CN117264999B - Application of NtUGT A1L1 gene in tobacco cold resistance - Google Patents

Abstract

The invention discloses an application of NtUGT A1L1 genes in cold resistance of tobacco, belonging to the technical field of genetic engineering. The invention discloses an application of NtUGT A1L1 genes in cold resistance of tobacco, which takes Hunan tobacco No. 7 as a background and obtains 2 knocked-out lines of the genes by using a CRISPR technology. Phenotypic characterization showed that both knockout lines wilt more severely than WT under low temperature stress. Biochemical results show that MDA, H ₂O₂ and OFR contents in the leaves of the knocked-out strain under low-temperature stress are significantly higher than those of WT, and SP, PRO and GSH contents are significantly lower than those of WT. DAB and NBT staining results indicate that leaves of the two knockout lines stain significantly deeper than WT under low temperature stress. The result shows that NtUGT A1L1 gene positively regulates the cold resistance of tobacco.

Description

Application of NtUGT A1L1 gene in tobacco cold resistance

Technical Field

The invention relates to the technical field of genetic engineering, in particular to an application of NtUGT A1L1 genes in tobacco cold resistance.

Background

Tobacco (Nicotiana tabacum l.) is an important commercial crop native to tropical and subtropical regions, and is extremely vulnerable to low temperature damage, low temperature stress being one of the major environmental factors limiting tobacco growth, quality and yield. The tobacco seedling stage is more obvious to low-temperature stress, and when the tobacco is 6-7 years old, if the tobacco is subjected to low-temperature stress of about 12 ℃ for two weeks, the tobacco can bloom early, and the yield and quality of the tobacco are reduced, so that income of tobacco farmers is reduced, and great loss is caused to the tobacco industry. At present, a molecular biotechnology means is utilized to excavate low temperature resistant genes of tobacco, a molecular marker is developed, the main cultivated variety is directionally improved, and the cultivation of new low temperature resistant tobacco variety is an important way for solving the problem.

Numerous studies have shown that abiotic stress can lead to accumulation of Reactive Oxygen Species (ROS), mainly hydrogen peroxide (H ₂O₂), superoxide anion radicals (O ₂ ^.-), alkoxy Radicals (RO), etc., and that accumulation of excess reactive oxygen species leads to peroxidation of membrane lipids, production of large amounts of Malondialdehyde (MDA), which reacts with proteins on the membrane, causing cell membrane damage, resulting in increased membrane permeability and ion leakage. Soluble proteins are one of important osmotic adjusting substances, and rapidly accumulate when plants respond to low-temperature stress so as to increase the concentration of cell fluid, maintain the osmotic balance of cell membranes, enhance the water retention capacity of cells and improve the cold resistance of plants. Proline is another important class of osmoregulating substances that plants accumulate during cold forging. Under normal growth conditions, the proline content in plants is usually not high, but after supercooling exercise, proline accumulates in large amounts to prevent damage to plants by osmotic stress. Reduced glutathione is one of the most effective scavengers of peroxides produced during intracellular metabolic processes and when plants are subjected to oxidative stress.

Glycosyltransferases (Glycosyltransferases, GTs) are a superfamily of enzymes widely found in animals, plants, fungi and bacteria, whose primary function is to catalyze the transfer of a donor's glycosyl to a receptor and form a glycosidic bond between the glycosyl and the receptor. Depending on the glycosylation site of the acceptor molecule, glycosyltransferases can be divided into four classes, O-GT, N-GT, C-GT and S-GT, respectively, and most of the plant glycosyltransferases studied at present belong to O-GT, such as UGT89C1 of Arabidopsis thaliana and UGT71G1 of medicago truncatum. Depending on the manner in which the protein is folded, glycosyltransferases can be divided into three superfamilies, GT-A, GT-B or GT-C. The main catalytic object of the GT-A family is uridine diphosphate glucose (UDP-glucose), which can transfer glycosyl groups to a wide range of receptor molecules and is therefore also known as UDP-glycosyltransferases (UDP-glycosyltransferases, UGTs).

