CN117210492A - Application of transcription factor GmHdz4 gene in regulation and control of soybean pod traits - Google Patents

Abstract

The invention provides an application of a transcription factor GmHdz4 gene in regulating and controlling soybean pod traits. The invention constructs the transgenic soybean plant with the over-expression and the gene knockout of the transcription factor GmHdz4, and discovers that the inflorescence length of the transgenic soybean plant with the gene knockout of the transcription factor GmHdz4 is prolonged and the number of single flowers and pods is obviously increased by observing the soybean yield constitutional factors.

Description

Application of transcription factor GmHdz4 gene in regulation and control of soybean pod traits

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to application of a transcription factor GmHdz4 gene in regulating and controlling soybean pod traits.

Background

The soybean yield is determined by the number of plants per unit area, the number of pods per plant, the number of grains per pod and the grain weight. Scientists analyze the correlation of agronomic traits and yield of the soybean examined varieties in the middle China between 1950 and 2000 and indicate that the number of single plants contributes most to the yield. The variation range of the number of single plants of different soybean varieties can be from 30 to 200. The number of single plant pods is obviously positively correlated with the number of main stem nodes and flowering. Although populations were constructed using crosses of both the more and less pod varieties, targeting some QTL sites associated with pod numbers, these QTLs were almost distributed on 20 chromosomes of soybean (except H) with a significant percentage of contribution below 20%. Researchers found that expression of the GmCYP78A10 gene affects soybean pod numbers of a single plant, and other pod number related genes are not reported in soybeans except the GmCYP78A10 gene, which can be related to complex pod number characters and environmental influence.

The number of pods per plant is a very complex quantitative trait that is regulated by multiple factors, wherein the number of flower buds differentiated, the rate of successful fertilization of ovules and the rate of normal embryo development to pods after successful fertilization are the three stages that determine the number of pods. Quantitative trait locus mapping or whole genome association analysis clearly controls pod number genes as candidate genes for determining meristem size. The number of pods per plant is already determined in the process of shoot apex meristem development and inflorescence meristem differentiation formation. Wherein SHOOT MERISTEMLESS (STM) gene codes KNOTTED I Homeobox protein, which is protein necessary for the development of arabidopsis embryo to form stem tip meristem; shoot meristem develops from pluripotent stem cells, and the CLAVATA (CLV) -WUSCHEL (WUS) feedback signal pathway participates in SAM size regulation by controlling pluripotent stem cells. It was found that the HD-Zip III transcription factor interacts with type-BRRs and activates expression in combination with the WUS promoter, forming a CLV independent positive feedback regulatory pathway.

The Homeodomain-leucine zipper (HD-Zip) protein is a class of transcription factors specific to higher plants, and consists of 60 amino acids making up the Homeodomain (HD) and the Leucine Zipper (LZ) closely linked thereto making up its conserved domain. Plant HD-Zip transcription factors can be divided into four subclasses (HD-Zip I-IV), wherein HD-Zip I has been shown to play an important regulatory role in plant growth, development, morphogenesis, signal network and environmental stress in Arabidopsis, rice and sesame studies.

The rice OsSLI1 gene is induced by various abiotic stresses and exogenous abscisic acid, and proved to be a transcriptional activator (Huang X, duan M, liao J et al (2014) OsSLI1, a homeodomain containing transcription activator, involves abscisic acid related stress response in rice (Oryza sativa L.). Sci.world J.2014: 809353.) that regulates rice stress-responsive gene expression and panicle development. Barley SIX-ROWED SPIKE 1 (VRS 1) is the major regulatory gene for SPIKE number, its wild allele Vrs1.b encodes an HD-Zip I transcription repressor, specifically controls cell division and fertility of side SPIKEs (Komatsuda T, pourkheirandish M, he C et al (2007) Six-ROWED barley originated from a mutation in a homeodomain-leucobase zipper I-class homebox gene.Proc Natl Acad Sci USA 104:1424-1429; nadolska-Orczyk, A, rajchel IK, orczyk W et al (2017) Major genes determining yield-related traits in wheat and barley. Theor Appl Genet 130:1081-1098). Ectopic expression of the LeHB-1 gene in tomato (Solanum lycopersicum) interferes with the normal flowering process of transgenic plants and produces phenomena such as multi-flower, flower morphology change, abnormal transformation of sepals into the pericarp, and induction of fruit ripening (LinZ, hong Y, yin M (2008) A-bitmap HD-Zip homeobox protein, leHB-1,plays an important role in floral organogenesis and ripening.Plant J.55:301-310). Tomato overexpresses the grape HD-Zip I gene VvHB58, and transgenic tomato regulates fruit size, reduces seed number, and impedes fruit peel expansion through a variety of hormonal pathways (Li Y, zhang S, dong R et al (2019) The grapevine homeobox gene VvHB58 influences seed and fruit development through multiple hormonal signaling pathway.bmc Plant biol.19, 523). Genome-wide DNA methylation analysis showed that the HD-Zip I transcription factor GmHDZ20 gene was associated with soybean cotyledon frizzled, with GmHDZ20 expressed in Arabidopsis as altered rosette leaf morphology, shortened cone and reduced seed number per cone (Yang H, yang Z, mao Z et al (2021) Genome-wide DNA methylation analysis of soybean curled-cotyledons mutant and functional evaluation of a homeodomain-leucone zipper (HD-Zip) Igene GmHDZ20.Front Plant Sci.11: 593999).

