CN117186229A

CN117186229A - Anti-human BCMA nanobody with long CDR3 sequence, CAR-T and application

Info

Publication number: CN117186229A
Application number: CN202311175223.7A
Authority: CN
Inventors: 杨寒朔
Original assignee: Chengdu Saiengino Biotechnology Co ltd
Current assignee: Chengdu Saiengino Biotechnology Co ltd
Priority date: 2022-12-06
Filing date: 2023-09-12
Publication date: 2023-12-08
Anticipated expiration: 2043-09-12
Also published as: CN117186228A; CN117186228B; CN117186229B

Abstract

The application belongs to the technical field of biology, and particularly relates to an anti-human BCMA nanobody with a CDR3 sequence with a specific length, a CAR-T and application thereof. The number of amino acid residues of CDR3 in the anti-human BCMA nano-antibody provided by the application is 16-32. The nano antibody prepared by the method has good affinity, and the prepared CAR-T can play a great clinical potential in the treatment of spontaneous immune diseases such as B lymphocyte malignant tumor, multiple myeloma, chronic lymphocytic leukemia, diffuse large B cell lymphoma, neuromyelitis optica pedigree diseases, human rheumatoid arthritis, multiple sclerosis, systemic lupus erythematosus and the like.

Description

Anti-human BCMA nanobody with long CDR3 sequence, CAR-T and application

The present application claims priority of "an anti-human BCMA nanobody having a long CDR3 sequence and a method for preparing and using the same," and "a bispecific antibody based on an anti-BCMA nanobody comprising a long CDR3 sequence, CAR-T formulation and using," as filed in chinese patent application No. 202211579918.7, 12, 2022, and "both priority patent applications are incorporated herein by reference in their entirety.

Technical Field

The application belongs to the technical field of biology, and particularly relates to an anti-human BCMA nanobody with a long CDR3 sequence, a CAR-T and application thereof.

Background

B cell maturation antigen (B-cell maturation antigen, BCMA), also known as tumor necrosis factor receptor superfamily member 17 (TNFRS 17) or CD269, is a protein specifically expressed on the surface of plasma cells and differentiated plasma cells, whose extracellular domain is composed of 185 amino acid residues, plays a major role in B cell maturation and differentiation into plasma cells. BCMA is a receptor for proliferation-inducing ligand (APRIL) and B cell activating factor (B-cell activating factor, BAFF) of the tumor necrosis factor superfamily. Both can trigger NF- κB signaling, increase the expression of pro-survival BCL-2 family genes and down-regulate pro-apoptotic genes, in addition, BCMA can activate JNK and MAPK8 signaling pathways, and these signaling pathways are involved in regulating humoral immunity, B cell development and homeostasis, promote B cell survival in different development stages, and are key to regulating B cell proliferation, maturation and differentiation into plasma cells.

Multiple Myeloma (MM) is the second largest hematological malignancy next to non-hodgkin's lymphoma, and is characterized by abnormal proliferation of malignant plasma cells in the bone marrow and osteolytic bone lesions. Related clinical symptoms include osteolytic lesions, anemia, renal insufficiency, hypercalcemia, infections and other related organ dysfunctions. BCMA protein and mRNA are almost exclusively found on plasma cells in normal human tissues, but are selectively overexpressed during malignant transformation of plasma cells, are highly expressed on the surface of multiple myeloma cells, and elevated BCMA levels in serum of MM patients promote tumor cell growth, survival and development of drug resistance, mainly by activating NF- κ B, AKT, phosphatidylinositol 3 kinase (PI 3K), STAT3 and MAPK intracellular signaling cascades. The current major treatment regimens include chemotherapy, autologous Stem Cell Transplantation (ASCT) and novel drugs (proteasome inhibitors, immunomodulatory drugs and monoclonal antibodies (such as daratumumab or elotuzumab), which, while delaying the progression of the disease, remain largely incurable, MM, and most patients relapse after multiple line therapy.

In 1993, an antibody having only a heavy chain variable region (variabledomain of the heavy chain of HCAb, VHH) and two CH2 and CH3 regions, called a single domain antibody (singledomain antibody, sdAb), also called a nanobody, was isolated from serum of camelids and sharks, which is superior to conventional antibodies in terms of molecular size, stability, solubility, penetrability, and the like. Such nanobodies alone express VHH structures, but still retain antigen specificity and binding affinity for the original heavy chain intact, being the smallest antibody fragment known to date to bind antigen. Nanobodies may therefore play an advantage in vaccine development, disease diagnosis and treatment. While nanobodies have numerous advantages over conventional antibodies, how nanobodies perform better and more stable functions in practical clinical treatments and applications is widely proven, and many doubts remain incompletely understood. And what types of nanobodies have good effects currently have no accurate answer, and still require considerable time and effort from researchers to explore.