At present, functional studies on glycosyltransferases have been mainly focused on arabidopsis thaliana, and few reports have been made on crops such as tobacco, tomato, rice, and the like. The research shows that glycosyltransferase plays an important role in plant secondary metabolic pathway, plant homeostasis regulation, adverse stress response and the like. For example, the Arabidopsis UGT71C5 and UGT75B1 genes can catalyze ABA to form ABA-glucose ester (ABA-GE), the ABA content in the over-expression strain is reduced, the ABA-GE is increased, drought sensitivity is shown, and the drought tolerance of the gene mutant strain is obviously enhanced. Glycosyltransferases also play an important role in regulating flavonoid metabolism and enhancing plant resistance to abiotic stress. The research shows that the Arabidopsis UGT79B2/B3 can glycosylate procyanidine and anthocyanin, the anthocyanin accumulation amount in the over-expression strain is higher than that of the wild type, and the abiotic stress resistance of the strain is obviously higher than that of the wild type. In addition, corn UFGT2 increases flavone content through glycosylation modification of kaempferol and quercetin, and enhances salt tolerance and drought tolerance of plants. Rice UGT83A1 catalyzes the glycosylation of lignin precursor materials and flavonoids, and the over-expression strain thereof has obviously enhanced resistance to salt stress, drought and cold injury.

Therefore, providing the use of NtUGT A1L1 gene in tobacco cold tolerance is a problem that one skilled in the art would need to solve.

Disclosure of Invention

In view of this, the present invention provides the use of NtUGT A1L1 gene in tobacco cold tolerance.

The early stage of the project group carries out transcriptomics and metabonomics combined analysis and gene co-expression network analysis on two tobacco varieties (low temperature resistant variety Xiang tobacco No. 7 and low temperature sensitive variety Tai tobacco No. 8) and digs a candidate gene NtUGT A1L1 responding to low temperature stress. On the basis, the invention carries out function identification on the gene, analyzes the gene function and provides gene resources and theoretical basis for low-temperature resistant molecular breeding of tobacco.

In order to achieve the above purpose, the present invention adopts the following technical scheme:

The application of NtUGT90A1L1 gene in tobacco cold tolerance, wherein the amino acid sequence coded by NtUGT90A1L1 gene is shown as SEQ ID NO. 2.

Furthermore, the application of the NtUGT A1L1 gene knockout in negative regulation of tobacco cold resistance is disclosed, and the amino acid sequence encoded by the NtUGT A1L1 gene is shown as SEQ ID NO. 2.

Further, the application of the biological material for knocking out NtUGT A1L1 gene expression in the aspect of negative regulation of tobacco cold resistance is that the biological material is any one of the following:

a: an expression cassette capable of silencing NtUGT A1L1 gene having a nucleotide sequence shown as SEQ ID NO. 1;

B: a recombinant vector comprising the expression cassette of a;

C: a recombinant microorganism comprising the expression cassette of A or the recombinant vector of B.

Further, the application of the biological material for improving NtUGT A1L1 gene expression in the aspect of cold resistance of tobacco is improved, wherein the biological material is any one of the following:

A: an expression cassette capable of over-expressing NtUGT A1L1 gene with a nucleotide sequence shown as SEQ ID NO. 1;

B: a recombinant vector comprising the expression cassette of a;

C: a recombinant microorganism comprising the expression cassette of A or the recombinant vector of B.

Low temperature stress can lead to tobacco flowering in advance, severely affecting tobacco yield and quality. The method has the advantages of digging the low temperature resistant gene of the tobacco and analyzing the regulation mechanism, and has important significance for cultivating new low temperature resistant varieties. In the early stage of the study, a candidate gene which is obviously induced by low temperature is mined from the transcriptome and metabonomics of tobacco leaves under low temperature stress, the CDS sequence length of the gene is 1386bp, and UDP-glycosyltransferase (UDP-glycosyltransferase 90A 1-like) with 461 amino acids is encoded, so that the gene is named NtUGT A1L1.

Compared with the prior art, the invention discloses application of NtUGT A1L1 genes in tobacco cold resistance, and 2 knocked-out strains ugt a 90 1L1-9 and ugt A1L1-11 of the genes are obtained by using CRISPR technology with Hunan tobacco No. 7 as a background. Phenotypic identification shows that the two knockout lines wilt more severely under low temperature stress than Hunan tobacco No. 7 (WT). Biochemical results show that Malondialdehyde (MDA), hydrogen peroxide (H ₂O₂) and superoxide anions (OFR) contents in leaves of the knockout line are significantly higher than those of WT and that of Soluble Proteins (SP), proline (PRO) and Glutathione (GSH) are significantly lower than those of WT under low-temperature stress. DAB and NBT staining results indicate that leaves of the two knockout lines stain significantly deeper than WT under low temperature stress. The result shows that NtUGT A1L1 gene positively regulates the cold resistance of tobacco. The gene excavation and function identification provide important gene resources and theoretical basis for low temperature resistant breeding of tobacco.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the embodiments or the description of the prior art will be briefly described below, and it is obvious that the drawings in the following description are only embodiments of the present invention, and that other drawings can be obtained according to the provided drawings without inventive effort for a person skilled in the art.

FIG. 1 is a diagram of a NtUGT A1L1 phylogenetic tree analysis of the present invention;

FIG. 2 is a schematic diagram showing the alignment of NtUGT A1L1 proteins according to the present invention;

FIG. 3 is a diagram showing sequence alignment and peak pattern analysis near a target point of the present invention;

FIG. 4 is a diagram showing alignment of NtUGT A1L1 protein sequences in a knockout line and WT according to the present invention;

FIG. 5 is a graph showing the phenotypic analysis of the present invention after 24h of low temperature (4 ℃ C.) treatment;

Wherein, before: before low-temperature treatment; after: after 24 hours of low-temperature treatment;

FIG. 6 is a graph showing the analysis of the change of the physiological and biochemical indicators after the low-temperature treatment according to the present invention;

Wherein A: MDA content; b: h ₂O₂ content; c: OFR content; d: SP content; e: PRO content; f: GSH content; each set of values is the mean ± standard deviation of 5 biological replicates; * And P <0.05 and P <0.01 (t-test) at the same treatment, respectively, are significantly different;

FIG. 7 is a graph showing the results of DAB and NBT staining of ugt a1l1-9 and ugt a1l1-11 knockout lines of the invention with WT plants under normal conditions and under low temperature stress;

wherein A: DAB; b: NBT.

Detailed Description

The following description of the embodiments of the present invention will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Example 1 Gene sequence profiling

The UGT90A1 protein sequence is derived from National Center for Biotechnology Information website(http://www.ncbi.nlm.nih.gov/BLAST/),NtUGT90A1L1 CDS and has the sequence shown in SEQ ID NO. 1; the NtUGT A1L1 protein sequence is shown as SEQ ID NO. 2.

NtUGT90A1L1 CDS sequence:

ATGGCTTCTCCTCCTTGTATTCATGTTGTTCTGTTCCCTTTCATGTCCAAAGGCCACACAATTCCCATCTTCGACCTTGCTCGCATTCTTCTCAATCGCAAAATTGCCATCACCATTTTCACCACTCCTGCAAATCGCCCTTTCTTCTCCAAATCTCTTTCTAACACAAACATAAATATCATCGACATCCCTTTTCCTGAAAATATAGAAGGAATTCCCCCAGGTGTGGAAAGTACTGATAAACTTCCTTCCATGTCACTTTTTGTTACCTTTGCTAACGCCACCAAATCTATGAAACCCCAGTTCGAACAAGCCTTAGAATCTCTTCCGCCAGTTACTTTCATGGTCACTGATGGCTTCCTCGGGTGGACTTTAGACTCTGCAAATAAATTTGGTATCCCAAGAATAGCTTATTACGGCATGAGCGCATTTTCCTCGGCCATATCGCATTCAGCTGCTTCAGTTCTTCACACAGAAGCGTCCGACGACGAGCCTTTTGCAGTCCCTAATTTCCCTTCGATTAAACTCACTAGAAATGATTTTGATTTTCCCTTCAGAGAGCGTGAACCAAAGGGTCCCATTTTCGAGTTCACCACGGAGGCAATCATAGCAACCTCTAAAAGCTATGGTCTACTTGTGAACAGCTTTTACGAGCTTGAATCTATTTATGTAGACTACTGTAACCGTACATCTAGTCCTAGAAAAGTGTGCGTCGGACCATTTTGTGCAGCGGTCGAACCACCAAAAGAACAACAGGAGAAGCCTTCATACATCAAATGGCTTGATGAAATGTTAGAACAGGGGAAGCCAGTTTTGTATGTTGCATTCGGGTCACAAGCTGAACTATCTCCTGAACAATTCAAGGAAATCAAAATTGGGTTGGAGAAATCTGAAGTTAACTTTTTTTGGGTAGTCAGGAGAAGCGCTATAAGTGAACCCAATGAAGAGTTCGAAAACAGAGTAAAAAACAGGGGACTGGTGGTTGCAGAGTGGGTTGATCAAAGACAAATCTTGAGCCACGGGAGCGTTCAAGGTTTCTTAAGTCACTGCGGTTGGAACTCGGTAATAGAGAGCATATGCGCAGAGGTGCCAATACTAGCATGGCCAATGATGGCGGAGCAACACCTAAATGCAAGGATGGTAGTGGAGGAAATCAAGATTGGACTAAGGGTCGAGACTTGCGATGGGTCAGTGAGAGGGTTCGTGAAGTGGGAAGGTTTGGAAAAGCCGATAAGGGAATTAATGGAAGGAGAGAAAGGTAAAGAGGCAAAGAAGAAAGTGAAGGAGATTTGTGAAGCAGCCATTAATGCAGTCAAAGACGGGGGAACATCATGGCAAGCGTTAAATGAGCTTATTCATGAGTTAAGTGGAAGAGGACAAGTTTGA;SEQ ID NO.1.

NtUGT90A1L1 protein sequence:

MASPPCIHVVLFPFMSKGHTIPIFDLARILLNRKIAITIFTTPANRPFFSKSLSNTNINIIDIPFPENIEGIPPGVESTDKLPSMSLFVTFANATKSMKPQFEQALESLPPVTFMVTDGFLGWTLDSANKFGIPRIAYYGMSAFSSAISHSAASVLHTEASDDEPFAVPNFPSIKLTRNDFDFPFREREPKGPIFEFTTEAIIATSKSYGLLVNSFYELESIYVDYCNRTSSPRKVCVGPFCAAVEPPKEQQEKPSYIKWLDEMLEQGKPVLYVAFGSQAELSPEQFKEIKIGLEKSEVNFFWVVRRSAISEPNEEFENRVKNRGLVVAEWVDQRQILSHGSVQGFLSHCGWNSVIESICAEVPILAWPMMAEQHLNARMVVEEIKIGLRVETCDGSVRGFVKWEGLEKPIRELMEGEKGKEAKKKVKEICEAAINAVKDGGTSWQALNELIHELSGRGQV;SEQ ID NO.2.

gene homology was analyzed using MEGA7.0 software and a evolutionary tree was constructed using the orthotopic merge method (NJ). Phylogenetic tree analysis found that NtUGT A1L1 was closest to Nicotiana villosa NtoUGT A1L (XP_ 009592995.1) (FIG. 1).

Protein similarity alignment was performed using DNAMAN software. The protein sequence has a typical UDPGT structural domain and has high homology with Nicotiana villosa NtoUGT A1L and Nicotiana aculeata NaUGT A1 of gradually-reduced She Yesheng (figure 2).

Example 2NtUGT A1L1 functional identification in tobacco Cold resistance

1) Gene editing vector construction

(1) Target design

Targets were designed on gene exons using http:// crispor.tefor.net/on-line analysis tool, and analyzed to obtain the following 2 specific targets:

Target1：GGTCGAAGATGGGAATTGTGTGG；SEQ ID NO.3；

Target2：AGAAGGAATTCCCCCAGGTGTGG；SEQ ID NO.4。

further, CRSIPR vector construction primers are designed, and the sequence information is as follows:

F1(+):cagtGGTCTCatgcaGGTCGAAGATGGGAATTGTG；SEQ ID NO.5；

R1(-):cgatGGTCTCaaaacCACCTGGGGGAATTCCTTCT；SEQ ID NO.6。

(2) PCR amplification

A50. Mu.L PCR reaction system (Table 1) was prepared and the amplification reaction was performed according to the procedure of Table 2.

The synthesized DNA is used as a template, and the sequence of the template is shown as SEQ ID NO. 7.

GGTCGAAGATGGGAATTGTGgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCAAGAAGGAATTCCCCCAGGTG;SEQ ID NO.7.

TABLE 1 PCR reaction system

Table 2 PCR reaction procedure

The target fragment (about 200 bp) was recovered by gel, DNA was recovered by dissolving it in water in a total volume of 30. Mu.L, and ligated with the vector after detection.

(3) Enzyme cutting connection

The cleavage ligation system and the reaction conditions are shown in tables 3 and 4.

Table 3 enzyme digestion ligation system

TABLE 4 cleavage ligation reaction conditions

(4) Transformation and identification

Coli competent (Northenan, fast-T1, C505) was transformed with 5-10. Mu.L ligation product, for specific procedures.

Transformation was plated on LB plates containing 50. Mu.g/mL kanamycin resistance, and incubated at 37℃for 12 hours for colony PCR identification.

10 Single colonies were picked, cultured with LB to obtain bacterial solutions, and PCR was performed, and the identification system and the reaction conditions were as shown in tables 5 and 6.

Primer information is as follows:

F2：gtaaaacgacggccagt；SEQ ID NO.8；

R2：ccagaaattgaacgccgaag；SEQ ID NO.9。

the target band is a fragment of about 800 bp.

TABLE 5 colony PCR reaction System

Table 6 PCR reaction procedure

Selecting bacterial solutions corresponding to 1-3 positive strips, taking 100 mu L of bacterial solutions, carrying out sample feeding and sequencing, inoculating the rest 400 mu L of bacterial solutions into LB containing 5-10ml of kanamycin resistance, shaking a test tube, taking a tube corresponding to correct sequencing after the result of sequencing comes out, extracting plasmids, and storing the strains and plasmids.

2) Genetic transformation of tobacco

(1) Agrobacterium preparation

Mu.L of plasmid was added to 50. Mu.L of GV3101 Agrobacterium competent cells (for specific methods reference). Transformation was plated on LB plates containing 50. Mu.g/mL kanamycin resistance, and incubated at 28℃for 48h for colony PCR identification. Amplification primers, reaction system and reaction procedure were as above. The PCR product is detected by gel electrophoresis, and the positive control (taking the plasmid with correct sequencing as a template) of the electrophoresis result and the electrophoresis band of the sample are clear and correct in size, and the negative control (the template is water) has no band, so that the sample can enter the next step and can be used for infecting tobacco.

Single colonies were selected in liquid LB medium containing 25. Mu.g/mL rifampicin (rifampicin) and 100. Mu.g/mL kana (Km) antibiotic, and shaken at 28℃for 24h; the shaken bacterial solution was centrifuged at 4000r/min for 10min, and after discarding the supernatant, resuspended in an immersion buffer (10 mM 2- (N-morpholino) ethanesulfonic acid (MES) and 0.1mM acetosyringone with 10mM MgCl ₂, pH=5.2) and incubated at room temperature for 3h or more until the OD ₆₀₀ value was about 0.6 as an infection solution for further use.

(2) Genetic transformation of tobacco

The full and consistent tobacco seeds are selected, sterilized with 10% sodium hypochlorite solution for 15min, rinsed 5 times with sterile water, and slightly blotted dry with sterile absorbent paper, and sown on a medium of ms+sucrose 30 g/l+agar 8g/L (ph=5.8) at 4 grains/bottle. Placing into a constant temperature incubator with illumination at 25deg.C under the conditions of 1600lx illumination intensity and 16 hr (light)/8 hr (dark) light period for 45 days. After 4 leaves of the aseptic seedlings grow, cutting the aseptic seedlings into small blocks with the length of about 5mm by 5mm, and removing veins. After 2d of preculture in MS medium containing 2 mg/L6-BA and 0.2mg/L IAA, the medium was immersed in an Agrobacterium infection solution. The infected explants were dark cultured in MS medium containing 2 mg/L6-BA and 0.2mg/L IAA for 2d. After co-cultivation, 50mg/L kanamycin and 500mg/L carbenicillin were added to the medium for selection, and the production of resistant calli was induced, and the culture conditions were the same as above, and 1 time was passed for every 14 days. After the resistant buds on the callus grow to 2cm, the buds are transferred to a rooting medium (MS+50 mg/L kanamycin+500 mg/L carbenicillin+0.2 mg/L IAA), rooting is carried out for about 7 days, when the seedlings grow to about 6cm, the mouth of a culture flask is opened, and seedling hardening is carried out for 2 days. Then transplanting the seedlings into a special tobacco substrate (Tianliang agricultural technology development Co., ltd.) sterilized at high temperature, covering a plastic film for moisturizing, and carrying out illumination culture at 25-27 ℃.

3) Sequencing analysis of Positive seedlings

Extraction of positive Miao leaf genomic DNA Using Nanjinouzan Biotechnology Co., ltdPlant DNA Isolation Mini Kit (cat# DC 104-01) plant total DNA extraction kit, and the detailed method is described in the specification. PCR amplification was performed on the knocked-out material using Hi-Fi enzyme PRIMESTAR MAX DNA POLYMERASE from Bao Ri doctor Material technology (Beijing).

Primer sequence information is as follows:

UGT90A1L1-cri-F1：CGTGATTGTACAAGATTGTTGC；SEQ ID NO.10；

UGT90A1L1-cri-R1：AATCGAAGGGAAATTAGGGAC；SEQ ID NO.11。

the length of the target fragment is 717bp.

The amplification procedure and the amplification system are shown in tables 7 and 8.

TABLE 7PCR amplification procedure

TABLE 8PCR amplification System

The obtained PCR product was sequenced, and the sequencing peak map and sequence alignment analysis were performed using SNAPGENE VIEWER and DNAMAN, respectively.

NtUGT90A1L1 homozygous knockout strain material screening

From this, 2 successfully edited strains ugt a1l1-9 and ugt a1l1-11 were selected by sequencing analysis of 30 positive seedlings. And it was found that ugt90a1l1-9 had a deletion of one base at the target 2 position, ugt90a1l1-11 had a deletion of one base at both target 1 and target 2, respectively, and both were clean single peaks near the target, indicating that both strains were homozygous mutations (FIG. 3). The protein sequences were aligned to find that the translation of the NtUGT A1L1 protein was prematurely terminated in the ugt A1L1-9 and ugt A1L1-11 strains (FIG. 4), indicating that NtUGT A1L1 gene function was disrupted in both strains.

4) Knockdown strain cold tolerance identification

Selecting seeds of transgenic pure line plants and wild plants with plump and consistent sizes, sterilizing, and then placing the seeds at a low temperature of 4 ℃ for 48 hours. Then sowing the seeds in a small square box which is provided with special tobacco machine materials (Hunan Tianliang agricultural technology development Co., ltd.) in advance and fully absorbs water, covering a cover for heat preservation and moisture preservation, and incubating and sprouting in a greenhouse (the temperature is 25 ℃, the humidity is 75%, the 16h illumination and the 8h darkness). After 30d (six leaves and one heart period) sowing, selecting tobacco seedlings with consistent growth vigor, placing the tobacco seedlings into a 4 ℃ incubator for low-temperature treatment, observing the phenotype, and photographing and recording.

As shown in FIG. 5, the pre-low temperature treatment (0 h) knockout lines ugt a1l1-9 and ugt a1l1-11 were not significantly different from the Hunan tobacco No. 7 (WT) phenotype. After 24h of low temperature treatment at 4 ℃, the whole plant wilting phenomenon appears in the two knocked-out lines, while the WT leaves only show slight sagging, and no obvious change exists before the treatment. The results indicate that the ugt a1l1-9 and ugt a1l1-11 strains have significantly reduced cold tolerance compared to WT.

5) Determination of physiological and biochemical indexes of knockout strain

Tobacco seedlings subjected to low-temperature treatment in the incubator at 4 ℃ are subjected to physiological and biochemical index detection by taking a third leaf (from top to bottom) as a plant sample at three time points of 0h, 12h and 24h, and 5 biological repetitions are treated each. After sampling, the sample is wrapped by tinfoil and put into liquid nitrogen for preservation at-80 ℃. MDA, H ₂O₂ and OFR, PRO, SP, GSH content were measured.

The Malondialdehyde (MDA) content is measured by using a plant Malondialdehyde (MDA) test box (built in Nanjing, cat# A003-3-1);

The hydrogen peroxide content (H ₂O₂) is measured by a hydrogen peroxide test box (Nanjing built, cat# A064-1-1);

The superoxide anion capacity (OFR) is determined by using a superoxide anion (Oxygen FREE RADICAL, OFR) kit (Jiangsu Edison biosciences, product number: ADS-W-YH 008);

the Proline (PRO) content is determined by using a Proline (PRO) content test box (Suzhou Geruisi, cat# G0111W);

The Soluble Protein (SP) is measured by a protein quantification (TP) measuring kit (Nanjing built, cat# A045-2);

The measurement of the Glutathione (GSH) content was performed using a micro-reduced Glutathione (GSH) measurement kit (Nanjing built, cat. No. A006-2-1).

The specific method comprises the following steps: reference is made to the kit instructions.

Physiological and biochemical results showed that the MDA, H ₂O₂ and OFR (superoxide anions) contents in the knockdown lines ugt a1l1-9 and ugt a1l1-11 were not significantly different from those of WT under the control condition (0H), and the MDA, H ₂O₂ and OFR contents in the knockdown lines were significantly higher than that of WT after the low temperature stress treatment for 12H and 24H (FIG. 6A-C).

The knocked-out strain before low-temperature treatment (0 h) has no obvious difference with the content of Soluble Protein (SP), proline (PRO) and Glutathione (GSH) in the WT; after 12h and 24h of low temperature stress treatment, the SP and PRO contents in the two knockout lines are significantly lower than those of the WT; GSH was significantly lower in the knockdown lines than WT at 12h of low temperature stress treatment, with no significant differences after 24h of stress treatment (fig. 6D-F).

The tobacco seedlings subjected to the low-temperature treatment in the incubator at 4 ℃ are dyed by taking out leaves (inverted 5 leaves or inverted 6 leaves) at the same parts after 5d of treatment.

3,3' -Diaminobenzidine (DAB) staining: DAB was prepared at 0.1mg/ml and dissolved in 50mM Tris-acetate buffer (pH 5.0). The leaves were immersed in the staining solution and the room temperature was dark overnight. Removing staining solution, adding absolute ethanol, and bathing in boiling water for 10min (if chlorophyll is difficult to dehydrate, it can be longer). Finally, the leaves are transferred into absolute ethyl alcohol, photographed and observed under a microscope or a camera, and stored.

Nitrotetrazolium chloride (NBT) staining: NBT staining solution 1mg/mL was prepared and dissolved in 10mM PBS (pH 7.8). The leaves were cut out and placed in NBT staining solution, stained under light for 1-2 hours, and decolorized when the developed phenotype (blue leaves) was present. Removing staining solution, adding absolute ethanol, boiling in boiling water for 10min, preserving in 70% ethanol, and photographing under microscope or camera for observation.

ROS histochemical staining was performed on the knockdown strain subjected to the low temperature treatment of 4deg.C (5 d) with wild type. DAB is oxidized to brown pigment in the presence of H ₂O₂ and peroxidase. DAB staining results showed (FIG. 7A) that under normal Conditions (CK), there was no significant difference between the knockdown strain leaves and the WT leaves. The knockout lines ugt a1l1-9 and ugt a1l1-11 contained a larger area of reddish brown spots in the leaves after low temperature stress, indicating that the knockout lines accumulated more H ₂O₂ than the WT plants. The NBT staining results indicated that under normal Conditions (CK), the knockout strain leaves and WT leaves had slightly blue spots, but there was no significant difference between the strains. After low temperature treatment, the leaves of the knockdown lines ugt a1l1-9 and ugt a1l1-11 were stained more extensively and more extensively than the WT plants, indicating that the knockdown lines accumulated more superoxide anions (O ₂·^-) than the WT plants.

The result shows that knocking out NtUGT A1L1 gene can cause the increase of the ROS content of tobacco, the peroxidation of membrane lipid is aggravated, the contents of osmotic adjusting substances and antioxidant substances are reduced, and finally the low-temperature sensitivity is shown, so that NtUGT A1L1 plays a role in the positive regulation and control of the cold resistance process of tobacco.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims (2)

1. The application of the knock-out NtUGT90A1L1 gene in negative regulation of tobacco cold resistance is that the amino acid sequence encoded by the NtUGT90A1L1 gene is shown as SEQ ID NO. 2.

2. The application of the biological material for knocking out NtUGT A1L1 gene expression in the aspect of negative regulation of tobacco cold resistance is characterized in that the biological material is any one of the following:

a: an expression cassette capable of silencing NtUGT A1L1 gene having a nucleotide sequence shown as SEQ ID NO. 1;

B: a recombinant vector comprising the expression cassette of a;

c: a recombinant microorganism comprising the expression cassette of a or the recombinant vector of B;

the amino acid sequence coded by NtUGT A1L1 gene is shown as SEQ ID NO. 2.