CN117165610A - Fusion gene of RARA related variant APL and amplification primer thereof - Google Patents

Fusion gene of RARA related variant APL and amplification primer thereof Download PDF

Info

Publication number
CN117165610A
CN117165610A CN202311422257.1A CN202311422257A CN117165610A CN 117165610 A CN117165610 A CN 117165610A CN 202311422257 A CN202311422257 A CN 202311422257A CN 117165610 A CN117165610 A CN 117165610A
Authority
CN
China
Prior art keywords
rara
primer
apl
fusion gene
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202311422257.1A
Other languages
Chinese (zh)
Inventor
张长林
江梅
魏彩辉
王雪梅
谢安
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
First Affiliated Hospital of Nanchang University
Original Assignee
First Affiliated Hospital of Nanchang University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by First Affiliated Hospital of Nanchang University filed Critical First Affiliated Hospital of Nanchang University
Priority to CN202311422257.1A priority Critical patent/CN117165610A/en
Publication of CN117165610A publication Critical patent/CN117165610A/en
Pending legal-status Critical Current

Links

Classifications

    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The application provides a fusion gene of RARA related variant APL and an amplification primer thereof. The fusion gene of the RARA-related variant APL is formed by fusing IRF2BP1exon1, through a RARA gene intron2 fragment, with RARA exon3 and downstream sequences thereof. The application designs a specific PCR primer aiming at the fusion gene, expands the detection range of the original detection means, can be applied to clinic, can improve the detection rate of the RARA related variant APL, and provides a basis for diagnosis typing and molecular targeted therapy.