In view of the foregoing, there remains a need in the art to develop novel nanobodies against BCMA and related applications to alleviate the deficiencies of current medical techniques in the treatment of multiple myeloma.

Disclosure of Invention

In view of the above, the present application aims to provide an anti-human BCMA nanobody with a CDR3 sequence of a specific length, CAR-T and application thereof, and the specific technical scheme is as follows.

An anti-human BCMA nanobody comprising a heavy chain variable region comprising a framework region and a complementarity determining region having 16 to 32 amino acid residues of CDR 3; the sequence of the heavy chain variable region is shown in SEQ ID NO. 1-SEQ ID NO. 42.

Further, the anti-human BCMA nanobody has an affinity KD value ranging from 1.0×10 ^-9 ～9.0×10 ^-12 。

Preferably, the anti-human BCMA nanobody has an affinity KD value in the range of 1.0 x 10 ^-9 ～7.5×10 ^-12 。

A CAR-T cell targeting multiple myeloma, the CAR-T cell comprising an anti-human BCMA nanobody as described above.

Further, the CAR-T cells also include a CD8 signal peptide, a hinge region (hinge), a human CD8 transmembrane region (TM), a human 4-1BB costimulatory signal region, and a human CD3 zeta signal domain.

The preparation method of the anti-human BCMA nano antibody comprises the following steps:

step 1: taking plasmid containing full-length sequence of human BCMA gene as a template, and preparing recombinant protein of specific targeted BCMA by using a eukaryotic expression system;

step 2: immunizing an animal by using the recombinant protein prepared in the step 1, extracting total RNA of peripheral blood lymphocytes of the immunized animal, reversely transcribing the total RNA into cDNA, performing two-round amplification by nested PCR to obtain nanobody genes, and cloning the nanobody genes to a phage display carrier to construct a phage nanobody library;

step 3: panning the nanobody constructed in the step 2 by using the specific targeted BCMA recombinant protein prepared in the step 1 by using a phage display technology, and identifying the nanobody capable of specifically binding to BCMA protein;

step 4: affinity detection is carried out on the elutriated nano antibody which specifically targets BCMA.

Further, the primers for the first round of nested PCR amplification are shown as SEQ ID NO.43 and SEQ ID NO. 44; the primers for the second round of nested PCR amplification are shown as SEQ ID NO.45 and SEQ ID NO. 46.

Further, detecting the nano-antibody which is specifically targeted to BCMA and is elutriated in the step 4, and screening the nano-antibody with the CDR3 amino acid residue length within the range of 16-32.

The application of the anti-human BCMA nano antibody in preparing medicaments for targeting multiple myeloma, B lymphocyte malignant tumor, chronic lymphocytic leukemia, diffuse large B cell lymphoma, neuromyelitis optica (NGL) pedigree diseases, human rheumatoid arthritis, multiple sclerosis or systemic lupus erythematosus.

The CAR-T cells are applied to the preparation of medicines for targeting multiple myeloma, B lymphocyte malignant tumor, chronic lymphocytic leukemia, diffuse large B cell lymphoma, neuromyelitis optica (NGL) lineage diseases, human rheumatoid arthritis, multiple sclerosis or systemic lupus erythematosus.

Further, the multiple myeloma is a multiple myeloma that highly expresses BCMA.

Beneficial technical effects

The nano antibody only has 3 highly variable regions (CDR 1/CDR2/CDR 3), the CDR3 of the conventional antibody only has 8-15 amino acids, and the amino acid residues of the CDR3 part of the nano antibody screened by the application are 16-32, so that the diversity and the specificity of the CDR are increased. In addition, the CDR3 region of the nanobody of the application is longer than the CDR3 region of the conventional antibody, can form a large exposed convex ring, extends into a gap or a split of an antigen like a finger, can contact an epitope which cannot be contacted by the conventional antibody, and therefore has higher affinity. Experiments prove that compared with the conventional CAR-T, the CAR-T prepared by the VHH provided by the application has positive correlation with the number of CDR3 in the killing capacity of tumor cells. Wherein, the CAR prepared by VHH (CDR 3 amino acid number is 21) shown in SEQ ID NO.16 has a CAR positive expression rate as high as 73.99 percent, which is higher than that of the CAR-T prepared by VHH shown in SEQ ID NO.1 (CDR 3 amino acid number is 16) and NO.5 (CDR 3 amino acid number is 18), and the CAR-T is more superior to that of the conventional CAR-T.

Finally, the nano antibody prepared by the method has good affinity and can play a great clinical potential in the treatment of multiple myeloma and spontaneous immune diseases. Experiments of the application prove that the affinity of the nano antibody is not positively correlated with the tumor killing capability. When the affinity of the nanobody is too high, the nanobody can be tightly combined with the surface antigen of a single tumor cell, so that the nanobody cannot be flexibly separated to kill other tumor cells, and the final tumor killing effect is general. Thus, VHH with better affinity for tumor cells, but moderate affinity, needs to be screened to perform better and more stable functions in practical clinical treatments and applications.

In conclusion, the nano-antibody screened and prepared CAR-T can effectively play an anti-tumor effect in BCMA positive tumor treatment such as multiple myeloma and the like.

Drawings

In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below. It will be apparent to those of ordinary skill in the art that the drawings in the following description are of some embodiments of the application and that other drawings may be derived from these drawings without inventive faculty.

FIG. 1 is an electrophoresis diagram of recombinant protein BCMA-mFc purified by means of affinity chromatography to obtain high purity;

FIG. 2 shows the total RNA of camelid lymphocytes extracted after immunization, and the electrophoresis pattern of PCR amplification products (A: first round amplification products; B: second round amplification products);

FIG. 3 is an electrophoresis diagram of recombinant nanobodies purified by means of affinity chromatography;

FIG. 4 is a graph showing absorbance at OD450 nm measured by incubating recombinant phage supernatant of the nanobody obtained with BCMA recombinant protein coated in ELISA plate and other irrelevant antigen;

FIG. 5 is a graph showing detection of BCMA-CAR-T cell CAR positive rate using FACS;

figure 6 is the in vitro killing activity of BCMA-targeted CAR-T against myeloma cells.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present application more clear, the technical solutions of the embodiments of the present application will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present application. It will be apparent that the described embodiments are some, but not all, embodiments of the application. All other embodiments, which can be made by those skilled in the art based on the embodiments of the application without making any inventive effort, are intended to be within the scope of the application.

Herein, "and/or" includes any and all combinations of one or more of the associated listed items.

Herein, "plurality" means two or more, i.e., it includes two, three, four, five, etc.

It should be noted that, in this document, the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus. Without further limitation, an element defined by the phrase "comprising one … …" does not exclude the presence of other like elements in a process, method, article, or apparatus that comprises the element.

As used in this specification, the term "about" is typically expressed as +/-5% of the value, more typically +/-4% of the value, more typically +/-3% of the value, more typically +/-2% of the value, even more typically +/-1% of the value, and even more typically +/-0.5% of the value.

In this specification, certain embodiments may be disclosed in a format that is within a certain range. It should be appreciated that such a description of "within a certain range" is merely for convenience and brevity and should not be construed as a inflexible limitation on the disclosed ranges. Accordingly, the description of a range should be considered to have specifically disclosed all possible sub-ranges and individual numerical values within that range. For example, a rangeThe description of (c) should be taken as having specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as individual numbers within such ranges, e.g., 1,2,3,4,5, and 6. The above rule applies regardless of the breadth of the range.

Example 1

The embodiment provides a method for constructing, expressing and purifying BCMA recombinant protein expression vector

1.1 construction of eukaryotic expression vectors

The full-length sequence of human BCMA gene is synthesized into a pMD19-T vector, a plasmid containing the full-length BCMA gene is used as a template, a primer is designed for amplification to obtain a BCMA extracellular region (ECD) gene, the BCMA extracellular region (ECD) gene is cloned into a pVax-mFc vector subjected to double enzyme digestion by restriction enzymes PstI and XbaI in a digestion connection mode, the pVax-mFc vector is transformed into DH5 alpha competent cells, screening is carried out through a kanamycin resistance plate, monoclonal sequencing is selected for identification, and the successfully constructed vector is named as pVax-mFc-BCMA-His.

1.2 recombinant protein expression and purification

The successfully constructed recombinant plasmid pVax-mFc-BCMA-His is transfected into HEK293T cells by using a transfection reagent PEI, the supernatant is collected after 5 days of expression, and the recombinant protein BCMA-mFc with high purity is obtained by purifying by using Ni gel through an affinity chromatography mode, and the result is shown in figure 1. The recombinant protein has the effect of specifically targeting a BCMA target.

Example 2

Screening and preparation method of anti-BCMA protein nano antibody

2.1 protein emulsification and animal immunization

The BCMA recombinant protein purified in example 1 (for example, 1 mg) was mixed with an equal volume of aluminum hydroxide adjuvant and the camel was immunized subcutaneously through the neck for the first time, then immunized continuously 4 times every 2 weeks, and peripheral anticoagulation was collected on day 7 after impact immunization.

2.2 construction of phage antibody library and antibody screening

2.2.1 isolation of peripheral blood lymphocytes

200mL of peripheral blood, containing a large number of B lymphocytes, was collected aseptically from the neck vein of the camel, and diluted with an equal volume of PBS buffer. And separating by Ficoll-Paque Plus lymphocyte separating liquid to obtain peripheral blood lymphocyte, wherein the obtained lymphocyte can be directly used for extracting total RNA or frozen at-80 ℃ for standby.

2.2.2 nanobody Gene amplification

Firstly extracting total RNA of lymphocytes, carrying out reverse transcription by taking the RNA as a template to obtain cDNA, then taking the cDNA as the template, amplifying VHH genes by using nested PCR, wherein the first round of amplification primers are CALL001 and CALL002 (see table 1), and separating and recovering about 700bp fragments by agarose gel electrophoresis (figure 2A); a second round of PCR amplification was then performed using the recovered 700bp product as template, the second round of amplification primers VHH-FOR, VHH-REV (see Table 1), and the 400bp fragment was separated and recovered by agarose gel electrophoresis (FIG. 2B).

TABLE 1 primer sequences required for VHH Gene amplification

Primer name	Primer sequencesColumn (5 '-3')	Sequence numbering
			CALL001	GTCCTGGCTGCTCTTCTACAAGG	43
CALL002	GGTACGTGCTGTTGAACTGTTCC	44
			VHH-FOR	CAGGTGCAGCTGCAGGAGTCTGGGGGAG	45
VHH-REV	CTAGTGCGGCCGCTGAGGAGACGGTGACCTGGGT	46

2.2.3 construction of phage display vectors

Both the PCR product amplified and recovered in the above step and the phage display vector pMECS were digested with the restriction enzymes Pst I and Not I, and then ligated using T4 DNA ligase.

2.2.4 electrotransformation and harvesting of phage antibody libraries

Adding the ligation product obtained in the above steps into TG1 competent cells, transforming the cells into TG1 by using an electrotransformation instrument, adding an SOC culture medium after electrotransformation is completed, culturing and activating the cells for 1h at 37 ℃ and 220rpm, uniformly coating the culture on an LB/Amp-Glu plate, culturing the cells for 6-8 h at 37 ℃, collecting the cells, adding sterile glycerol to reach the final concentration of 15%, and storing the prepared phage library at-80 ℃ or directly using the phage library for subsequent antibody screening.

2.2.5 screening of specific nanobodies

Taking the prepared phage library as an antibody source, taking a phage library with 20 times of library capacity, adding an auxiliary phage M13K07 to obtain recombinant phage for expressing the antibody, incubating the recombinant phage with BCMA recombinant protein coated in an ELISA plate, eluting with 0.1M Glycine (pH 1.5), re-infecting TG1 strain with the eluent, culturing at 37 ℃ and 220rpm to logarithmic phase, and adding the auxiliary phage to display the antibody on the surface of the phage. After repeating the above steps for 3 rounds of screening, a monoclonal colony is selected from the colony plate prepared by the third round of screening for amplification culture, a monoclonal ELISA is used for identifying the nanobody capable of specifically binding to BCMA protein, and the colony is subjected to sequencing analysis to obtain 42 specific nanobodies against BCMA, as shown in Table 2.

TABLE 2 nanobody complete sequence

The CDR3 regions of the sequences shown in SEQ ID NOS.1-42 are shown in Table 3 below.

TABLE 3 nanobody CDR3 regions

2.2.6 preparation of nanobodies

The VHH gene is amplified by taking a recombinant plasmid pMECS-Nbs containing the nanobody gene in 2.2.5 as a template, cloned into a eukaryotic expression vector pcDNA3.1-hFc in a way of enzyme digestion connection, and the plasmid is extracted and transfected into HEK293T cells after the construction is successful, the supernatant is collected after the expression is carried out for 5 days, and the recombinant nanobody is obtained by purifying the supernatant by utilizing a Ni column in an affinity chromatography way.

Example 3

3.1Biacore detection of nanobody affinity

The binding affinity of the nanobodies of this batch was measured with the antigen BCMA-mFc coated on the CM5 chip using a Biacore 8k instrument, and the results are shown in Table 4. The selected CDR3 nanometer antibody sequences with specific length amino acid residues (16-32) have KD value range of 1.0 x 10 ^-9 ～9.0×10 ^-12 The larger the KD value, the smaller the affinity.

Table 4 nanobody affinity data

Remarks: 1e+04=1×10 ⁴ ；1E-04＝1×10 ^-4 The method comprises the steps of carrying out a first treatment on the surface of the And others by analogy.

3.2 specific analysis of anti-BCMA protein nanobodies

The affinity of the nano antibody and BCMA antigen is compared by an indirect ELISA (enzyme-linked immunosorbent assay) method, the BCMA recombinant protein is coated in a 96-hole ELISA plate, the nano antibody (0.1 mug/mL) prepared in the method is added into the ELISA plate after the completion of the sealing, and the detection is carried out by using an HRP-marked goat anti-human secondary antibody, and the result is shown in figure 4, the obtained 42-strain nano antibody can be specifically combined with the BCMA protein and does not react with other irrelevant antigens, so that the nano antibody has good specific binding activity.

Example 4

In vitro killing activity assay of chimeric antigen receptor modified T cells targeting BCMA on myeloma cells

Taking the nano sequences shown in SEQ ID No.1, no.5 and No.16 as an example, a chimeric antigen receptor lentiviral expression vector pWPXLD-BCMA-CAR for expressing the targeted BCMA is constructed by using a molecular cloning method, and the CAR fragment also comprises a CD8 signal peptide, a BCMA VHH, a hinge region (hinge), a human CD8 transmembrane region (TM), a human 4-1BB co-stimulatory signal region and a human CD3 zeta signal domain.

In the embodiment, pWPXLD-BCMA-CAR is used as a core plasmid, psPAX2 and pMD2.G are used as auxiliary plasmids, 293T cells are transfected by using a calcium phosphate transfection technology, viruses are packaged, the viruses are used for preparing BCMA-CAR-T cells, and the positive expression rate of the CAR is shown in figure 5.

Taking a multiple myeloma cell line MM.1S-mcherry expressing fluorescent protein mcherry as a target cell and BCMA-CAR-T cells as effector cells, co-culturing 2 cells according to an effective target ratio of 1 (CAR-T: target cell=2.5:1), and using a living cell workstation to monitor a fluorescence value to characterize the killing condition of the BCMA-CAR-T cells, wherein the result is shown in figure 6, the CAR-T prepared by the nano antibody has good in vitro killing activity on a natural MM cell line and is enhanced along with the enhancement of the effective target ratio.

The embodiments of the present application have been described above with reference to the accompanying drawings, but the present application is not limited to the above-described embodiments, which are merely illustrative and not restrictive, and many forms may be made by those having ordinary skill in the art without departing from the spirit of the present application and the scope of the claims, which are to be protected by the present application.

Claims

1. An anti-human BCMA nanobody comprising a heavy chain variable region comprising a framework region and a complementarity determining region having 16 to 32 amino acid residues of CDR 3; the sequence of the heavy chain variable region is shown in SEQ ID NO. 1-SEQ ID NO. 42.

2. The anti-human BCMA nanobody as claimed in claim 1 wherein said anti-human BCMA nanobody has an affinity KD value ranging from 1.0 x 10 ^-9 ～9.0×10 ^-12 。

3. A CAR-T cell targeting multiple myeloma, characterized in that the CAR-T cell comprises the anti-human BCMA nanobody of claim 1.

4. The CAR-T cell of claim 3, further comprising a CD8 signal peptide, a hinge region, a human CD8 transmembrane region, a human 4-1BB co-stimulatory signal region, and a human CD3 zeta signal domain.

5. The method for preparing the anti-human BCMA nanobody as claimed in claim 1, comprising the steps of:

6. The method of claim 5, wherein the primers for the first round of nested PCR amplification are set forth in SEQ ID NO.43 and SEQ ID NO. 44; the primers for the second round of nested PCR amplification are shown as SEQ ID NO.45 and SEQ ID NO. 46.

7. The method according to claim 5, wherein the specific BCMA-targeted nanobody selected in step 4 is detected and the nanobody having a CDR3 amino acid residue length within the range of 16 to 32 is selected.

8. Use of an anti-human BCMA nanobody according to claim 1 for the preparation of a medicament targeting multiple myeloma, B-lymphocyte malignancy, chronic lymphocytic leukemia, diffuse large B-cell lymphoma, neuromyelitis optica lineage disease, human rheumatoid arthritis, multiple sclerosis or systemic lupus erythematosus.

9. Use of the CAR-T cell of claim 3 in the manufacture of a medicament for targeting multiple myeloma, B-lymphocyte malignancy, chronic lymphocytic leukemia, diffuse large B-cell lymphoma, neuromyelitis optica lineage disease, human rheumatoid arthritis, multiple sclerosis or systemic lupus erythematosus.

10. The use of claim 9, wherein the multiple myeloma is a multiple myeloma that highly expresses BCMA.