Disclosure of Invention

The invention provides a new application of a transcription factor GmHdz4 gene in increasing soybean pod traits, and provides a reference basis for soybean germplasm resource innovation.

The specific technical scheme is as follows:

application of a transcription factor GmHdz4 gene in regulating soybean pod traits, wherein the nucleotide sequence of the GmHdz4 gene is shown as SEQ ID NO. 1; the pod traits are inflorescence length and single plant pod number.

SEQ ID NO.1：ATGAATCATCGACCACCTTTCCAAGACCACATGATGCTCATGTCTCAGTTATTCCCTGCTGATGCATACACTCAAATTATTTCTCAACAAGGAGAGACTAATAAGAAGCCAAGACGCCGTCGTAACAAGAAGAACAAAGGAGGAGAAAACGGTGCCTCGGAAGCCAACAAGAAGAGGAAGCTTAGTGAGGTGCAAGTTAATTTACTTGAACAAAACTTTGGAAATGAACGCAAACTTGAGTCCGAAAGAAAGGATAGGCTGGCAATGGAGCTTGGTTTGGACCCTCGACAAGTTGCTGTGTGGTTTCAAAACAGAAGAGCCCGTTGGAAGAACAAAAAGTTGGAAGAAGAGTACTCCAGCCTTAAAAAAAATCATGAAGCCACCTTGCTTGAGAAATGTTGCCTGGAGAGTGAGGTGTTGAAGCTCAAAGAGCAACTTTCTGAGGCAGAGAAAGAGATTCAGAGGCTGCTAGAGAGTGCCGAGAGAGTCCCAAGCAACAGTTCTAGTTCGTCACAGTCACAATCAATGGAAGCGGTGGACCCACCATTCTTTGGGGAATTTGGAGTTGATGGATATGAGGATGATGTGTTTTACGTGCCTGAGACCCATTACATCAACGGCATGGAATGGATTAATCTGTATATGCATCACCACCACCACCACTAA。

The regulation and control mode is as follows: the length of inflorescences of soybeans is prolonged and the number of flowers and pods of a single plant is increased by knocking out GmHdz4 gene,

further, the genetically engineered bacterium comprises a CRISPR/Cas9 vector edited by a GmHdz4 gene; the nucleotide sequence of the GmHdz4 gene is shown as SEQ ID NO. 1.

Further, the host cell of the genetically engineered bacterium is agrobacterium tumefaciens EHA105, and the original carrier of the CRISPR/Cas9 carrier is pBGK041.

Further, the regulation and control method comprises the following steps:

(1) Designing target sequence sgRNA of a transcription factor GmHdz4 gene, and constructing a CRISPR/Cas9 vector of the transcription factor GmHdz4 gene;

(2) Transferring the CRISPR/Cas9 vector into a competent cell of agrobacterium tumefaciens to obtain agrobacterium containing the CRISPR/Cas9 vector;

(3) And infecting cotyledonary nodes of wild soybeans sprouting for 1 day by using agrobacterium containing a GmHdz4 gene editing vector, recovering seedlings by tissue culture, and screening to obtain mutant plants with the transcription factor GmHdz4 gene deletion.

Further, the agrobacterium tumefaciens is EHA105.

Further, in step (1), the target sequence sgRNA is shown in SEQ ID NO.2 (5'-GTCCGAAAGAAAGGATAGGC-3').

Compared with the prior art, the invention has the following beneficial effects:

(1) The invention constructs the transgenic soybean plant with the over-expression and the gene knockout of the transcription factor GmHdz4, and discovers that the inflorescence length of the transgenic soybean plant with the gene knockout of the transcription factor GmHdz4 is prolonged and the number of single flowers and pods is obviously increased by observing the soybean yield constitutional factors.

(2) The invention discovers that the transcription factor GmHdz4 gene knocked out gene for regulating inflorescence meristem development and floral meristem development in plants: the expression quantity of GmFT2a, gmFT5a, gmFUL, gmLFY and GmAP1 is obviously increased, and the expression quantity of the GmKNT1 gene for negatively regulating inflorescence tissue development in a knockout line is obviously reduced, so that the transcription factor GmHdz4 is a key gene for regulating soybean inflorescence development.

Drawings

FIG. 1 is a genetic transformation process of soybean.

FIG. 2 shows the PCR identification of the over-expressed strain in example 1.

FIG. 3 is the effect of wild-type, gmHdz4 over-expression and GmHdz4 gene editing mutant lines on inflorescence length and floret number in example 2;

wherein, the A picture is a photo; panel B shows inflorescence length; panel C shows the number of florets; gmHdz4-oe represents an overexpressing GmHdz4 gene line, WT represents a wild-type non-transgenic plant, and gmHdz4 represents a gene editing GmHdz4 mutant.

FIG. 4 is a graph showing the results of in situ hybridization of GmHdz4 in example 2;

wherein, the A graph shows the in situ hybridization result of GmHdz4 in soybean inflorescence tissue; and B is a partial enlarged view in the block of the A diagram.

FIG. 5 is an agronomic trait investigation of wild-type, gmHdz4 over-expression and GmHdz4 gene editing mutant lines;

wherein, the A picture is a photo, and the B picture is an agronomic character index histogram; gmHdz4-oe represents an overexpressing GmHdz4 gene line, WT represents a wild-type non-transgenic plant, and gmHdz4 represents a gene editing GmHdz4 mutant.

FIG. 6 shows the expression levels of different genes (GmFT 2a, gmFT5a, gmSOC1, gmFUL, gmKNT1, gmWUS, gmAP1 and GmLFY 2) of the wild type, gmHdz4 overexpression and GmHdz4 gene editing mutant lines.

Detailed Description

The invention will be further described with reference to the following examples, which are given by way of illustration only, but the scope of the invention is not limited thereto.

Example 1 obtaining overexpression and mutant lines by Agrobacterium-mediated methods

The GmHdz4 CDS sequence was amplified with primers GmHdz4_plus_F:5'-CAGTGAATTCCTGGACGTCCGTACGTTCGA-3' and GmHdz4_plus_R:5'-CGATGAATTCCGGCGCAAAAATCACCAGTC-3' and inserted into the EcoRI site of the pTF102 vector, the transcription being controlled by the CaMV35S promoter. Transforming agrobacterium EHA105; the sgRNA sequence is amplified by probes oligo_UP 5'-GGGTTGGTCCGAAAGAAAGGATAGGC-3' and oligo_DOWN 5'-AAACGTCCGAAAGAAAGGATAGGCCA-3', the amplified dimer is connected with pBGK041 in an idle mode, and the constructed knockout vector contains an expression cassette of Cas9 protein and sg RNA, which is driven by S35 and GmU6 promoters respectively, so as to transform agrobacterium EHA105.

T was obtained by constructing the method described by Yang et al (Yang XF, yu XQ, zhou Z et al (2016) A high efficiency Agrobacterium tumefaciens mediated transformation system using cotyledonary node as explants in soybean (Glycine max L.). Acta Physiol plant.38 (3): 1-10.). The optimization of Agrobacterium tumefaciens-mediated transformation system, using the constructed overexpression vector and CRISPR/Cas9 vector, taking the one day-sprouted Tianlong soybean cotyledonary node as the explant, and performing seed sterilization, seed germination, explant isolation, agrobacterium tumefaciens infection co-culture, bud induction, bud elongation, bud rooting and the like ₀ The generation GmHdz4 overexpressing lines and mutants (shown in FIG. 1).

Results: the genetic transformation efficiency of soybean in the experiment is stabilized at about 4.5%.

The test identification is carried out by a bar test strip and glufosinate-ammonium coating to obtain T ₀ 3 and mutant of generation GmHdz4 over-expression independent transformant line11 strains, the bar gene and the target gene of the over-expressed strain were positive in PCR (FIG. 2), and the conditions of each strain are shown in Table 1. T (T) ₀ Pair T after seed reproduction ₁ The generation mutants were further identified and 5 unimodal strains were selected (Table 2), in which two mutation cases were present for the Ko-171 strain, with 3 consecutive bases deleted from both the Ko-334 and the Ko-342 strain without affecting the frameshift mutation.

Table 1T ₀ Identification of the over-expressed and mutant lines

Table 2T ₀ Identification result of generation gene editing strain

Example 2 GmHdz4 affects soybean inflorescence structure and grain size

Wild-type, gmHdz4 strain and knockout strain were grown in gallon pots and incubated under light/dark conditions at 28℃for 10h/14h in a greenhouse. The inflorescence length was observed before growing to the initial flowering period (R1) while inflorescence samples were collected for in situ hybridization, and counting of the number of florets was performed in the full flowering period (R2). The inflorescence structure was observed to show that the number of florets and inflorescence length of the mutant were significantly higher than that of the wild type (fig. 3). The results of in situ hybridization experiments also showed that the GmHdz4 gene was abundantly expressed in the apical meristem of the inflorescence (FIG. 4).

The resulting Gmhdz4 overexpressing strains #5, #6, #16 and the gene editing mutants Ko-165, ko-166, ko-171 were self-pollinated to T ₂ And (5) examining agronomic characters after the generation and the maturation. The main stem node number and the branch number have no obvious difference between wild type, over-expressed strain and gene mutant strain, but the strain height of the mutant strainShorter, mutant lines had significantly higher pod numbers per plant than the over-expressed lines and wild type (fig. 5).

Example 3

The transformation of soybean apical meristem into inflorescence meristem was confirmed to be determined by GmFT2a and GmFT5a, both genes regulating the formation of primary inflorescence meristem, the expression levels of both genes being significantly increased in the knockout line gmhdz4, especially GmFT5a. Downstream genes GmSOC1 and GmFUL and GmFT2a and GmFT5a regulate and control development of secondary inflorescence meristems, and expression quantity of GmSOC1 in a knockout line gmhhdz 4 is not remarkably different from that of a wild type strain and an over-expression line, but expression quantity of GmFUL is remarkably increased. Studies show that the GmKNT1 gene causing flower atrophy is specifically expressed in apical meristems and inflorescence tissues, and the expression level of GmKNT1 in the knockout strain gmhdz4 is obviously reduced. The expression levels of GmLFY2 and GmAP1 in the knockout line gmhhdz 4 are all significantly increased, while the expression levels of GmWUS are only slightly increased in the knockout line Ko-171 by activating the flower organ function to determine the genes GmLFY2, gmAP1 and GmWUS of the flower meristem.

Claims (7)

1. The application of the transcription factor GmHdz4 gene in regulating and controlling soybean pod traits is characterized in that the nucleotide sequence of the GmHdz4 gene is shown as SEQ ID NO. 1; the pod traits are inflorescence length and single plant pod number.

2. The use according to claim 1, wherein the regulation is by: the length of inflorescences is prolonged and the number of single flowers and pods of soybean is increased by knocking out GmHdz4 genes.

3. The application of the genetically engineered bacterium in improving the pod traits of the soybean is characterized in that the genetically engineered bacterium comprises a CRISPR/Cas9 vector edited by a GmHdz4 gene; the nucleotide sequence of the GmHdz4 gene is shown as SEQ ID NO. 1.

4. The use of claim 3, wherein the host cell of the genetically engineered bacterium is agrobacterium tumefaciens EHA105 and the original vector of the CRISPR/Cas9 vector is pBGK041.

5. The use according to any one of claims 1 to 4, wherein the method of modulation is:

(1) Designing target sequence sgRNA of a transcription factor GmHdz4 gene, and constructing a CRISPR/Cas9 vector of the transcription factor GmHdz4 gene;

(2) Transferring the CRISPR/Cas9 vector into a competent cell of agrobacterium tumefaciens to obtain agrobacterium containing the CRISPR/Cas9 vector;

(3) And infecting cotyledonary nodes of wild soybeans sprouting for 1 day by using agrobacterium containing a GmHdz4 gene editing vector, recovering seedlings by tissue culture, and screening to obtain mutant plants with the transcription factor GmHdz4 gene deletion.

6. The use of claim 5, wherein the agrobacterium tumefaciens is EHA105.

7. The use according to claim 5, wherein in step (1) the target sequence sgRNA is shown in SEQ ID No. 2.