Description

Fusion gene of RARA related variant APL and amplification primer thereof
Technical Field
The application relates to the technical field of biomedicine, in particular to a fusion gene of RARA related variant APL and an amplification primer thereof.
Background
Acute Promyelocytic Leukemia (APL) is a special type of acute leukemia, which is defined as AML-M3 type based on cell morphology and histochemical characteristics, and AML with t (15; 17) (q 22; q 21)/PML-RARA fusion gene is defined directly as APL. Most APL patients have urgent and dangerous conditions, and often have disseminated intravascular coagulation, thereby endangering life. The application of all-trans retinoic acid (ATRA) greatly improves the APL treatment effect.
However, it has been found clinically that about 5% of APL patients do not have PML-RARA fusion genes, often with RARA fused to other genes or with a retinoic acid receptor family member RARB or RARG rearrangement, most of them characterized by resistance to ATRA and arsenics, and the prognosis is poor, and this disease is defined as variant APL. At present, twenty rare RARA related partner genes, namely ZBTB16, NUMA, STAT5B, NPM1, IRF2BP2, TBLR1, FIPIL1, BCOR, STAT3, PRKAR1A, OBFC2A, GTF2I, FNDC3B, NUP98, TNRC18, HNRNPC, TTMV, NAB2, THRAP3 and SART3, are found at home and abroad. The fusion of RARA and different partner genes has very different reactivity to ATRA, and the prognosis of patients of this type is very bad, which becomes one of the difficulties of APL clinical diagnosis and treatment.
Therefore, the clinical identification and detection of these fusion genes is particularly important for the accurate diagnosis and treatment of diseases. Accurate detection of RARA related fusion genes is helpful for understanding APL more comprehensively, and accurate diagnosis and personalized treatment are carried out on APL caused by different fusion genes, so that the complete remission rate of the diseases is effectively improved, and the life health and safety of patients are ensured.
Disclosure of Invention
In view of this, the first aspect of the present application provides a fusion gene of a RARA-associated variant APL, which is formed by fusion of IRF2BP1exon1, via a RARA gene intron2 fragment, with RARA exon3 and downstream sequences thereof.
Further, the intermediate length of the RARA gene intron2 fragment is 9 base pairs.
Further, the fusion gene of the RARA-associated variant APL comprises a nucleotide sequence shown as SEQ ID NO. 7.
The fusion gene of the RARA-related variant APL is named as IRF2BP1exon1-RARAIntron 2-RARARAexon 3 fusion gene, abbreviated as IRF2BP1-RARA fusion gene, and the schematic diagram of the fusion gene of the RARA-related variant APL is shown in FIG. 1. Furthermore, it is also considered that the fusion gene of the RARA-associated variant APL is formed by fusion of only IRF2BP1exon1, RARAIntron2 and RARAexon3, or that the fusion gene of the RARA-associated variant APL is a gene comprising fusion of IRF2BP1exon1 and RARAIntron2 with RARARAexon 3, and that the fusion gene of the RARA-associated variant APL expands the type of the RARA-associated fusion gene in APL.
The mRNA of IRF2BP1 gene is encoded as NM_015649.3 in the GeneBank database, and the mRNA of RARA gene is encoded as NM_000964.4 in the GeneBank database. Wherein, the nucleotide sequence of the exon1 (exon 1) of the IRF2BP1 gene is shown as SEQ ID NO.3, and the nucleotide sequence of the fragment of the intron2 (intron 2) of the RARA gene is shown as follows: AGTGTATTG the number of the individual pieces of the plastic,
RARA gene exon3 (exon 3) nucleotide sequence: CCATTGAGACCCAGAGCAGCAGTTCTGAAGAGATAGTGCCCAGCCCTCCCTCGCCACCCCCTCTACCCCGCATCTACAAGCCTTGCTTTGTCTGTCAGGACAAGTCCTCAGGCTACCACTATGGGGTCAGCGCCTGTGAGGGCTGCAAG (SEQ ID NO. 4), the two genes are fused into IRF2BP1exon 1-RARARAintron 2-RARARAexon 3.
The second aspect of the application provides an amplification primer for detecting the fusion gene of the RARA-associated variant APL, which comprises a first primer and a second primer, wherein the first primer is designed by taking IRF2BP1exon1 as a target gene, and the second primer is designed by taking RARA exon4 as the target gene.
Further, the first primer and the second primer are designed in a conserved region of a target gene, the lengths of the first primer and the second primer are 15 bp-30 bp, the GC contents of the first primer and the second primer are 40% -60%, and complementary sequences are not present between the first primer and the second primer.
Further, the first primer is designed by taking a nucleotide sequence shown as SEQ ID NO.3 as a target gene, and the second primer is designed by taking the nucleotide sequence shown as SEQ ID NO.5 as the target gene.
The nucleotide sequence coded by SEQ ID NO.5 is as follows:
GGCTTCTTCCGCCGCAGCATCCAGAAGAACATGGTGTACACGTGTCACCGGGACAAGAACTGCATCATCAACAAGGTGACCCGGAACCGCTGCCAGTACTGCCGACTGCAGAAGTGCTTTGAAGTGGGCATGTCCAAGGAGT（SEQIDNO.5）。
further, the sequence of the first primer and the sequence of the second primer are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2.
The application detects one IRF2BP1exon1-RARAintron2-RARAexon3 fusion gene by high-throughput sequencing technology in one clinical manifestation, morphology and immune typing of initial diagnosis cases conforming to APL, but the molecular biology does not detect PML-RARA, NPM1-RARA and ZBTB16-RARA fusion genes, and finds that the fusion genes are formed by fusion of IRF2BP1exon1, RARA intron2 and RARA exon3, belonging to the first discovered variant APL. Therefore, the third aspect of the present application provides the use of the fusion gene of the RARA-related variant APL according to the first aspect in preparing a diagnostic reagent for RARA-related APL using the fusion gene as a detection target.
In a fourth aspect, the application provides a variant APL diagnostic kit, comprising amplification primers using the fusion gene of the RARA-related variant APL described in the first aspect as a diagnostic target.
Further, the amplification primer is the amplification primer according to the second aspect.
According to the technical scheme, the application provides the fusion gene (IRF 2BP1exon 1-RARARAIntron 2-RARAexen 3) of the RARA-related variant APL, and a specific PCR primer is designed for the fusion gene, so that the detection range of the original detection means is enlarged, the detection method can be applied to clinic, the detection rate and the accuracy rate of diagnosing the RARA-related APL can be improved, and the basis is provided for diagnosis typing and molecular targeting treatment.
The details of one or more embodiments of the application are set forth in the accompanying drawings and the description below to provide a more thorough understanding of the other features, objects, and advantages of the application.
Drawings
FIG. 1 is a schematic diagram of a fusion gene of RARA-associated variant APL of the present application; wherein, the left side of the arrow represents exon1 (exon 1) of the IRF2BP1 gene; the right arrow indicates the RARA gene intron2 (intron 2) fragment and exon3 and downstream sequences thereof (exon 4-9);
FIG. 2 shows the PCR amplification results of the amplification experiments of example 2 of the present application;
FIG. 3 shows the sequencing results of PCR amplification products of the amplification experiments of example 2 of the present application;
FIG. 4 is a prediction diagram of fusion results of the fusion gene of RARA-associated variant APL of the present application;
FIG. 5 shows the expression results of the fusion gene constructed in the function test of the fusion gene in example 3 of the present application;
FIG. 6 shows the result of luciferase activity assay in the fusion gene function test of example 3 of the present application;
the application will be further described in the following detailed description in conjunction with the above-described figures.
Detailed Description
The embodiment of the application discloses a fusion gene of RARA related variant APL and an amplification primer thereof, and a person skilled in the art can properly improve process parameters by referring to the content of the fusion gene. It is expressly noted that all such similar substitutions and modifications will be apparent to those skilled in the art, and are deemed to be included within the present application. The fusion gene of the RARA-associated variant APL and the amplification primer thereof are described through the preferred embodiments, and the related personnel can obviously change or appropriately change and combine the fusion gene of the RARA-associated variant APL and the amplification primer thereof without departing from the content, spirit and scope of the application, so as to realize and apply the technology of the application.
The amplification primer of the application is used for supplementing a PCR primer accompanying with RARA fusion gene detection in the original APL case, expands the type of the RARA related fusion gene in the APL, and increases the detection rate of diagnosing the variant APL by an RT-PCR method. The fusion gene and the amplification primer of the RARA-associated variant APL provided by the application are further described below.
Example 1: validation and analysis for explicitly diagnosed cases
Female patients, 51 years old, were admitted with chest distress, shortness of breath, fever without obvious cause.
Blood examination displayShows hemoglobin level 67g/L (normal range is 110-150 g/L), white blood cell count 25.05X10 9 L (normal range is 4-9×10) 9 L) in which 80% of the abnormal immature cells, platelet count was 53X 10 9 L (normal range is 100-300×10) 9 ). Fibrinogen and D-dimer levels were 1.00. Mu.g/L (reference 2.00-4.00. Mu.g/L) and 35.39. Mu.g/mL (normal range 0.00-0.55. Mu.g/mL), respectively. The prothrombin time and the activated partial prothrombin time were 17.3 seconds (normal range 10.5-13.0 seconds) and 28.6 seconds (normal range 23-35 seconds), respectively.
Morphological analysis showed bone marrow cytopenia, in which 74% of immature cells consisted mainly of abnormally high-granularity promyelocytes, with Auer corpuscles in the bone marrow. In addition, primary cell Peroxidase (POX) staining was strongly positive. Flow cytometry immunophenotyping studies showed that primary cells were positive for CD13, CD33, CD117 and cytoplasmic Myeloperoxidase (MPO), but negative for HLA-DR, CD34, CD38, CD15, CD14 and other T or B lymphoid related markers.
Thus, the patient's clinical manifestations, morphology and immunophenotyping are consistent with the diagnosis of Acute Promyelocytic Leukemia (APL), initially diagnosed with APL, and receiving all-trans retinoic acid (ATRA) treatment from the first day of admission.
However, double-color double-fusion fluorescent in situ hybridization (DCDF-FISH) using specific probes for PML and RARA failed to detect PML-RARA fusion transcripts in bone marrow samples, nor was the rearrangement of RARA found by fluorescent in situ hybridization techniques using RARA fragmentation probe. The leukemia related fusion genes including PML-RARA, NPM1-RARA and ZBTB16-RARA are negative through RT-PCR detection.
Referring to FIG. 1, the present application detects IRF2BP1exon1-RARAIntron 2-RARARAexon 3 fusion gene sequence as shown in SEQ ID NO.6 by performing transcriptome sequencing on a bone marrow sample and searching for a potential fusion gene by using defasein software, and finds that the fusion gene is formed by fusing IRF2BP1exon1 (exon 1) with RARA gene intron2 (intron 2) fragments with an intermediate length of 9 base pairs with RARA exon3 (exon 3) and downstream sequences thereof.
Example 2: amplification experiments
For cases of the fusion gene of the RARA-associated variant APL (IRF 2BP1exon 1-RARARAintron 2-RARAexon3 fusion gene) detected by transcriptome sequencing in example 1, the amplification primers proposed by the present application were used for verification.
