CN117265153A - InDel marker primer for identifying natural population bacterial age of lentinus edodes and identification method - Google Patents
InDel marker primer for identifying natural population bacterial age of lentinus edodes and identification method Download PDFInfo
- Publication number
- CN117265153A CN117265153A CN202310445546.7A CN202310445546A CN117265153A CN 117265153 A CN117265153 A CN 117265153A CN 202310445546 A CN202310445546 A CN 202310445546A CN 117265153 A CN117265153 A CN 117265153A
- Authority
- CN
- China
- Prior art keywords
- lentinus edodes
- age
- identifying
- natural population
- bacterial
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 240000000599 Lentinula edodes Species 0.000 title claims abstract description 51
- 235000001715 Lentinula edodes Nutrition 0.000 title claims abstract description 51
- 230000001580 bacterial effect Effects 0.000 title claims abstract description 50
- 239000003550 marker Substances 0.000 title claims abstract description 30
- 238000000034 method Methods 0.000 title claims abstract description 18
- 238000001962 electrophoresis Methods 0.000 claims abstract description 15
- 239000000203 mixture Substances 0.000 claims abstract description 5
- 238000000246 agarose gel electrophoresis Methods 0.000 claims abstract description 3
- 230000013011 mating Effects 0.000 claims abstract description 3
- 238000012408 PCR amplification Methods 0.000 claims description 16
- 150000001875 compounds Chemical class 0.000 claims description 2
- 108090000623 proteins and genes Proteins 0.000 claims description 2
- 102000004169 proteins and genes Human genes 0.000 claims description 2
- 241001060310 Styracaceae Species 0.000 claims 1
- 235000001361 Styrax officinalis Nutrition 0.000 claims 1
- 235000019382 gum benzoic Nutrition 0.000 claims 1
- 235000001674 Agaricus brunnescens Nutrition 0.000 abstract description 27
- 238000001514 detection method Methods 0.000 abstract description 12
- 238000009395 breeding Methods 0.000 abstract description 11
- 230000001488 breeding effect Effects 0.000 abstract description 11
- 239000000463 material Substances 0.000 abstract description 6
- 238000012216 screening Methods 0.000 abstract description 5
- 230000000694 effects Effects 0.000 abstract description 2
- 210000000349 chromosome Anatomy 0.000 description 13
- 238000003752 polymerase chain reaction Methods 0.000 description 9
- 239000003147 molecular marker Substances 0.000 description 7
- 241000233866 Fungi Species 0.000 description 6
- 239000011543 agarose gel Substances 0.000 description 6
- 239000012634 fragment Substances 0.000 description 6
- 238000012163 sequencing technique Methods 0.000 description 5
- 239000000980 acid dye Substances 0.000 description 4
- 102000039446 nucleic acids Human genes 0.000 description 4
- 108020004707 nucleic acids Proteins 0.000 description 4
- 150000007523 nucleic acids Chemical class 0.000 description 4
- 239000000243 solution Substances 0.000 description 4
- 239000007853 buffer solution Substances 0.000 description 3
- 238000012364 cultivation method Methods 0.000 description 3
- 239000012154 double-distilled water Substances 0.000 description 3
- 239000000499 gel Substances 0.000 description 3
- 238000003384 imaging method Methods 0.000 description 3
- 238000012986 modification Methods 0.000 description 3
- 230000004048 modification Effects 0.000 description 3
- 235000015511 Liquidambar orientalis Nutrition 0.000 description 2
- 239000004870 Styrax Substances 0.000 description 2
- 244000028419 Styrax benzoin Species 0.000 description 2
- 235000000126 Styrax benzoin Nutrition 0.000 description 2
- 238000009402 cross-breeding Methods 0.000 description 2
- 238000012217 deletion Methods 0.000 description 2
- 230000037430 deletion Effects 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 238000009396 hybridization Methods 0.000 description 2
- 238000011081 inoculation Methods 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- 230000009105 vegetative growth Effects 0.000 description 2
- 108700028369 Alleles Proteins 0.000 description 1
- 241000894006 Bacteria Species 0.000 description 1
- 201000004569 Blindness Diseases 0.000 description 1
- 244000201986 Cassia tora Species 0.000 description 1
- 235000014552 Cassia tora Nutrition 0.000 description 1
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 238000004364 calculation method Methods 0.000 description 1
- 238000006243 chemical reaction Methods 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 238000012258 culturing Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 238000001914 filtration Methods 0.000 description 1
- 238000012214 genetic breeding Methods 0.000 description 1
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 1
- 239000010931 gold Substances 0.000 description 1
- 229910052737 gold Inorganic materials 0.000 description 1
- 230000012010 growth Effects 0.000 description 1
- 238000012165 high-throughput sequencing Methods 0.000 description 1
- 238000003780 insertion Methods 0.000 description 1
- 230000037431 insertion Effects 0.000 description 1
- 238000002372 labelling Methods 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 238000013507 mapping Methods 0.000 description 1
- 230000035800 maturation Effects 0.000 description 1
- 230000035772 mutation Effects 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 235000016709 nutrition Nutrition 0.000 description 1
- 230000035764 nutrition Effects 0.000 description 1
- 238000002798 spectrophotometry method Methods 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 230000009466 transformation Effects 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an InDel marker primer for identifying the bacterial age of a natural population of lentinus edodes and an identification method, wherein a primer composition comprises the following components: SEQ ID NO.1:3'-AACGAATTCTCCCATCTTAGCA-5', SEQ ID NO.2:3'-CTTTGCGCATGGTACTAGAGT-5'; the method comprises S1, obtaining DNA of Lentinus Edodes; s2, amplifying DNA of the lentinus edodes by PCR; s3, performing agarose gel electrophoresis on the PCR product; s4, judging the mating type of the lentinus edodes according to the number and the length of the electrophoresis strips; the InDel marker disclosed by the invention can be used for rapidly identifying the breeding materials of the strains with short bacterial ages and long bacterial ages in the natural mushroom population, has the advantages of high detection accuracy, good repeatability, high detection efficiency and strong operability, solves the problem of low breeding efficiency of selecting and breeding parent bacterial ages only by experience judgment in the prior art, and realizes the technical effect of early screening of strains with different bacterial ages in the natural mushroom population in the mycelium stage.
Description
Technical Field
The invention relates to the technical field of genetic breeding, in particular to an InDel marker primer for identifying the bacterial age of a natural population of lentinus edodes and an identification method.
Background
Lentinus edodes (Lentinus edodes) is the most productive variety of cultivated edible fungi. The mushroom age (Vegetative Growth Rate, VGR) refers to the time required from inoculation to primordium generation (nutrition growth stage), the difference of the bacterial ages between different varieties of edible mushrooms and different strains of the same variety is large, and the bacterial ages of different strains of the mushrooms are in the range of 60-180d. The mushroom age determines the cultivation time of the mushroom stick and directly influences the mushroom yield, thus having important application value in production. With the continuous increase of the cultivation amount of the lentinus edodes and the facility and intensive transformation of the cultivation mode, the requirements for different types of lentinus edodes varieties are higher and higher, wherein the requirements for short-bacterial-age varieties are particularly urgent in order to shorten the cultivation period. At present, mushroom variety breeding is still mainly based on traditional crossbreeding, the parent selection can only be judged by virtue of cultivation experience, certain limitation exists only by virtue of cultivation experience, optimal parents are difficult to select in natural populations to carry out crossbreeding with different bacterial age traits, and great blindness exists. The method for directionally selecting the parent with the specific character by the aid of the molecular marker has a great deal of application in crop breeding, but has less application in edible fungi. Along with the maturation of molecular marker technology and the completion of the sequencing of the genome of the mushrooms, the application of directional breeding of the mushrooms and other edible mushrooms by using molecular markers is inevitable. The InDel molecular marker is an application based on a high-throughput sequencing technology, and has the advantages of being rich in quantity, high in accuracy, good in stability, rapid and simple in typing and the like.
Therefore, developing an InDel marker primer and a detection method thereof for identifying the bacterial age of a natural population of lentinus edodes becomes a major research problem in the field.
Disclosure of Invention
Aiming at the problems, the invention also provides an InDel marker primer and an identification method for identifying the bacterial age of the natural population of the lentinus edodes, which can be used for early screening and identification of the bacterial strain of the natural population of the lentinus edodes with natural child-length bacterial age and short bacterial age, and further can be used for molecular marker assisted breeding of the lentinus edodes.
To achieve the purpose, the invention provides the following technical scheme:
in a first aspect of the invention, there is provided an InDel marker primer composition for identifying the age of a natural population of lentinus edodes, comprising:
SEQ ID NO.1：3’-AACGAATTCTCCCATCTTAGCA-5’；
SEQ ID NO.2：3’-CTTTGCGCATGGTACTAGAGT-5’。
preferably, the primer amplifies the InDel marker site as follows: chr2:4546558-4546812, the marker position is 4546639-missing 77.
Preferably, the mushrooms comprise 931, L26, pingquan 18, shenxiang No. 10, CR04, styrax, shouxiang No.1, wuxiang No.1, shenxiang No. 8, junxing No. 8, shenxiang No. 12, xiangxiang No. 26, Q1, huxiang F2, 3239, 238, 0912, 3243, huaxiang No. 5, 212, cv105, L135, qingke 20, 939, shenxiang No. 18, senyuan No. 10, 3210, shenxiang No. 16, jindi mushrooms 241-4, mushrooms 241, 9608.
In a second aspect of the invention, there is provided a kit for identifying the age of a natural population of lentinus edodes, the kit comprising a kit for identifying the InDel marker locus chr2:4546558-4546812, a base, protein or compound with a 4546639-deleted 77 tag position.
Preferably, the base comprises:
SEQ ID NO.1：3’-AACGAATTCTCCCATCTTAGCA-5’；
SEQ ID NO.2：3’-CTTTGCGCATGGTACTAGAGT-5’。
preferably, the mushrooms comprise 931, L26, pingquan 18, shenxiang No. 10, CR04, styrax, shouxiang No.1, wuxiang No.1, shenxiang No. 8, junxing No. 8, shenxiang No. 12, xiangxiang No. 26, Q1, huxiang F2, 3239, 238, 0912, 3243, huaxiang No. 5, 212, cv105, L135, qingke 20, 939, shenxiang No. 18, senyuan No. 10, 3210, shenxiang No. 16, jindi mushrooms 241-4, mushrooms 241, 9608.
In a third aspect of the invention, there is provided a method for identifying the age of a natural population of lentinus edodes, comprising the steps of:
s1, obtaining DNA of lentinus edodes;
s2, amplifying DNA of the lentinus edodes by PCR;
s3, performing agarose gel electrophoresis on the PCR product;
s4, judging the mating type of the lentinus edodes according to the number and the length of the electrophoresis strips.
Preferably, the judging method in the step S4 is that when 169bp and 248 bp bands and 2 bands are amplified, the bands are the natural group short bacterial strain of the lentinus edodes; when the strain is amplified to 1 band at 246bp, the strain is the lentinus edodes natural population long-bacterial-age strain.
Preferably, in step S2, the PCR primers are:
SEQ ID NO.1：3’-AACGAATTCTCCCATCTTAGCA-5’
SEQ ID NO.2：3’-CTTTGCGCATGGTACTAGAGT-5’。
preferably, in step S2, the PCR amplification conditions are: 94 ℃ for 5min;94 ℃ for 30s, 48-55 ℃ for 45s,72 ℃ for 30s,35 cycles; 7min at 72 ℃. Preferably, the method for identifying the bacterial age of the natural population of lentinus edodes comprises the following steps:
step one, mycelium culture: transferring Lentinus Edodes mycelium onto PDA plate, culturing at 25deg.C in dark place, and collecting mycelium after 10 d;
step two, extracting genome DNA: extracting genome DNA of the mycelium by using a CTAB method, detecting the concentration and purity of the total genome DNA by using an ultraviolet spectrophotometry, and adjusting the concentration of the sample DNA to 20-30 ng/uL;
step three, detecting InDel molecular markers: PCR amplification of InDel markers developed on the extracted DNA described above:
PCR amplification system: 2 XEs Premix TaqTM 10. Mu.L, inDel labeled forward primer, reverse primer (10. Mu. Mol/L) 1. Mu.L each, template DNA (20-30 ng/. Mu.L) 2. Mu.L, and ddH2O to 20. Mu.L; PCR amplification conditions: 94 ℃ for 5min;94 ℃ for 30s, 48-55 ℃ for 45s,72 ℃ for 30s,35 cycles; 7min at 72 ℃; preserving at 10 ℃.
Fourth, electrophoresis detection: carrying out electrophoresis on the PCR amplified product sample 7uL on agarose gel added with nucleic acid dye, wherein the volume percentage concentration of the agarose gel is 2.5%, the electrophoresis buffer solution is 1xTAE, the voltage is 90v, the current is 300mA, the power is 100w, the electrophoresis is 5 hours, and a gel imaging system is used for photographing and analyzing the result;
performing PCR (polymerase chain reaction) amplification on the lentinus edodes strain by using InDel Marker primers with the number of JLID-3, determining the number and the relative molecular weight of allelic fragments amplified by each InDel Marker primer by using a control DNA Marker2000, and counting the number of strips;
wherein the InDel locus is located on chromosome 2, and the name of the InDel marker is chr2:4546558-4546812, the labeling position is 4546639-missing 77, the forward primer 3'-5' is AACGAATTCTCCCATCTTAGCA, the reverse primer 3'-5' is CTTTGCGCATGGTACTAGAGT, and the product size is 246bp.
Compared with the prior art, the technical scheme of the invention has the beneficial effects and remarkable progress that: the invention takes a natural group of mushrooms as a research object, comprehensively utilizes mixed pool resequencing and bioinformatics means to develop excellent marking sites of short bacterial age and long bacterial age, forms 1 pair of InDel marks for early screening of the short bacterial age and long bacterial age strains of the natural group of mushrooms and allele specific primers of genotypes of 1 InDel site, and adopts the method for early screening of the strains of different bacterial ages of the natural group of mushrooms, can rapidly identify the strains of different bacterial ages of the natural group of mushrooms as breeding materials by utilizing the marking and judging method, has high detection accuracy, good repeatability and high detection efficiency, has strong operability, solves the problem that the prior art can only judge the breeding efficiency of the short bacterial age and the long bacterial age of the natural group of mushrooms by virtue of cultivation experience in a bacterial stick stage, reduces a large amount of workload and test cost, and realizes the technical effect of identifying the short bacterial age and the long bacterial age strains of the natural group of mushrooms in a hypha stage.
Drawings
In order to more clearly illustrate the technical solution of the present invention, the following description will briefly explain the drawings used in the embodiments of the present invention.
FIG. 1 shows the PCR amplification result of a natural population of Lentinus Edodes of example 3;
FIG. 2 shows the results of PCR amplification of the natural population of Lentinus edodes of example 4.
Detailed Description
The invention is further illustrated below in connection with specific examples. The examples are only for illustrating the present invention and are not intended to limit the scope of the present invention. Further, it is understood that various changes and modifications may be made by those skilled in the art after reading the disclosure herein, and such equivalents are intended to fall within the scope of the claims appended hereto.
The sources of the strains and experimental materials in this example are as follows:
the strain sources are shown in table 1 below.
TABLE 1
Marker、Premix Taq TM All purchased from: takala Bio Bao Ri Biotechnology Co., ltd.
Nucleic acid dyes were purchased from: beijing full gold Biotechnology Co.
The rest materials and reagents are all common commercial products.
Example 1 screening for InDel markers
Constructing a hybridization group by taking mushrooms L135 and 931 as parents, and dividing a hybridization seed fungus stick into three fungus age periods for fruiting test: the first batch is cultured for 80d, the second batch is cultured for 100d, and the third batch is cultured for 120d. The age of the bacteria was calculated comprehensively from the number of days from inoculation to primordium formation (vegetative growth), the number of buds, the weight of single mushrooms and the total yield according to three batches of cultivation experiments.
Randomly selecting 30 strains of long bacterial age strains (+.120d30), 30 strains of short bacterial age strains (+.80d30 strains) and 30 strains of intermediate bacterial age strains (80-120 d), carrying out BSA mixed pool sequencing, wherein the depth of parent and offspring re-sequencing is 30X, and sequencing 5G data in each pool. The original sequencing data is filtered to remove reads with an N content of more than 10%, and reads with a linker and low mass are removed to obtain high mass reads. High quality reads were aligned to Lentinus edodes reference genome L808-1 (GenBank accession No. JABFYJ 000000000) using alignment software bwa (0.7.12). Statistical mutation sites using alignment software bwa (0.7.12): the variants of the multiple samples were first tested using Unified Genotyper module of software GATK (3.4-46), then the detected variance was filtered using Variant Filtration, and finally the variance sites were analyzed. Obtaining 47 polymorphic SNP loci in total through resequencing, taking the SNP loci with the depth of more than 10 for the calculation of ED values, and mapping the distribution of ED2 value points of the SNP on the chromosome in order to intuitively reflect the distribution of the ED values of the offspring on the chromosome. Plotting the squares of the ED values reduces the interference of background noise. ED values are plotted on the abscissa with chromosomes 1-10 as the ordinate. Fitting with a Loess curve. The results show that: there are multiple SNP threshold peak regions, and the peak regions on chromosome 2, 4, 6, 7, 8, 9 are most pronounced.
Further comparing with reference genome, positioning 8 sites related to bacterial age based on the deletion and proportion difference of SNP sites, respectively positioning at 380000-5000000bp of chromosome 2 and 106000-266000bp of chromosome 4,
1900000-2200000bp, 0-4000000bp of chromosome 6, 2600000-2770000bp of chromosome 7, 2520000-2800000bp of chromosome 8, 930000-102000bp of chromosome 9, and 2400000-2440000bp. The 8-site insertion and deletion fragments are detected, and 38 InDel molecular marker sites are screened.
Example 2 design of InDel tagged primers
The 38 InDel molecular marker loci screened in example 1 above were subjected to primer design. The Primer is designed in the length of 200bp on each wing of InDel locus by the 5.0 software of a Premier Primer, and the obtained Primer sequence is synthesized by the biology.
| Numbering device | Sequence(s) |
| SEQ ID NO.1 | AACGAATTCTCCCATCTTAGCA |
| SEQ ID NO.2 | CTTTGCGCATGGTACTAGAGT |
Example 3 detection of Lentinus Edodes Natural population short bacterial age Natural seed and its parent Using InDel marker
Performing PCR amplification on DNA extracted from natural population short bacterial strain and parent thereof, wherein the PCR reaction conditions are as follows:
PCR amplification system: 2 XEs Premix TaqTM 10. Mu.L, inDel labeled forward primer, reverse primer (10. Mu. Mol/L) 1. Mu.L each, template DNA (20-30 ng/. Mu.L) 2. Mu.L, and ddH2O to 20. Mu.L; PCR amplification conditions: 94 ℃ for 5min;94 ℃ for 30s, 48-55 ℃ for 45s,72 ℃ for 30s,35 cycles; 7min at 72 ℃; preserving at 10 ℃.
And (3) electrophoresis detection: carrying out electrophoresis on the PCR amplified product sample 7uL on agarose gel added with nucleic acid dye, wherein the volume percentage concentration of the agarose gel is 2.5%, the electrophoresis buffer solution is 1xTAE, the voltage is 90v, the current is 300mA, the power is 100w, the electrophoresis is 5 hours, and a gel imaging system is used for photographing and analyzing the result;
the InDel marked primer with the number of JLID-3 is selected for carrying out PCR amplification on the lentinus edodes strain, the number and the relative molecular weight of allelic fragments amplified by each InDel marked primer can be determined by the control DNA Marker2000, and the number of bands is counted.
Wherein the InDel site is screened in example 1: located on chromosome 2, inDel marker name chr2:4546558-4546812, the marker position is 4546639-missing 77.
Primers were designed for example 2: the forward primer 3'-5' was AACGAATTCTCCCATCTTAGCA, the reverse primer 3'-5' was CTTTGCGCATGGTACTAGAGT, and the product size was 246bp. Detecting the number and relative molecular weight of allelic fragments amplified by the InDel marker primer of the strain to be detected; 1 band is respectively arranged at 169bp and 246bp, namely the strain is a short bacterial strain; only 1 band is arranged at 246bp, namely the long fungus age strain.
The PCR amplification result of the short bacterial strain of the natural population of the lentinus edodes is shown in figure 1, 14 bacterial strains in 21 hybridosomes have 1 band at 169bp and 246bp respectively, the statistics is that the bacterial strain of the short bacterial strain is counted, and the bacterial age identification result of 66.67% of the bacterial strains is consistent with the bacterial age identification result of the early cultivation method. 33.33% of the results of identifying the bacterial age of the strain are inconsistent with those of the prior cultivation method, which can be related to the standard of the time for identifying the bacterial age by the prior cultivation method. The molecular marker detection has higher accuracy, good repeatability, high detection efficiency and strong operability, can help a breeding worker to evaluate the bacterial age and temperature characteristics of the existing natural population germplasm resources, greatly reduces the difficulty of selecting mushroom breeding parents, solves the problem that the efficiency of judging by virtue of cultivation experience in the bacterial stick stage in the prior art is low, and has great practical application value.
Example 4 detection of Lentinus Edodes Natural population Long-acting bacterial Strain and its parent Using InDel marker
PCR amplification system: 2 XEs Premix TaqTM 10. Mu.L, inDel labeled forward primer, reverse primer (10. Mu. Mol/L) 1. Mu.L each, template DNA (20-30 ng/. Mu.L) 2. Mu.L, and ddH2O to 20. Mu.L; PCR amplification conditions: 94 ℃ for 5min;94 ℃ for 30s, 48-55 ℃ for 45s,72 ℃ for 30s,35 cycles; 7min at 72 ℃; preserving at 10 ℃.
And (3) electrophoresis detection: carrying out electrophoresis on the PCR amplified product sample 7uL on agarose gel added with nucleic acid dye, wherein the volume percentage concentration of the agarose gel is 2.5%, the electrophoresis buffer solution is 1xTAE, the voltage is 90v, the current is 300mA, the power is 100w, the electrophoresis is 5 hours, and a gel imaging system is used for photographing and analyzing the result;
the InDel marked primer with the number of JLID-3 is selected for carrying out PCR amplification on the lentinus edodes strain, the number and the relative molecular weight of allelic fragments amplified by each InDel marked primer can be determined by the control DNA Marker2000, and the number of bands is counted.
Wherein the InDel site is screened in example 1: located on chromosome 2, inDel marker name chr2:4546558-4546812, the marker position is 4546639-missing 77.
Primers were designed for example 2: the forward primer 3'-5' was AACGAATTCTCCCATCTTAGCA, the reverse primer 3'-5' was CTTTGCGCATGGTACTAGAGT, and the product size was 246bp. Detecting the number and relative molecular weight of allelic fragments amplified by the InDel marker primer of the strain to be detected; 1 band is respectively arranged at 169bp and 246bp, namely the strain is a short bacterial strain; only 1 band is arranged at 246bp, namely the long fungus age strain.
As shown in FIG. 2, the PCR amplification result of the Lentinus edodes natural population long-fungus-age strain shows that 11 hybridosomes all meet 1 band at 256bp, and the accuracy is 100% when counted as the long-fungus-age strain.
Applicant states that during the description of the above specification:
the terms "this embodiment," "an embodiment of the invention," "as shown in … …," "further improved embodiments," and the like, mean that a particular feature, structure, material, or characteristic described in the embodiment or example is included in at least one embodiment or example of the invention; in this specification, a schematic representation of the above terms is not necessarily directed to the same embodiment or example, and the particular features, structures, materials, or characteristics described, etc. may be combined or combined in any suitable manner in any one or more embodiments or examples; furthermore, various embodiments or examples, as well as features of various embodiments or examples, described in this specification may be combined or combined by one of ordinary skill in the art without undue experimentation.
Finally, it should be noted that:
the above embodiments are only for illustrating the technical solution of the present invention, and are not limiting thereof;
although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art will appreciate that modifications may be made to the technical solutions described in the foregoing embodiments, or equivalents may be substituted for some or all of the technical features thereof, without departing from the spirit of the technical solutions of the embodiments of the present invention, and that insubstantial improvements and modifications or substitutions by one skilled in the art from the disclosure herein are within the scope of the invention as claimed.
Claims (9)
1. An InDel marker primer composition for identifying the age of a natural population of lentinus edodes, comprising:
SEQ ID NO.1：3’-AACGAATTCTCCCATCTTAGCA-5’；
SEQ ID NO.2：3’-CTTTGCGCATGGTACTAGAGT-5’。
2. an InDel marker primer composition for identifying the age of a natural population of lentinus edodes according to claim 1, wherein the InDel marker sites amplified by the primer are: chr2:4546558-4546812, the marker position is 4546639-missing 77.
3. An InDel marker primer composition for use in identifying the age of a natural population of lentinus edodes according to claim 1, wherein said lentinus edodes comprises 931, L26, flat spring 18, shen 10, CR04, storax, shou 1, marxiang 1, shen 8, jun 8, shen 12, xiang 26, Q1, hun xiang F2, 3239, 238, 0912, 3243, hua xiang 5, 212, cv105, L135, qingke 20, 939, shen 18, sen 10, 3210, shen 16, jindixiang, 241-4, lentinus edodes 241, 9608.
4. A kit for identifying the age of a natural population of lentinus edodes, said kit comprising a marker for identifying InDel marker locus chr2:4546558-4546812, a base, protein or compound with a 4546639-deleted 77 tag position.
5. A kit for identifying the age of a natural population of lentinus edodes as claimed in claim 4, wherein said bases comprise:
SEQ ID NO.1：3’-AACGAATTCTCCCATCTTAGCA-5’；
SEQ ID NO.2：3’-CTTTGCGCATGGTACTAGAGT-5’。
6. a method for identifying the age of a natural population of lentinus edodes, comprising the steps of:
s1, obtaining DNA of lentinus edodes;
s2, amplifying DNA of the lentinus edodes by PCR;
s3, performing agarose gel electrophoresis on the PCR product;
s4, judging the mating type of the lentinus edodes according to the number and the length of the electrophoresis strips.
7. The method for identifying the age of natural population of Lentinus edodes according to claim 6, wherein the judging method in the step S4 is that when 169bp and 246bp of 2 bands are amplified, the strain is a natural population of Lentinus edodes short bacterial strain;
when the strain is amplified to 1 band at 246bp, the strain is the lentinus edodes natural population long-bacterial-age strain.
8. A method for identifying the age of a natural population of lentinus edodes according to claim 6, wherein in step S2, the PCR primers are:
SEQ ID NO.1：3’-AACGAATTCTCCCATCTTAGCA-5’
SEQ ID NO.2：3’-CTTTGCGCATGGTACTAGAGT-5’。
9. a method for identifying the age of a natural population of lentinus edodes according to claim 6, wherein in step S2, the PCR amplification conditions are: 94 ℃ for 5min;94 ℃ for 30s, 48-55 ℃ for 45s,72 ℃ for 30s,35 cycles; 7min at 72 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310445546.7A CN117265153A (en) | 2023-04-24 | 2023-04-24 | InDel marker primer for identifying natural population bacterial age of lentinus edodes and identification method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310445546.7A CN117265153A (en) | 2023-04-24 | 2023-04-24 | InDel marker primer for identifying natural population bacterial age of lentinus edodes and identification method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117265153A true CN117265153A (en) | 2023-12-22 |
Family
ID=89207024
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310445546.7A Pending CN117265153A (en) | 2023-04-24 | 2023-04-24 | InDel marker primer for identifying natural population bacterial age of lentinus edodes and identification method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117265153A (en) |
-
2023
- 2023-04-24 CN CN202310445546.7A patent/CN117265153A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106755480B (en) | SSR molecular marker I for identifying progeny plants of Gala apples and application thereof | |
| CN111926098B (en) | InDel molecular marker closely linked with epistatic gene Y of eggplant fruit color and application | |
| CN114752702B (en) | Molecular marker BnCa-2C2 closely linked with rape calcium content trait QTL and application thereof | |
| CN117265153A (en) | InDel marker primer for identifying natural population bacterial age of lentinus edodes and identification method | |
| CN114107542B (en) | DNA bar code for identifying origin of agrocybe aegerita, primer group and application | |
| CN116732221A (en) | InDel marker primer for identifying bacterial age of lentinula edodes hybridization population and identification method | |
| CN109554498B (en) | Molecular marker for identifying early-late maturing characteristics of single-cropping water bamboo and application and acquisition method thereof | |
| CN112011640A (en) | KASP molecular marker, primer and application for identifying pH of watermelon fruit | |
| CN113981134B (en) | Indel marker combination for early screening of high-polysaccharide lentinan strains and detection method thereof | |
| CN112593006B (en) | Wheat green-extending character main effect QTL locus, KASP primer closely linked with same and application of KASP primer | |
| CN111996280B (en) | SNP marker co-separated from brassica napus dwarf compact trait and application thereof | |
| CN112980985B (en) | PCR primer group for identifying or screening cabbage hybrid lethal parent type 1 and application thereof | |
| KR102526682B1 (en) | Molecular marker for predicting fruit orientation in pepper and uses thereof | |
| CN114686614B (en) | KASP molecular marker for detecting pea leaf configuration and application thereof | |
| CN110724755B (en) | CAPS marker primer group linked with watermelon internode length and application thereof | |
| CN114164294B (en) | SNP locus related to green keeping property of Chinese cabbage and application thereof | |
| CN116640878B (en) | Molecular marker of wheat floret number QTL per spike developed based on novel mode of multi-single-combined-standard-evidence and application thereof | |
| CN111004858B (en) | Molecular marker primer of soybean single pod number major QTL (quantitative trait locus) locus and application thereof | |
| CN116694808A (en) | Specific SNP primer and method for identifying purity of Beijing-yan-Yu-sweet 156 cucumber variety | |
| CN117965783A (en) | KASP (KASP labeling) marker for melon sour character screening and application | |
| CN117248065A (en) | Molecular marker of total root tip number QNRT.caas-5D of wheat and application thereof | |
| CN117757973A (en) | Molecular marker related to drought resistance of tomatoes and application thereof | |
| CN117737294A (en) | Molecular marker and method for rapidly identifying purity of tomato winter rhyme hybrid seeds | |
| CN117402998A (en) | Molecular marker, primer and kit for length of capsicum fruits and application of molecular marker | |
| CN115786561A (en) | Molecular marker combination and method for predicting linalool content of peach fruit floral component |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |