDV2-Cap-454-80μg	22549.7±9568.2	1679.3±904.6
			SVDV2-Cap-454-100μg	20944.6±5126.3	1577.9±603.7
PBS	156.7±66.4	79.8±33.2

4.8 animal immunization and efficacy assessment

PCV3 antigen positive pig farms were selected for animal immunization and efficacy assessment. 300 weaned pigs with PCV3 antigen positive and 4-6 weeks old were randomly drawn, and the average number of the weaned pigs was divided into 3 groups, and 100 weaned pigs in each group were subjected to neck muscle immunization:

group 1: LNP-coated CKV-Cap-56 was inoculated at an immunizing dose of 80 μg/dose.

Group 2: the LNP-coated SVDV2-Cap-454 was inoculated at an immunizing dose of 80. Mu.g/dose.

Group 3: sterile PBS was inoculated at an immunizing dose of 1 ml/hr.

The RNA groups were boosted once at the same dose on day14 (day 14) after the initial immunization (day 0). Serum is collected before immunization and after 42 days of secondary immunization, nucleic acid is extracted to perform PCV3 specific PCR detection so as to evaluate the prevention and control effect on virus infection; serum was collected separately to detect the amount of PCV 2-specific IFN-gamma secreting cells in the circovirus type 3 antibodies and PBMC cells to assess humoral and cellular immune responses, as described in step 3.3 of example 3.

The results are shown in tables 23 to 24. The PCR positive rate of the blood virus nucleic acid of each group before immunization/at the early infection stage is 100 percent, and the positive rate of the blood antibody is 23 percent, which shows that humoral immunity and cellular immunity stimulated by wild virus infection cannot resist virus infection. After immunization, the positive rate of the PBS group antibody is 25%, the number of IFN-gamma secretion cells in unit PBMC is 38, and the PCR positive rate of the corresponding blood virus nucleic acid is 100%, which shows that no beneficial progress is caused without intervention; there was no significant improvement in the CKV-Cap-56 group compared to the PBS group. The positive rate of SVDV2-Cap-454 group antibody is increased to 96%, the number of IFN-gamma secretion cells in unit PBMC is increased to 124, and the PCR positive rate of corresponding blood virus nucleic acid is reduced to 3%, which shows that vaccine immunity successfully stimulates pig humoral immunity and cellular immune response, and has good effect on virus elimination. The research optimizes the preparation of the circular RNA molecules and prepares the LNP-coated RNA vaccine through an optimized preparation process, thereby providing a basis for developing the vaccine for preventing virus infection.

TABLE 23 humoral and cellular immune responses

TABLE 24 PCV3 Virus antigen Positive Rate in pigs before and after immunization

4.9 vaccine safety test

3 batches of RNA vaccines are prepared by SVDV2-Cap-454 molecules according to the optimized preparation process laboratory, the batch numbers are P3-001, P3-002 and P3-003 respectively, and the vaccine is packaged into 25 ml/bottle after being inspected to be qualified by physical properties, sterility test and the like, and is preserved at the temperature of minus 20 ℃ for standby. Preliminary safety test studies were performed on piglets and sows.

4.9.1 Single dose immunization piglet test

The number of non-immunized healthy piglets is 40, each batch of vaccine is set as 1 group, 1-3 groups are immune test groups, 10 groups are selected from each group, and the 4 th group is a non-vaccinated control group and 10 groups are selected from the group. The immunization test group pigs were vaccinated at 1 part (0.5 ml/dose) and injected intramuscularly at the neck. Safety test clinical observation was carried out for 28 days, and the clinical manifestations of the test pigs were recorded.

4.9.2 Single dose repeat immunized piglet test

After waiting for the completion of the single dose inoculation test group, the 2 nd single dose repeated immunization test is carried out, 1 part (0.5 ml/part) of each pig neck muscle is injected according to the vaccine of the same batch, and the clinical manifestations of the test pigs are recorded after the inoculation and further observation for 28 days.

4.9.3 high dose immunization piglet test

The non-immune healthy piglets are selected to be 40 (10 piglets/litter), each batch of vaccine is set as 1 group, 1-3 groups are immune test groups, 10 piglets are selected from each group, and the 4 th group is a non-vaccinated control group and 10 piglets are selected from each group. The immunization test group pigs were vaccinated at 2 parts (0.5 ml/dose) and injected intramuscularly at the neck. Safety test clinical observation was carried out for 28 days, and the clinical manifestations of the test pigs were recorded.

4.9.4 sow immune safety test

The method comprises the steps of selecting 20 primiparous sows, setting 1 group of vaccine in each batch, setting 1-3 groups of vaccine in each group as an immune experiment group, setting 5 groups of vaccine in each group, setting the 4 th group as a control group, and setting 5 vaccinations. The sows were vaccinated once each day 20 before mating and before parturition, at a dose of 1 serving (0.5 ml/serving). The observation of sows covers the whole lactation period, weaning is observed all the time, and the focus of the study is to determine the survival rate of piglets, including weak fetus, dead fetus and the like.

4.9.5 safety test judgment standard

The vaccinated test pigs do not cause clinical symptoms such as progressive emaciation, pale skin, mao Cucao, enlarged superficial lymph nodes, dyspnea, dyspepsia, raised body temperature and the like, and the local reaction condition of vaccine injection has influence on feeding, weight gain and the like of the pigs. Passive immune sow farrowing survival rate and weight gain in lactation.

The results are shown in tables 25 to 28. The test pigs are inoculated in a single dose, after 28 days of clinical observation after the inoculation, no local reaction caused by vaccine injection is found, and no other adverse reaction is found in the vaccinated pigs; the body temperature and body weight measurements were not significantly different from the control group, demonstrating that the vaccine single dose vaccinated group was safe (table 25).

Test pigs were vaccinated at a single dose and each group was vaccinated repeatedly with the same batch of vaccine at the same dose and route 21 days after the vaccination interval. No allergic reaction to the injection was seen on the 2 nd repeat vaccination. Clinical observation for 28 days shows that no local reaction caused by vaccine injection is found, and no other adverse reactions are found in vaccinated pigs; the body temperature and body weight measurements were not significantly different from the control group, demonstrating that single dose repeated vaccination of the vaccine was only safe for the test pigs (table 26).

The test pigs are inoculated in large dose, after 28 days of clinical observation, no local reaction caused by vaccine injection is found, and no other adverse reaction is found in the vaccinated pigs; the body temperature and body weight measurements were not significantly different from the control group, demonstrating that the high dose vaccinated group was safe (table 27).

The pregnant sow is inoculated, clinical reproduction disorder diseases such as abortion, stillbirth and the like are not caused by the vaccine on the pregnant sow, compared with a blank control group, the vaccine immune group sow has no obvious influence on the litter size and weight increment condition, and the litter size is 9-12 and belongs to the normal range. The vaccine is healthy and active to the farrowing, has good survival rate and no toxic or side effect, and proves that the vaccine is safe to pregnant sows (table 28).

Table 25 conventional safety test results

Table 26 results of double dose safety test

TABLE 27 high dose safety test results

Table 28 results of the sow immune safety test

4.10 vaccine stability Studies

3 batches of RNA vaccines are prepared on SVDV2-Cap-454 molecules according to the optimized preparation process laboratory, the batch numbers are respectively P3-001, P3-002 and P3-003, the vaccine is packaged into 25 ml/bottle after being checked to be qualified by physical properties, sterility test and the like, the vaccine is preserved at the temperature of minus 20 ℃ for standby, and the samples are respectively tested in 0 day, 1 month, 2 months, 3 months and 6 months:

With Quant-iT ^TM RiboGreen ^TM RNA Assay Kit(Invitrogen ^TM R11490) RNA content and encapsulation efficiency were determined. The particle size of the LNP particles was measured using a Zeta potential-laser particle sizer Malvern Zetasizer Nano-ZEN 3600 (Malvern). pH and appearance checks were performed.

The detection results are shown in Table 29, the vaccine is stable after being stored for 6 months at the temperature of minus 20 ℃, the encapsulation efficiency, the particle size, the RNA content, the RNA integrity, the pH and the appearance have no obvious change, and the vaccine is stable, thus providing a foundation for the preparation and the application of the large-scale vaccine.

Table 29 vaccine storage stability

The foregoing describes specific embodiments of the present invention. It is to be understood that the invention is not limited to the particular embodiments described above, and that various changes and modifications may be made by one skilled in the art within the scope of the claims without affecting the spirit of the invention.

Claims (12)

1. A circular RNA comprising a coding element that encodes a polypeptide comprising a Cap protein of circovirus type 3; the amino acid sequence of the coding element coding the circovirus type 3 Cap protein comprises a sequence shown as SEQ ID NO.3, or a sequence which has at least 90% sequence identity with the sequence shown as SEQ ID NO.3 and has or partially has the activity of the Cap protein;

the nucleotide sequence of the coding element for the circovirus type 3 Cap protein comprises a sequence shown as SEQ ID NO.4, or has at least 90% sequence identity with the sequence shown as SEQ ID NO.4, and codes for a polypeptide with or partially with the activity of the circovirus type 3 Cap protein;

The coding element comprises any one of the following nucleotide sequences encoding 8 amino acids C-terminally truncated Cap protein of the circovirus 3/comprising the mutation W115P/Y176E: nucleotide sequence shown as SEQ ID NO.11, nucleotide sequence 1 shown as SEQ ID NO.12, nucleotide sequence 2 shown as SEQ ID NO.13, and nucleotide sequence 3 shown as SEQ ID NO. 14.

2. The circular RNA of claim 1, comprising elements in the order shown in any one of (a) to (d) as follows:

(a) A first exon, a second exon, a 5 'spacer, a translation initiation element, a coding element, and a 3' spacer;

(b) A first exon, a second exon, a translation initiation element, and a coding element;

(c) A translation initiation element and a coding element;

(d) A translation initiation element, a coding element, and an insertion element;

the translation initiation element comprises one or more sequences having translation initiation activity as shown below: IRES sequence, 5' UTR sequence, kozak sequence, m-containing ⁶ A modified sequence, a complement of ribosomal 18S rRNA; the insert element comprises one or more of the sequences shown below: an untranslated region sequence, a polyN sequence, an aptamer sequence, a ribosome switching sequence, and a sequence that binds a transcriptional regulator; wherein the polyN sequence, wherein N is selected from at least one of A, T, G, C.

3. The circular RNA of claim 2, wherein the nucleotide sequence of the circular RNA is any one of the following: a nucleotide sequence shown as SEQ ID NO.8, a nucleotide sequence shown as SEQ ID NO.9, a nucleotide sequence shown as SEQ ID NO.15, a nucleotide sequence shown as SEQ ID NO.16, a nucleotide sequence shown as SEQ ID NO.17, a nucleotide sequence shown as SEQ ID NO.18, a nucleotide sequence shown as SEQ ID NO.26, and a nucleotide sequence shown as SEQ ID NO. 29.

4. A linear RNA which cyclizes upon self-cleavage to form a circular RNA according to any one of claims 1 to 3.

5. A recombinant nucleic acid molecule, wherein said recombinant nucleic acid molecule forms a linear RNA after transcription; the linear RNA as set forth in claim 4.

6. A recombinant escherichia coli engineering bacterium, which is obtained by converting the recombinant nucleic acid molecule of claim 5 into e.

7. A circovirus type 3 vaccine comprising a circular RNA according to any one of claims 1 to 3, characterized in that the circovirus type 3 vaccine comprises a circular RNA molecule encoding a circovirus type 3 Cap truncated plus mutein, the amino acid sequence of which is shown as SEQ ID No.10 or a degenerate sequence thereof, and a pharmaceutically acceptable carrier, the nucleotide sequence of which is shown as SEQ ID No.12 or a degenerate sequence thereof.

8. The circovirus type 3 vaccine according to claim 7, wherein the nucleotide sequence of the circular RNA molecule is any one of the following: a nucleotide sequence shown as SEQ ID NO.26 and a nucleotide sequence shown as SEQ ID NO. 29.

9. The circovirus type 3 vaccine according to claim 7, wherein the circular RNA molecule encoding the circovirus type 3 Cap truncated plus mutein is formed by transcriptional circularization of a vector DNA comprising the arrangement order elements according to any of the following (1) to (2):

(1) An intron fragment II shown as SEQ ID NO.1, a translation initiation element fragment II shown as SEQ ID NO.27, a coding element shown as SEQ ID NO.12, a polyAC shown as SEQ ID NO.5, a translation initiation element fragment I shown as SEQ ID NO.28, and an intron fragment I shown as SEQ ID NO. 7;

(2) An intron fragment II shown as SEQ ID NO.23, a translation initiation element fragment II shown as SEQ ID NO.27, a coding element shown as SEQ ID NO.12, a polyAC shown as SEQ ID NO.25, a translation initiation element fragment I shown as SEQ ID NO.28, and an intron fragment I shown as SEQ ID NO. 24.

10. The circovirus type 3 vaccine according to claim 7, wherein the lipid nanoparticle has a raw material composition, in mole percent, comprising: 45% -55% of cationic lipid, 35% -44% of cholesterol, 3% -10% of neutral lipid and 0.8% -1.8% of PEG modified lipid; the cationic lipid is CMAX4 or SM-102; the cholesterol is 5-cholesten-3 beta-ol; the neutral lipid is DSPC or DOPE; the PEG modified lipid is PEG-DMG, PEG-DSG or PEG-DPG.

11. A method of preparing a circovirus type 3 vaccine according to any one of claims 7-10, characterised in that the method comprises the steps of:

s1, synthesizing a ring virus 3-type Cap truncated mutant protein gene and a ring forming element, and cloning the ring virus 3-type Cap truncated mutant protein gene and the ring forming element into a recombinant vector to obtain the recombinant vector containing the ring virus 3-type Cap truncated mutant protein gene and the ring forming element;

s2, transforming or transducing the recombinant vector containing the ring virus 3-type Cap truncated mutant protein gene and the loop-forming element obtained in the step S1 into a host to obtain a recombinant containing the recombinant vector;

s3, culturing the recombinants obtained in the step S2, and preparing plasmids containing the ring virus 3 type Cap truncated mutant protein genes and the ring-forming elements;

S4, preparing a circular RNA for encoding the circular virus 3 type Cap truncated mutant protein by using the plasmid containing the circular virus 3 type Cap truncated mutant protein gene and the loop-forming element obtained in the step S3;

s5, adding a pharmaceutically acceptable carrier into the annular RNA for encoding the annular virus 3 type Cap truncated mutant protein obtained in the step S4 to obtain the annular virus 3 type vaccine.

12. Use of a circular RNA according to any one of claims 1 to 3, or a linear RNA according to claim 4, or a recombinant nucleic acid molecule according to claim 5, or a recombinant escherichia coli engineering bacterium according to claim 6, or a circovirus type 3 vaccine according to any one of claims 7 to 10, or a circovirus type 3 vaccine obtained by a preparation method according to claim 11, for the preparation of a medicament for the prophylaxis and/or treatment of circovirus type 3.