The amplification primer comprises the first primer and the second primer, and as can be understood, the first primer is an upstream primer, the second primer is a downstream primer, target genes designed by the first primer are all selected from nucleotide sequences (IRF 2BP1exon 1) shown by SEQ ID NO.3, target genes designed by the second primer are selected from nucleotide sequences shown by SEQ ID NO.5, the target genes are the next exon of RARARAexon 3, namely the sequence of RARARAexon 4, the design principle is the same, the forward primer sequence is 5'-AGTGGTGCTACCTGTGCGAC-3' (SEQ ID NO. 1), and the reverse primer sequence is 5'-TCTGCAGTCGGCAGTACTGG-3' (SEQ ID NO. 2);
1. extraction of RNA: taking 2mL of fresh bone marrow liquid of a patient, placing the fresh bone marrow liquid into an EDTA-K2 anticoagulant tube, separating total white blood cells by using cell lysate, reversing and uniformly mixing, standing at room temperature for 10 minutes, and centrifuging at 1500rpm for 5 minutes.
Total RNA from the samples was extracted using TRIzol reagent and RNA pellet was dissolved in 20 μLDEPC treated water. Detecting the concentration and purity of RNA by an ultraviolet spectrophotometer, regulating the concentration of the RNA sample to 0.5 mug/mL, and placing the RNA sample in an environment of-80 ℃ for freezing.
2. Reverse transcription PCR (RT-PCR): the RNA was reverse transcribed into cDNA according to the two-step procedure. The PCR amplification primer is a primer combination of SEQ ID NO.1 and SEQ ID NO. 2.
The amplification system included 5u/ul Taq enzyme 0.2ul,10 XTaq buffer (containing MgC 12) 2.5 ul,10 mmol/LdNTP0.5ul (all reagents were purchased from Promega BioCo. USA), 10 ul/L of each of the upstream and downstream primers 0.5ul, 150ng of cDNA template, and sterile deionized water to 25 ul.
The PCR amplification conditions were that after denaturation at 95℃for 10min, the PCR was performed at 94℃for 30s, 60℃for 30s, and 72℃for 30s, followed by a total of 35 cycles, and finally extension at 72℃for 7min. PCR products were stained with 2% agarose, 100V at voltage, electrophoresed, gelRed (available from Biotechnology Co.) and visualized under UV light and sequenced.
3. Results: referring to FIGS. 2 to 4, as expected, the result of electrophoresis after PCR using the primers of the present application shows a band of about 500bp in length in bone marrow. And carrying out Sanger sequencing analysis on PCR amplification products of the docking fragment of the IRF2BP1exon1-RARAIntron2-RARAExon3 fusion transcript to obtain the sequence of the docking fragment at the fusion site of the IRF2BP1exon1-RARAIntron2-RARAExon3 fusion gene, namely, the fusion gene of the RARA related variant APL comprises a nucleotide sequence shown as SEQ ID NO.7, wherein the sequence shows that the docking fragment of the fusion transcript is formed by fusing the IRF2BP1exon1, the RARA gene intron2 fragment with the intermediate length of 9 base pairs with the RARA exon3 and the downstream sequence thereof.
4. The detection of the specific band at 500bp was not achieved by using the above-described kit and PCR amplification conditions for bone marrow specimens from 5 cases of normal non-leukemia, 10 cases of non-APL acute myelogenous leukemia, and 5 cases of PML-RARA positive APL patients.
Example 3: fusion gene function experiment
Taking a case bone marrow specimen of the RARA-associated variant APL fusion gene (IRF 2BP1exon1-RARA intron2-RARA exon3 fusion gene) detected by transcriptome sequencing in example 1 as a study object, amplifying the case bone marrow specimen into an IRF2BP1-RARA fusion gene coding region by PCR, and inserting the coding region sequence into a Plvx-NSFB vector to construct an expression plasmid capable of expressing IRF2BP1-RARA protein.
1. The reverse transcription product of experimental example 2 was used as a template, the amplification was performed by the amplification primer of example 2, the amplified product was digested with EcoR1 and BamH1, recovered and ligated with the EcoR1 and BamH1 digested PLVX-NSFB expression vector, then transformed into engineering bacterium E.coli DH 5. Alpha. And inoculated onto LB agarose medium plates, cultured overnight at 37℃in an incubator, and clones were picked up and amplified in LB medium. Then extracting plasmid, adopting enzyme cutting method to make plasmid identification and using one-generation sequencing method to verify that the constructed plasmid is correct.
PML-RARA, RARA and the IRF2BP1-RARA expression plasmid and the RARE luciferase reporter plasmid which verify correct are transfected together into 293T cells, and then the cells are treated with 1 mu MATRA for 24 hours, and the collected cells are analyzed for transcriptional activity of IRF2BP1-RARA during ATRA treatment by using a commercial luciferase activity detection kit (Promega (Beijing) BiotechCo., ltd.) to evaluate the reactivity of the fusion gene to ATRA.
2. Results: referring to FIGS. 5 and 6, the PLVX-NSFB-IRF2BP1-RARA plasmid constructed according to the present application was digested with EcoR1 and BamH1 to generate a fragment of 8000BP (pLVX-NSFB vector) and 1500BP (IRF 2BP 1-RARA), as expected. The sequence of the IRF2BP1-RARA coding region is verified by sequencing. Analysis of the coding region sequence, IRF2BP1exon 1-rarintron 2-rareeon 3 was expected to produce a 513 amino acid fusion protein whose amino acid sequence is shown in seq id No.8, comprising the zinc finger domain (ZF) of IRF2BP1 and the DNA Binding Domain (DBD) and Ligand Binding Domain (LBD) of RARA. Luciferase reporter experiments showed that IRF2BP1-RARA responds to ATRA treatment as does PML-RARA, but not as strongly as RARA.
The foregoing is only for the understanding of the method of the present application and the core idea thereof, and it should be noted that it will be apparent to those skilled in the art that several improvements and modifications can be made to the present application without departing from the principle of the application, and these improvements and modifications also fall within the protection scope of the claims of the application.

Claims (10)

1. A fusion gene of RARA-associated mutant APL is characterized in that the fusion gene is formed by fusing IRF2BP1exon1 with RARA exon3 and a downstream sequence thereof through RARA gene intron2 fragment.
2. The fusion gene of the RARA-associated variant APL according to claim 1, wherein the intermediate length of the intronic 2 fragment of the RARA gene is 9 base pairs.
3. The fusion gene of the RARA-related variant APL according to claim 2, wherein the fusion gene of the RARA-related variant APL comprises a nucleotide sequence as shown in seq id No. 7.
4. An amplification primer for detecting a fusion gene of a RARA-related variant APL according to any one of claims 1 to 3, which comprises a first primer designed with IRF2BP1exon1 as a target gene and a second primer designed with RARA exon4 as a target gene.
5. The amplification primer of claim 4, wherein the first primer and the second primer are designed within a conserved region of a target gene, wherein the first primer and the second primer are 15 bp-30 bp in length, wherein the first primer and the second primer have GC contents of 40% -60%, and wherein no complementary sequences exist between the first primer and the second primer.
6. The amplification primer of claim 5, wherein the first primer is designed with the nucleotide sequence of SEQ ID NO.3 as a target gene and the second primer is designed with the nucleotide sequence of SEQ ID NO.5 as a target gene.
7. The amplification primer of claim 4, wherein the sequence of the first primer and the sequence of the second primer are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.
8. The use of the fusion gene of the RARA-related variant APL according to any one of claims 1 to 3 for preparing a diagnostic reagent of RARA-related APL using the fusion gene as a detection target.
9. A variant APL diagnostic kit comprising amplification primers using the fusion gene of the RARA-related variant APL of any one of claims 1 to 3 as a diagnostic target.
10. The variant APL diagnostic kit of claim 9, wherein the amplification primer is the amplification primer of any one of claims 4 to 7.
CN202311422257.1A 2023-10-31 2023-10-31 Fusion gene of RARA related variant APL and amplification primer thereof Pending CN117165610A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311422257.1A CN117165610A (en) 2023-10-31 2023-10-31 Fusion gene of RARA related variant APL and amplification primer thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311422257.1A CN117165610A (en) 2023-10-31 2023-10-31 Fusion gene of RARA related variant APL and amplification primer thereof

Publications (1)

Publication Number Publication Date
CN117165610A true CN117165610A (en) 2023-12-05

Family

ID=88943431

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311422257.1A Pending CN117165610A (en) 2023-10-31 2023-10-31 Fusion gene of RARA related variant APL and amplification primer thereof

Country Status (1)

Country Link
CN (1) CN117165610A (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107365783A (en) * 2017-07-26 2017-11-21 中国人民解放军南京军区南京总医院 A kind of new fusion of MiT families transposition clear-cell carcinoma and its detection primer and application
CN111549043A (en) * 2020-06-09 2020-08-18 苏州大学附属第一医院 Fusion gene of RARA-related variant APL and detection primer and application thereof
CN114134164A (en) * 2021-12-16 2022-03-04 大连医科大学附属第二医院 RARA-WIPF2 fusion gene and application and detection kit thereof
CN114350804A (en) * 2022-01-07 2022-04-15 中南大学湘雅二医院 AML-related fusion gene and application thereof, detection primer and kit
CN114561473A (en) * 2022-04-28 2022-05-31 南京世和基因生物技术股份有限公司 Detection method of PML-RARA fusion gene mutation

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107365783A (en) * 2017-07-26 2017-11-21 中国人民解放军南京军区南京总医院 A kind of new fusion of MiT families transposition clear-cell carcinoma and its detection primer and application
CN111549043A (en) * 2020-06-09 2020-08-18 苏州大学附属第一医院 Fusion gene of RARA-related variant APL and detection primer and application thereof
CN114134164A (en) * 2021-12-16 2022-03-04 大连医科大学附属第二医院 RARA-WIPF2 fusion gene and application and detection kit thereof
CN114350804A (en) * 2022-01-07 2022-04-15 中南大学湘雅二医院 AML-related fusion gene and application thereof, detection primer and kit
CN114561473A (en) * 2022-04-28 2022-05-31 南京世和基因生物技术股份有限公司 Detection method of PML-RARA fusion gene mutation

Similar Documents

Publication Publication Date Title
Lonergan et al. Identification of novel lung genes in bronchial epithelium by serial analysis of gene expression
CN105316341A (en) LncRNA and application thereof as prostatic cancer detection marker or prostatic cancer prognosis recurrence marker
CN112226536A (en) CRISPR-Cas13 system for detecting novel coronavirus and kit and method thereof
CN110616229A (en) Fusion gene of FGFR1 translocation blood disease and detection primer and application thereof
CN109402262B (en) PCR detection kit for auxiliary diagnosis of neuroblastoma and method for detecting miR-199a-3p expression level
EP3529376A1 (en) Biomarkers of oral, pharyngeal and laryngeal cancers
CN108866187B (en) Long-chain non-coding RNA marker related to lung cancer auxiliary diagnosis and application thereof
CN117165610A (en) Fusion gene of RARA related variant APL and amplification primer thereof
Kolovou et al. Five gene variants in nonagenarians, centenarians and average individuals
CN107653316B (en) Primer pair for detecting three recessive genetic defects of dairy cow and application thereof
CN108676852B (en) Primer pair group and kit for detecting epigenetic modification difference of P53 gene in peripheral blood free DNA
KR102063486B1 (en) Association of RNF213 single nucleotide polymorphism with the risk of Moyamoya disease in a Korean population
CN112094860A (en) CTCF-ETO2 blood disease fusion gene and detection primer and application thereof
CN108486230B (en) Kit for noninvasive detection of MITF gene mutation and preparation method thereof
JP5897704B2 (en) Detection of Brachyspina mutation
CN107029238B (en) Applications of the LINC01094 in diagnosis and treatment cerebral arterial thrombosis
CN116064765B (en) Application of substance for detecting LOXL1gene mutation in preparation of hepatic fibrosis patient molecular typing product
CN110714081B (en) Complete set of reagent for quantitatively detecting OC-STAMP gene expression level and application thereof
CN108866199B (en) mRNA marker for breast cancer diagnosis, detection kit and application thereof
RU2799797C2 (en) Method of obtaining molecular str markers of the human y chromosome for identifying an unknown individual and determining biological relationship by multiplex amplification, and a kit of oligonucleotides for implementing the method
CN110577991B (en) Diagnosis box for non-obstructive azoospermia
RU2723090C1 (en) Diagnostic technique for predisposition to renal cell carcinoma based on pcr-rflp
CN108531583B (en) Primer combination for noninvasive detection of MITF gene mutation and detection method
CN110511992B (en) TARDBP mutant gene, detection primer and kit
CN110452910B (en) FUS mutant gene, detection primer and kit

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination