CN117265140B - Burkholderia cepacia complex PCR detection primer and detection method thereof - Google Patents
Burkholderia cepacia complex PCR detection primer and detection method thereof Download PDFInfo
- Publication number
- CN117265140B CN117265140B CN202310506923.3A CN202310506923A CN117265140B CN 117265140 B CN117265140 B CN 117265140B CN 202310506923 A CN202310506923 A CN 202310506923A CN 117265140 B CN117265140 B CN 117265140B
- Authority
- CN
- China
- Prior art keywords
- detection
- burkholderia cepacia
- primer
- pcr
- cepacia complex
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 238000001514 detection method Methods 0.000 title claims abstract description 65
- 241000020730 Burkholderia cepacia complex Species 0.000 title claims abstract description 23
- 239000000523 sample Substances 0.000 claims abstract description 44
- 238000000034 method Methods 0.000 abstract description 33
- 241000589513 Burkholderia cepacia Species 0.000 abstract description 18
- 230000000694 effects Effects 0.000 abstract description 6
- 150000001875 compounds Chemical group 0.000 abstract description 4
- 239000012634 fragment Substances 0.000 abstract description 4
- 241000894007 species Species 0.000 abstract description 4
- 230000035945 sensitivity Effects 0.000 abstract description 3
- 238000003766 bioinformatics method Methods 0.000 abstract description 2
- 238000003752 polymerase chain reaction Methods 0.000 abstract 3
- 238000000137 annealing Methods 0.000 description 13
- 238000010586 diagram Methods 0.000 description 12
- 238000001179 sorption measurement Methods 0.000 description 10
- 238000006243 chemical reaction Methods 0.000 description 8
- 241000589517 Pseudomonas aeruginosa Species 0.000 description 6
- 239000007788 liquid Substances 0.000 description 6
- 241001453380 Burkholderia Species 0.000 description 4
- 239000002699 waste material Substances 0.000 description 4
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 3
- 239000000872 buffer Substances 0.000 description 3
- 238000002156 mixing Methods 0.000 description 3
- 201000003883 Cystic fibrosis Diseases 0.000 description 2
- 238000012408 PCR amplification Methods 0.000 description 2
- 241000192142 Proteobacteria Species 0.000 description 2
- 230000003321 amplification Effects 0.000 description 2
- 238000003556 assay Methods 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 238000003199 nucleic acid amplification method Methods 0.000 description 2
- 108020004707 nucleic acids Proteins 0.000 description 2
- 150000007523 nucleic acids Chemical class 0.000 description 2
- 102000039446 nucleic acids Human genes 0.000 description 2
- 238000005457 optimization Methods 0.000 description 2
- 238000003753 real-time PCR Methods 0.000 description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 2
- 206010053555 Arthritis bacterial Diseases 0.000 description 1
- 208000031729 Bacteremia Diseases 0.000 description 1
- 241000894006 Bacteria Species 0.000 description 1
- 102100025621 Cytochrome b-245 heavy chain Human genes 0.000 description 1
- 108010067770 Endopeptidase K Proteins 0.000 description 1
- 206010061598 Immunodeficiency Diseases 0.000 description 1
- 208000029462 Immunodeficiency disease Diseases 0.000 description 1
- 208000004575 Infectious Arthritis Diseases 0.000 description 1
- 206010048723 Multiple-drug resistance Diseases 0.000 description 1
- 239000003242 anti bacterial agent Substances 0.000 description 1
- 229940088710 antibiotic agent Drugs 0.000 description 1
- 230000001580 bacterial effect Effects 0.000 description 1
- 244000052616 bacterial pathogen Species 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 208000016532 chronic granulomatous disease Diseases 0.000 description 1
- 108091036078 conserved sequence Proteins 0.000 description 1
- 238000011109 contamination Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000007847 digital PCR Methods 0.000 description 1
- 231100000676 disease causative agent Toxicity 0.000 description 1
- 239000012149 elution buffer Substances 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 230000007813 immunodeficiency Effects 0.000 description 1
- 230000006698 induction Effects 0.000 description 1
- 208000015181 infectious disease Diseases 0.000 description 1
- 238000007689 inspection Methods 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 235000015097 nutrients Nutrition 0.000 description 1
- 206010034674 peritonitis Diseases 0.000 description 1
- 239000002244 precipitate Substances 0.000 description 1
- 238000001556 precipitation Methods 0.000 description 1
- 239000000047 product Substances 0.000 description 1
- 208000023504 respiratory system disease Diseases 0.000 description 1
- 201000001223 septic arthritis Diseases 0.000 description 1
- 238000010561 standard procedure Methods 0.000 description 1
- 239000006228 supernatant Substances 0.000 description 1
- 208000019206 urinary tract infection Diseases 0.000 description 1
- 239000000304 virulence factor Substances 0.000 description 1
- 230000007923 virulence factor Effects 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of biological detection, and particularly discloses a PCR (polymerase chain reaction) detection primer and a detection method for Burkholderia cepacia compound group. The invention firstly utilizes a bioinformatics method to analyze molecular biological information of 24 burkholderia cepacia and screens out a plurality of candidate sequence fragments specific to burkholderia cepacia; designing corresponding primers and probes according to the sequence fragments; the designed primer and probe are utilized to carry out actual detection on the Burkholderia cepacia complex, and a primer and probe system capable of specifically detecting the Burkholderia cepacia complex is finally obtained according to the actual detection effect. The PCR detection primer and the detection method for the Burkholderia cepacia complex can uniformly detect 24 species level members of the Burkholderia cepacia complex, and the method has the advantages of high accuracy, strong specificity and high sensitivity.
Description
Technical Field
The invention relates to the technical field of biological detection, in particular to a Burkholderia cepacia complex PCR detection primer and a detection method thereof.
Background
Burkholderia cepacia complex (Burkholderia cepacia complex, bcc) is a generic name for a class of bacteria of the beta subclass of the Proteobacteria phylum Proteobacteria having similar gram-negative, non-fermentative aerobic phenotypes and differences in genotype. By far, 24 BCC members have been named by classification. BCC can survive in a harsh, low nutrient environment. In recent years, BCC has been found to be an important causative agent of respiratory diseases such as bacteremia, urinary tract infection, septic arthritis, peritonitis, induction of cystic fibrosis (cystic fibrosis, CF) and chronic granulomatous disease, and can lead to high mortality in infected and immunodeficiency people. Because BCC has multiple virulence factors, natural bacteriostats and multiple drug resistances of antibiotics, it is also one of the important pathogenic bacteria that cause infections inside medical institutions and care institutions. The non-sterile product recall event due to BCC contamination is endless each year, so there is a need to conduct the examination and study of burkholderia cepacia complex population.
The 24 Burkholderia cepacia listed in the Chinese pharmacopoeia are required to be detected according to the clear requirements of the draft of the Burkholderia cepacia group inspection method of the Chinese pharmacopoeia. Because the number of Burkholderia cepacia in the Burkholderia cepacia compound group is large, if each strain is detected independently, the detection reagent and the workload are large, the operation is complex, and the time consumption is long. Therefore, there is a need to develop a high throughput rapid burkholderia cepacia complex assay.
The Chinese patent application number 202111216769.3 discloses a digital PCR detection kit of Burkholderia, which can accurately identify whether a sample contains DNA of Burkholderia cepacia, burkholderia melitensis and Burkholderia pseudomelitensis by using a primer and a probe set. However, the number of Burkholderia cepacia in the Burkholderia cepacia compound group is large, the PCR detection kit cannot ensure that 24 Burkholderia cepacia can be completely detected, and in the detection process, the Burkholderia cepacia possibly crosses with the Burkholderia cepacia and the Burkholderia pseudomeldonii, so that the detection result of the Burkholderia cepacia compound group is affected.
Disclosure of Invention
Aiming at the defects in the prior art, the invention aims to provide a PCR detection primer for Burkholderia cepacia complex and a detection method thereof, which can uniformly detect 24 species level members of the Burkholderia cepacia complex.
In order to achieve the aim of the invention, the invention adopts the following technical scheme:
in a first aspect, a burkholderia cepacia PCR detection primer is provided, wherein the primer is any one of a first set of PCR primers or a second set of PCR primers;
the sequences of the first set of PCR primers were:
Primer F：ATGCGCAATGCGATGACC
Primer R：ATTTCCGTGCGCTTGCT
Taqman probe：FAM-AACGGCACGCTCGCGAGCGG-BHQ1；
The sequences of the second set of PCR primers were:
Primer F：CGTACAAGGCCGCCGA
Primer R：AGCGCCTTCTTCATGTC
Taqman probe：FAM-TTCAAGAAGCCGCGCAAC-BHQ1。
Further, a first set of PCR primers is preferred.
In a second aspect, there is provided a method for detecting burkholderia cepacia complex using the above primer, the method comprising the steps of:
step 1, extracting DNA of a Burkholderia cepacia sample to be detected;
And 2, performing PCR amplification by using the DNA extracted in the step 1 as a template and using the first group of PCR primers or the second group of PCR primers, and judging that a sample with a Ct value of more than 30 is negative and a sample with a Ct value of less than or equal to 30 is positive.
Further, in step 2, the PCR reaction system is shown in the following table:
the reaction procedure was 95℃for 5min;95℃15s,60℃1min,40cycles.
The beneficial effects of the invention are as follows:
The PCR detection primer and the detection method for the Burkholderia cepacia complex can uniformly detect 24 species level members of the Burkholderia cepacia complex, and the method has the advantages of high accuracy, strong specificity and high sensitivity.
Drawings
FIG. 1 is a schematic diagram showing the detection result of a sample 123 8 9 11 23 using a first set of PCR primers (syto dye method, annealing temperature 60 ℃);
FIG. 2 is a schematic diagram showing the detection result of sample 123 8 9 11 23 using the second set of PCR primers (syto dye method, annealing temperature 60 ℃);
FIG. 3 is a schematic diagram showing the detection result of a sample 123 8 9 11 23 using a third set of PCR primers (syto dye method, annealing temperature 60 ℃);
FIG. 4 is a schematic diagram showing the detection result of sample 123 8 9 11 23 using the first set of PCR primers (syto dye method, annealing temperature 58 ℃);
FIG. 5 is a schematic diagram showing the detection result of sample 123 8 9 11 23 using the second set of PCR primers (syto dye method, annealing temperature 58 ℃);
FIG. 6 is a schematic diagram of sample 12 3 8 9 11 23 using the first set of PCR primer (syto dye method, annealing temperature 62 ℃) assay;
FIG. 7 is a schematic diagram showing the detection result of sample 123 8 9 11 23 using the second set of PCR primers (syto dye method, annealing temperature 62 ℃);
FIG. 8 is a schematic diagram showing the detection result of sample 12 36 78 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 using the first set of PCR primers (syto dye method);
FIG. 9 is a schematic diagram showing the detection result of a sample 12 36 78 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 by using a first set of PCR primers (Taqman probe method);
FIG. 10 is a schematic diagram showing the detection result of a sample 24 25 26 27 28 29 30 31 by using a first set of PCR primers (Taqman probe method);
FIG. 11 is a schematic diagram showing the detection result of a sample 32 33 34 37 38 39 40 41 by using a first set of PCR primers (Taqman probe method);
FIG. 12 is a schematic diagram showing the detection result of the sample 35 36 by using the first set of PCR primers (Taqman probe method).
Detailed Description
The following description of the embodiments of the present invention is provided to facilitate understanding of the present invention by those skilled in the art, but it should be understood that the present invention is not limited to the scope of the embodiments, and all the inventions which make use of the inventive concept are protected by the spirit and scope of the present invention as defined and defined in the appended claims to those skilled in the art.
Example 1 extraction of genomic DNA
DNA was extracted according to the standard method of commercial kits, and the specific procedures are as follows:
① 1mL of bacterial liquid is weighed, added into a 1.5mL centrifuge tube, centrifuged to remove supernatant, 200 mu L of buffer GA is added, and the mixture is vibrated until uniform mixing;
② Adding 20 mu L of proteinase K solution, uniformly mixing, carrying out enzymolysis for 15min at 70 ℃, and reversing the mixed sample for 2-3 times during the enzymolysis;
③ 200. Mu.L of buffer GB was added, mixed well upside down, the solution was cleared and centrifuged briefly to remove water droplets from the inner wall of the tube cap.
④ Adding 200 mu L of absolute ethyl alcohol, fully oscillating and uniformly mixing for 15 seconds, wherein flocculent precipitation possibly occurs at the moment, and centrifuging briefly to remove water drops on the inner wall of the tube cover;
⑤ Adding the solution obtained in the last step and flocculent precipitate into an adsorption column CB3 (the adsorption column is placed into a collecting pipe), centrifuging at 12000rpm (13400 g) for 30 seconds, pouring out waste liquid, and placing the adsorption column CB3 into the collecting pipe;
⑥ Adding 500 mu L buffer GD (before use, checking whether absolute ethyl alcohol is added or not) into an adsorption column CB3, centrifuging at 12000rpm (13400 g) for 30 seconds, pouring out waste liquid, and placing the adsorption column CB3 into a collecting tube;
⑦ 600 μl of rinse solution PW (checked for the presence of absolute ethanol before use) was added to the column CB3, centrifuged at 12000rpm (13400 g) for 30 seconds, the waste liquid was decanted, and the column CB3 was placed in a collection tube;
⑧ Repeating the operation step 7;
⑨ The adsorption column CB3 was returned to the collection tube, and centrifuged at 12000rpm (. About.13400 g) for 2min to discard the waste liquid. Placing the adsorption column CB3 at room temperature for a plurality of minutes to thoroughly dry the residual rinsing liquid in the adsorption material;
⑩ Transferring the adsorption column CB3 into a clean centrifuge tube, suspending and dripping 50-200 mu L of elution buffer TE into the middle part of the adsorption film, standing at room temperature for 2-5min, centrifuging at 12000rpm (13400 g) for 2min, collecting the solution into the centrifuge tube, and storing at-20 ℃ to obtain the template for the next nucleic acid detection.
Example 2 PCR amplification detection
2.1PCR primer design:
PCR primers were designed based on the conserved gene sequence information obtained at 9.15 of 2022. The base sequence with the highest repetition number in all strains is selected, and the 3' -end of the primer is kept free from base mismatch as much as possible.
1) First set of PCR primers
ATGCGCAATGCGATGACCACGAACGGCACGCTCGCGAGCGGCAACCG CTACGCGATCGTCGGCATCGCCGAGTACGCGCTCAGCAAGCGCACGGAAA T(SEQ ID NO.1)
Primer F：ATGCGCAATGCGATGACC
Primer R：ATTTCCGTGCGCTTGCT
Taqman probe：FAM-AACGGCACGCTCGCGAGCGG-BHQ1。
2) Second set of PCR primers
CGTACAAGGCCGCCGACTTCAAGAAGCCGCGCAACCTGATCGGCCTG CAGAAGACGCTGCCCGATGCCGACATGAAGAAGGCGCT(SEQ ID NO.2)
Primer F：CGTACAAGGCCGCCGA
Primer R：AGCGCCTTCTTCATGTC
Taqman probe：FAM-TTCAAGAAGCCGCGCAAC-BHQ1。
3) Third set of PCR primers
CGTGTCGATCTACAACATCTCCGCATGGGGCAGCGGTTATGCGATCCACCAGGGCGACTTCGACCGCTTCAACGGCGACCGCCTGCCGAATTCGGTGAAGTTCCTGTCGAACGACCTCAGCGGCTTCAAGTTCGGCGCGATGTACTCGT TCGGCAACGTCGC(SEQ ID NO.3)
Primer F：CGTGTCGATCTACAACAT
Primer R：GCGACGTTGCCGAAC
Taqman probe：FAM-CAGGGCGACTTCGACCG-BHQ1。
2.2PCR reaction System:
The PCR reaction system is shown in Table 1 below. The total volume of the reaction was 25. Mu.L, in which the nucleic acid template was 2. Mu.L. The real-time PCR reaction is carried out on QuantStudioTM real-time PCR instrument, and the reaction program is 95 ℃ for 5min;95℃15s,60℃1min,40cycles.
TABLE 1PCR reaction System
Example 3 optimization of PCR primers and annealing temperature
The strain from accession number 123 8 9 11 23 in Table 2 was selected for PCR detection (syto dye method) at an annealing temperature of 60 ℃. As a result, the first set of PCR primers and the second set of PCR primers can detect 123 8 9 11 # strain, the detection signal of 23 # pseudomonas aeruginosa is weaker, the Ct value is larger than 35 (shown in figures 1-2), but the third set of PCR primers can not completely detect the strain (shown in figure 3), which indicates that the first set of PCR primers and the second set of PCR primers can be used for detecting Burkholderia cepacia complex, and the third set of PCR primers can not be used for detecting Burkholderia cepacia complex.
In order to select the primer with the optimal detection effect and the optimal annealing temperature in the two groups of primers, the embodiment of the invention has the following design.
The strain numbered 123 48 9 11 23 in table 2 was selected for PCR detection (syto dye method) and the annealing temperatures of the first and second set of primers PCR reactions were optimized. FIGS. 1,4 and 6 show that the first set of PCR primers has a high reaction rate and a weak detection signal of Pseudomonas aeruginosa No. 23 at 60 ℃. FIGS. 2, 5 and 7 show that the second set of PCR primers had a higher amplification rate at 58℃but the No. 23 Pseudomonas aeruginosa had a detection signal, and the second set of PCR primers had a lower amplification rate at 60℃and the No. 23 Pseudomonas aeruginosa had no detection signal. The results show that the detection effect is optimal when the annealing temperature of the first group of primers is 60 ℃. Thus, this condition was used for strain detection in the experiments thereafter.
Example 4, syto comparison of detection Effect of dye method and Taqman Probe method
Based on the PCR primers and the annealing temperature optimization results in example 3, the strain of Table 2, which was self-numbered 12 36 7 89 10 11 12 13 14 15 16 17 18 19 20 21 22 23, was selected to be subjected to PCR detection using the first set of PCR primers (syto dye method and Taqman probe method, respectively).
As shown in FIG. 8, the result of syto dye method shows that other strains have detection signals except that the No. 23 Pseudomonas aeruginosa has no detection signal or weak detection signal, and Ct values are smaller than 24. The results of Taqman probe method are shown in FIG. 9, and other strains have detection signals except that the No. 23 Pseudomonas aeruginosa has no signal or very weak signal, and Ct values are smaller than 22.
The results show that compared with syto dye method, the Taqman probe method has better detection effect, so that the Taqman probe method is adopted for strain detection in the later experiments.
Example 5 detection results of Taqman Probe method
The strain numbered 24-41 in Table 2 was tested by Taqman probe PCR (first set of PCR primers) and the results are shown in FIGS. 10-12, wherein the Ct values of the strains numbered 37, 38, 39, 40, 41 were more than 30 and the Ct values of the other strains were less than 24.
Based on the above detection data, the detection results are summarized in table 2 below:
TABLE 2 Strain information and PCR detection results
According to the detection result, a sample with a Ct value greater than 30 can be judged as negative; samples with Ct value of 30 or less were judged to be positive.
The invention firstly utilizes a bioinformatics method to analyze molecular biological information of 24 burkholderia cepacia and screens out a plurality of candidate sequence fragments specific to burkholderia cepacia; designing corresponding primers and probes according to the sequence fragments; the designed primer and probe are utilized to carry out actual detection on the Burkholderia cepacia complex, and a primer and probe system capable of specifically detecting the Burkholderia cepacia complex is finally obtained according to the actual detection effect.
The PCR detection primer and the detection method for the Burkholderia cepacia complex can uniformly detect 24 species level members of the Burkholderia cepacia complex, and the method has the advantages of high accuracy, strong specificity and high sensitivity.
It will be evident to those skilled in the art that the invention is not limited to the details of the foregoing illustrative embodiments, and that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive, the scope of the invention being indicated by the appended claims rather than by the foregoing description, and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein.
Furthermore, it should be understood that although the present disclosure describes embodiments, not every embodiment is provided with a separate embodiment, and that this description is provided for clarity only, and that the disclosure is not limited to the embodiments described in detail below, and that the embodiments described in the examples may be combined as appropriate to form other embodiments that will be apparent to those skilled in the art.
Claims (1)
1. The PCR detection primer and the probe for the Burkholderia cepacia complex are characterized in that the sequences of the PCR detection primer and the probe are as follows:
Primer F：ATGCGCAATGCGATGACC；
Primer R：ATTTCCGTGCGCTTGCT；
Taqman probe：FAM-AACGGCACGCTCGCGAGCGG-BHQ1。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310506923.3A CN117265140B (en) | 2023-05-05 | 2023-05-05 | Burkholderia cepacia complex PCR detection primer and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310506923.3A CN117265140B (en) | 2023-05-05 | 2023-05-05 | Burkholderia cepacia complex PCR detection primer and detection method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN117265140A CN117265140A (en) | 2023-12-22 |
| CN117265140B true CN117265140B (en) | 2024-08-27 |
Family
ID=89218400
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310506923.3A Active CN117265140B (en) | 2023-05-05 | 2023-05-05 | Burkholderia cepacia complex PCR detection primer and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117265140B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113699257A (en) * | 2021-08-18 | 2021-11-26 | 上海市食品药品检验研究院 | Specificity detection target spot and constant temperature detection method of Burkholderia cepacia complex |
| CN113755619A (en) * | 2021-10-19 | 2021-12-07 | 中国医学科学院北京协和医院 | Digital PCR detection kit for Burkholderia |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB2362212A (en) * | 1998-09-03 | 2001-11-14 | Univ British Columbia | Method for the identification and speciation of bacteria of the burkholderia cepacia complex |
| CN101838705A (en) * | 2010-02-04 | 2010-09-22 | 浙江大学 | Method for detecting burkholderia cepacia flora on fruits or vegetables and identifying seeds |
| CN115992274A (en) * | 2022-11-08 | 2023-04-21 | 杭州微数生物科技有限公司 | Primer probe for detecting BCC through fluorescent quantitative PCR (polymerase chain reaction), design method and kit thereof |
-
2023
- 2023-05-05 CN CN202310506923.3A patent/CN117265140B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113699257A (en) * | 2021-08-18 | 2021-11-26 | 上海市食品药品检验研究院 | Specificity detection target spot and constant temperature detection method of Burkholderia cepacia complex |
| CN113755619A (en) * | 2021-10-19 | 2021-12-07 | 中国医学科学院北京协和医院 | Digital PCR detection kit for Burkholderia |
Also Published As
| Publication number | Publication date |
|---|---|
| CN117265140A (en) | 2023-12-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Vinjé et al. | Simultaneous detection and genotyping of “Norwalk-like viruses” by oligonucleotide array in a reverse line blot hybridization format | |
| Kim et al. | Heterogeneity of vaginal microbial communities within individuals | |
| Svenstrup et al. | Development of a quantitative real-time PCR assay for detection of Mycoplasma genitalium | |
| Bi et al. | Rapid prenatal diagnosis using uncultured amniocytes and oligonucleotide array CGH | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN101886138A (en) | Three-color fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) combined detection method of enterovirus 71, Coxsackie virus A16 and other subtypes of enterovirus as well as kit thereof | |
| CN113502352B (en) | EMA-ddPCR primer and probe for detecting infectious ASFV and application | |
| US20190048393A1 (en) | Method for qualitative and quantitative detection of microorganism in human body | |
| CN104846122A (en) | Nucleic acid detection kit of enterovirus type 71 (EV71) and coxsackievirus type A16 (CA16) (fluorescent polymerase chain reaction (PCR) method) | |
| Payne et al. | High-resolution melt PCR analysis for genotyping of Ureaplasma parvum isolates directly from clinical samples | |
| CN111793704B (en) | SNP molecular marker for identifying Brucella vaccine strain S2 and wild strain and application thereof | |
| CN107365869B (en) | Method and primer for detecting Klebsiella pneumoniae by loop-mediated isothermal amplification technology | |
| CN105886663A (en) | Locked nucleic acid sensitivity-enhanced fluorescent quantitative PCR (polymerase chain reaction) detection reagent kit for wild strains of porcine pseudorabies viruses | |
| TWI362419B (en) | Nucleic acid detection | |
| CN101381767B (en) | Universal real time fluorescent PCR detection method of trichinella | |
| CN104342487B (en) | Mycoplasma nucleic acid constant-temperature amplification method | |
| CN117265140B (en) | Burkholderia cepacia complex PCR detection primer and detection method thereof | |
| CN111961763A (en) | Novel gene chip for detecting coronavirus | |
| CN108486228B (en) | Fluorescent quantitative PCR detection kit for pre-judging sepsis infection condition and method thereof | |
| CN1814788A (en) | Waters frequent food born pathogenic hacteria multiple PCR rapid detecting kit and its detecting method | |
| CN113564271A (en) | Primer probe set for pathogenic bacterium typing quantitative detection, kit and sample purification method | |
| CN106048051A (en) | Candida krusei fluorescence PCR detection kit | |
| CN110423799A (en) | A kind of helicobacter pylori lavo-ofloxacin Drug Resistance Detection method | |
| CN114836581B (en) | Primer combination for detecting pathogens of digestive tract infectious diseases | |
| Lin et al. | Performance of metagenomic next-generation sequencing in cerebrospinal fluid for diagnosis of tuberculous meningitis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |