CN117164680A

CN117164680A - Preparation method and application of recombinant bovine coronavirus S protein

Info

Publication number: CN117164680A
Application number: CN202311373572.XA
Authority: CN
Inventors: 张斌; 喻琦胜; 汤承; 岳华
Original assignee: Southwest Minzu University
Current assignee: Southwest Minzu University
Priority date: 2023-10-23
Filing date: 2023-10-23
Publication date: 2023-12-05

Abstract

The invention provides a preparation method of recombinant bovine coronavirus S protein, which optimizes the coding gene of the bovine coronavirus S protein, and expresses the S protein through recombinant baculovirus, wherein the nucleotide sequence of the optimized S gene is shown as SEQ ID NO. 1. The invention also provides a bovine coronavirus subunit vaccine and application thereof. The invention expresses the bovine coronavirus complete BCoV S protein by utilizing a baculovirus expression system, has good immunogenicity, and provides a theoretical basis for researching bovine coronavirus subunit vaccine.

Description

Preparation method and application of recombinant bovine coronavirus S protein

Technical Field

The invention belongs to the technical field of biological products for livestock, and particularly relates to a preparation method and application of recombinant bovine coronavirus S protein.

Background

Bovine coronavirus disease is a viral disease caused by bovine coronavirus (Bovine coronavirus, BCoV) that causes infections of the respiratory and intestinal tracts of cattle, and is widely recognized as one of the important causative agents of diarrhea in primary calves. At present, the domestic BCoV is widely popular, and seriously hinders the development of the cattle raising industry. There are studies demonstrating that BCoV can infect a variety of hosts, demonstrating that BCoV has great significance in the cross-species transmission field, and that its biosafety impact is not negligible.

BCoV is a single-stranded positive strand RNA virus belonging to the genus picornaviridae, family coronaviridae, genus betacoronavirus. The virus particles are spherical or polygonal, and encode five main structural proteins, namely, fibronectin (S protein), nucleocapsid protein (N protein), envelope glycoprotein (M protein), hemagglutinin lipase glycoprotein (HE protein) and small membrane protein (E protein). The S structural protein contains main antigenic sites and comprises two subunits S1 and S2, and can induce an organism to generate an immune response, thereby inducing the generation of a neutralizing antibody. Various coronavirus vaccines have been developed based on the S protein.

The full length of the S protein of BCoV is 1363 amino acids, the genome is large, and the highly mutated and highly recombined characteristics of the sequence may lead to changes in antigenicity and pathogenicity of BCoV. The current reports on BCoV S protein expression all belong to prokaryotic expression, lack of posttranslational modification, low protein yield and complete S protein not expressed.

The baculovirus expression system (Baculovirus expression system, BES) is a eukaryotic expression system using baculovirus as an exogenous gene expression vector and insect cells as a receptor. The baculovirus has the advantages that the capacity of the baculovirus for containing exogenous genes is strong, only arthropods are infected, and the baculovirus is safer in practical production and application; the insect cell can process and modify the exogenous protein, so that the exogenous protein can be folded correctly, and the spatial conformation and the protein activity are maintained.

Disclosure of Invention

The invention aims to efficiently express recombinant complete S protein by utilizing a baculovirus expression system according to the nucleotide sequence of BCoV fiber protein, and provides thought for the research of BCoV subunit vaccine.

The invention provides a preparation method of recombinant bovine coronavirus S protein, which optimizes the coding gene of the bovine coronavirus S protein, and expresses the S protein through recombinant baculovirus, wherein the nucleotide sequence of the optimized S gene is shown as SEQ ID NO. 1.

Wherein, it includes the following steps:

a. preparing a bovine coronavirus S gene nucleotide sequence shown in SEQ ID NO.1, cloning the bovine coronavirus S gene nucleotide sequence into a baculovirus expression vector, and transforming competent cells of escherichia coli to obtain recombinant bacmid containing complete S genes;

b. transfecting the recombinant bacmid into insect cells, and carrying out transmission culture to obtain recombinant baculovirus carrying complete S genes;

c. and (3) infecting insect cells with the recombinant baculovirus carrying the complete S gene, and purifying to obtain the recombinant S protein.

Wherein, in the step a, the baculovirus expression vector is a pFastBac-Dual plasmid; the competent cells were DH10Bac competent cells.

Wherein in steps b and c, the insect cells are Sf9 cells.

Wherein, in the step b, the passage is from the culture to the generation P4.

Wherein in step c, the MOI value of the recombinant baculovirus infection is 0.5.

The invention also provides a bovine coronavirus subunit vaccine, which is prepared by fully and uniformly mixing the recombinant S protein prepared by the method and a pharmaceutically acceptable adjuvant.

Wherein the adjuvant is CpG and/or MF59.

Wherein, the recombinant S protein is mixed and emulsified with MF59 and CpG according to the volume ratio of 50:50:20.

The invention also provides application of the bovine coronavirus recombinant S protein and subunit vaccine prepared by the method in preparation of bovine coronavirus subunit vaccine.

The invention takes the full-length S gene of the BCoV/SUWN/HXD-4/2021 strain as a template, carries out codon optimization and synthesis aiming at insect cells, expresses the full-length S protein of bovine coronavirus BCoV by utilizing a baculovirus expression system, and can be correctly folded to maintain the original spatial conformation and protein activity after complete post-translational modification including glycosylation of the expressed BCoV S protein of the insect cells.

After the BCoV S protein immunizes mice, the mice can be stimulated to generate specific IgG antibodies, the maximum serum antibody titer reaches 1:12800, the antibody titer is obviously higher than that of an inactivated virus group and an adjuvant control group, meanwhile, the mice can be induced to generate high-level neutralizing antibodies, the maximum neutralizing antibody titer reaches 1:224, and the average neutralizing titer of the S protein group is higher than that of the inactivated virus group. The BCoV S recombinant protein expressed by the invention has good immunogenicity, and provides a theoretical basis for the research of bovine coronavirus subunit vaccine.

The invention will be further illustrated by the following detailed description in conjunction with the drawings and examples, which are not intended to limit the invention in any way. It will be apparent to those skilled in the art that various changes, modifications, substitutions, combinations, and simplifications can be made without departing from the spirit and principles of the invention and these are intended to be equivalent arrangements.

Drawings

FIG. 1 identification of recombinant baculovirus rpFastBac-S, A: PCR electrophoresis results (1:DL 5000Marker;2: recombinant baculovirus DNA); b: indirect immunofluorescence results; c: westernblot results (1: protein Marker; 2-4: cell supernatant after baculovirus infection; 5: normal Sf9 cell control).

FIG. 2 optimization of expression conditions of BCoVS protein, A: western blot results (1: protein Marker; 2-6: virus-receiving amount 0.005,0.05,0.5,1,2MOI); b: western blot gray value analysis.

FIG. 3 results of mouse serum specific antibody IgG detection.

FIG. 4 analysis of neutralizing antibody titers against mouse serum viruses.

Detailed Description

The present invention will be described in further detail with reference to examples, but the present invention is not limited thereto.

The experimental methods described in the following embodiments are conventional methods unless otherwise specified, and the reagents or apparatus are commercially available.

EXAMPLE 1 preparation of recombinant bovine coronavirus S protein of the invention

1 materials and methods

1.1 materials

1.1.1 Strain and cells

Coli competent cells (DH 5. Alpha., DH10 Bac), sf9 cells, pFastBac-Dual plasmids were maintained by the university of southwest, national institute of livestock and veterinary medicine, preventive veterinary laboratories.

1.1.2 major reagents

Plasmid miniprep kit was purchased from OMEGA Biolabs, bacPAK ^TM Baculovirus titer rapid assay kits were purchased from Takara Bio Inc., hypersensitive ECL chemiluminescent substrate was purchased from Sizhengbai Bio Inc., horseradish peroxidase (HRP) -labeled goat anti-rabbit IgG, HRP-labeled goat anti-mouse IgG were all purchased from Beijing Boossen BioCo., ltd., fluorescein Isothiocyanate (FITC) -labeled goat anti-rabbit IgG, BCA protein concentration assay kits were all purchased from Boston Bioengineering Co., ltd., RIPA lysate was purchased from Thermo Fisher Scientific, protease inhibitor cocktail (general purpose) was purchased from Shanghai Biyun Biotechnology Co., ltd., NE41 animal immunoadjuvant (MF 59 adjuvant), cpG immunopotentiator were all purchased from Beijing Biotechnology Co., ltd.

1.1.3 laboratory animals

Female Balb/c mice of 4-6 weeks of age were purchased from Chengdu laboratory animal Co.

1.2 method

1.2.1 construction and identification of recombinant plasmids

S structural protein of BCoV/SUWN/HXD-4/2021 strain (GenBank: OL 456213.1) is selected as a template, codon optimization and synthesis are carried out on Sf9 cells by a biological engineering (Shanghai) stock company, and the recombinant plasmid pFastBac-Dual-S is obtained by connecting the recombinant plasmid to a pFastBac-Dual vector.

1.2.2 harvesting recombinant bacmid

The pFastBac-Dual-S recombinant plasmid DNA successfully constructed above was transformed into DH10Bac competent cells, and plated onto LB agar plates containing gentamicin, kanamycin and chloramphenicol. After 48h of stationary culture in a carbon dioxide incubator at 37℃blue and white circular colonies were observed, white circular single colonies were picked, positive clones were screened out by colony PCR, and further streaked and purified by a three-wire method to remove false positives. The positive clones were amplified, and the recombinant Bacmid-S was extracted and stored at-20 ℃.

1.2.3 rescue of recombinant baculoviruses

Sf9 cells from a confluent cell culture flask were passaged into six well plates according to Cellfectin ^TM II Reagent transfection Reagent Specification, after stationary culture at 27℃for 96 hours, repeated freeze thawing was performed 3 times, and virus solution was harvested as the first generation virus (P1), and designated as rpFastBac-S. After blind transfer to P4, the virus solution was collected and stored in aliquots at-80 ℃.

1.2.4 identification of recombinant baculoviruses

1.2.4.1 genomic PCR

Extracting genome DNA from P4 virus liquid. Genomic PCR was performed using the DNA of rpFastBac-S as a template.

1.2.4.2 Indirect immunofluorescence

The Sf9 cells in the overgrown cell culture flask are passaged, and the cell concentration is adjusted to 4X 10 by using a special culture medium for Sf9 ⁵ Six-well plates were plated at cell/mL, 2mL per well, and rpFastBac-S was inoculated at a ratio of 3% in the cell culture medium after 8-10 h. Standing at 27deg.C for 48 hr, discarding culture solution, fixing with 80% acetone for 10min, and washing with PBS for 3 times; sealing with 5% skimmed milk for 2h, and washing with PBS for 3 times; taking an Anti-BCoV-S2 protein polyclonal antibody as a primary antibody, incubating for 2h at 37 ℃, and washing 3 times by PBS; FITC-labeled Goat Anti-rabit IgG is used as a secondary antibody, incubated for 1h at 37 ℃ and washed 3 times with PBS; dripping DAPI staining solution, incubating for 10min at room temperature, sucking the clean residual liquid by using absorbent paper, and performing fluorescence microscopy imaging.

1.2.4.3Western blot analysis

The expression of S protein in Sf9 cells was analyzed by Western blot. The sample preparation method is the same as that of 1.5.2, the culture solution is discarded after the static culture is carried out for 48 hours at the temperature of 27 ℃, PBS is used for resuspension cells, the centrifugation is carried out for 5 minutes at 12000rpm, and the supernatant is discarded; cells were lysed by adding 200. Mu.L of RIPA lysate, while adding 2. Mu.L of the universal protease inhibitor, ice-bathing for 15min, centrifuging again, collecting supernatant, adding SDS-PAGE loading buffer, and heating at 95℃for 5min to complete sample preparation. Taking 5% skimmed milk as a sealing solution, horizontally shaking and incubating for 2h at 37 ℃, and washing with TBST for 3 times; taking an Anti-BCoV-S2 protein polyclonal antibody as a primary antibody, horizontally shaking at 4 ℃ for incubation overnight, and washing with TBST for 3 times; HRP-labeled Goat Anti-rabit IgG is used as a secondary antibody, incubated for 2h by horizontal shaking at 37 ℃, and washed 3 times by TBST; the bands of interest were observed using development of a hypersensitive ECL chemiluminescent substrate.

1.2.5 determination of recombinant baculovirus titres

According to BacPAK ^TM Baculovirus titer rapid assay kit instructions, titer of P4 recombinant baculovirus rpFastBac-S was determined.

1.2.6 optimization of the Effect of different infection doses on protein expression

rpFastBac-S was infected with Sf9 cells at moi=0.005, moi=0.05, moi=0.5, moi=1, moi=2, respectively, and after 3 days, the supernatant was discarded, the cells were collected, and protein expression was detected by Western blot.

1.2.7 harvesting of S protein and preparation of immunogens

rpFastBac-S was used to infect Sf9 cells at the optimal multiplicity of infection, cell culture broth was harvested after 3 days, centrifuged at 3000rpm for 20min to remove cell debris, the supernatant collected for ultracentrifugation purification at 4℃at 30000rpm for 2h, and the pellet was resuspended in PBS after centrifugation was completed. Protein concentration was measured using BCA protein concentration assay kit and stored in aliquots at-80 ℃ for future use.

2 experimental results

2.1 construction of recombinant plasmids

The S gene is used as a template, codon optimization is carried out on insect cells, CAI (codon adaptation index) is adjusted to 0.87 from 0.39, average GC content is adjusted to 50.6% from 35.8%, and a recombinant plasmid pFastBac-Dual-S is obtained by using a gene synthesis technology (when gene synthesis is carried out, a Kozak sequence is added in front of a translation initiation codon, and enzyme cleavage sites BamHI and EcoRI are added at the N end and the C end of the sequence for connecting vectors respectively).

Optimized complete S gene sequence (SEQ ID NO. 1):

ATGTTCCTGATCCTCCTGATCAGCCTCCCCACTACATTCGCCGTGATCGGTGACCTGAAATGCACAACAGTTAGCATCAATGACGTTGACACTGGTGGACCTAGCATCTCAACTGACACAGTTGACGTGACTAACGGACTGGGCACATACTACGTCTTGGACCGCGTGTACCTGAACACAACTCTCCTCCTGAACGGCTACTACCCCACTAGCGGTTCTACCTACAGGAACATGGCCTTGAAGGGAACCCTGCTCCTGAGTACCTTGTGGTTCAAGCCCCCCTTCCTGTCTGACTTCACTAACGGCATCTTCGCTAAGGTTAAGAACACTAAAGTGATTAAGGACGGCGTGATGTACTCCGTGTTCCCAGCTATCACAATCGGTAGCACTTTCGTTAACACTTCCTACTCCGTGGTCGTCCAGCCACACACTACTATCTTGGGTAACAAGCTGCAGGGATTCCTCGAAATCAGCGTGTGCCAATACACAATGTGTGAATACCCTAATACTATCTGTAACTCTAACCTCGGTAACAGACGTGTTGAGCTGTGGCACTGGGACACCGGTGTTGTGTCCTGCCTGTATAAACGTAACTTCACATACGACGTTAACGCTGATTACCTCTACTTCCACTTCTACCAAGAAGGAGGCACCTTCTACGCTTACTTCACTGACACCGGAGTGGTGACTAAGTTCCTGTTCAACGTCTACCTCGGCACCGTCCTGAGTCACTACTACGTCATGCCCTTGACATGCAACTCAGCTCTGACTCTGGAGTTCTGGGTGACCCCTCTGACATCTAAGCAATACTTGCTGGCCTTCAACCAGGACGGAGTTATCTTCAACGCCGTTGACTGTAAGTCTGACTTCATGAGTGAGATCAAGTGTAAAACACTGTCCATCGCCCCCTCTACAGGCGTGTACGAACTCAATGGTTACACTGTCCAGCCCATCGCTGACGTTTACCGCCGTATCCCCAACCTCCCTGATTGTAACATCGAAGCCTGGCTGAACGATAAGAGCGTTCCTAGCCCCTTGAACTGGGAACGTAAGACCTTCTCAAACTGTAACTTTAACATGAGCTCTTTGATGTCATTCATCCAGGCTGATAGCTTCACCTGTAACAACATCGACGCCGCTAAGATCTACGGTATGTGTTTCTCCTCAATCACCATCGATAAGTTCGCTATCCCTAACGGCCGTAAGGTCGATCTGCAATTGGGTAACCTCGGCTACTTGCAAAGTTTTAACTACCGTATTGACACCACAGCCACATCTTGTCAACTCTACTACAACCTGCCCGCTGCTAACGTTAGCGTTAGTCGTTTCAATCCAAGCACTTGGAACAGGCGCTTCGGCTTCACTGAGCAGTCAGTTTTCAAGCCCCAACCTGCCGGCGTTTTCACTGATCATGACGTCGTTTACGCTCAGCACTGTTTCAAGGCCCCCACCAACTTCTGTCCATGCAAGCTGGATGGATCACTCTGTGTTGGCTCCGGCTCCGGTATCGATGCCGGATACAAGCACACCGGCATCGGCACATGTCCCGCTGGTACTAACTACTTGACCTGTCACAACGCTGCCCAGTGCGACTGTCTGTGCACTCCTGACCCAATCACATCTAAGGCTACAGGTCCTTACAAGTGCCCCCAGACTAAGTATCTCGTGGGAATCGGAGAACACTGTTCCGGTTTGGCCATTAAGAGTGATCACTGTGGCGGAAACCCCTGCTCCTGTCAACCTCAGGCCTTCTTGGGTTGGTCCGTTGACTCTTGCTTGCAGGGTGACCGATGTAACATCTTCGCTAATTTCATCCTGCACGACGTGAACAGCGGAACCACCTGTTCTATCGACTTGCAAAAATCAAATACTGACATTATCCTAGGAGTGTGCGTGAACTACGACCTCTACGGTATAACAGGCCAAGGAATCTTCGTGGAGGTTAACGCTACATACTACAACTCCTGGCAGAACTTGTTGTACGATAGCAACGGTAACCTGTACGGTTTCCGCGACTACCTCACTAACCGTACATTCATGATCCGCTCTTGTTACAGCGGTAGAGTTTCAGCTGCCTTTCACGCTAACTCTTCAGAACCCGCTCTCCTCTTCCGCAACATTAAGTGTAACTACGTGTTTAATAACACCCTGCTGAGGCAGCTCCAACCCATCAATTACTTTGATAGCTACTTGGGTTGCGTTGTGAACGCCGACAACAGTACCAGCTCAGTTGTTCAGACTTGCGACCTGACCGTCGGCTCCGGCTACTGTGTTGACTACAGCACCAAGCGTAGATCTAGACGCAGCATCACAACCGGTTACCGCTTCACTAACTTTGAACCCTTCACAGTTAACTCTGTCAACGACTCTTTGGAACCAGTCGGTGGTCTGTACGAGATCCAGATCCCTTCTGAGTTCACAATCGGCAACATGGAAGAGTTCATCCAAACAAGTAGCCCTAAGGTGACTATCGATTGTAGTGCCTTCGTTTGTGGTGACTACGCCGCCTGTAAGTCACAGTTGGTCGAATACGGCAGCTTCTGTGACAACATCAACGCCATCCTCACAGAGGTGAATGAGCTCTTGGACACCACTCAGCTCCAAGTCGCTAACTCATTGATGAACGGTGTGACTCTGAGTACTAAGTTGAAGGACGGCGTCAACTTTAACGTTGATGACATCAACTTCTCACCAGTCCTGGGATGCTTAGGTAGTGACTGTAACAAGGTCTCATCTCGTTCTGCTATCGAGGACCTCCTGTTTAGTAAGGTTAAGTTGGCCGACGTTGGTTTCGTCGAAGCTTACAATAACTGTACAGGAGGAGCTGAAATTCGTGACCTCATTTGCGTGCAATCTTACAACGGTATCAAGGTTCTGCCACCTCTCCTGTCTGAAAACCAAATCTCAGGCTACACCCTGGCCGTCACCAGCGCTTCTCTCTTCCCTCCCTGGAGCGCTGCCGCCGGCGTGCCCTTCTACCTCAACGTGCAGTACAGGATCAACGGTATCGGAGTGACAATGGACGTTCTGAGTCAAAACCAGAAGTTGATTGCTAACGCCTTCAACAACGCTCTCGGTGCCATCCAGGAAGGTTTTGACGCCACAAATAGCGCCCTCGTGAAGATCCAAGCTGTTGTCAACGCTAACGCCGAAGCTTTGAACAACCTGCTGCAGCAGTTGTCCAATCGTTTCGGCGCTATCTCATCTTCTCTGCAGGAAATCCTGTCACGCCTCGACGCCCTAGAAGCTCAGGCTCAAATCGATCGCCTCATCAACGGTCGCCTGACAGCCCTCAACGCCTACGTTTCCCAGCAATTGAGCGACTCCACACTGGTCAAGTTTAGCGCCGCTCAGGCCATGGAGAAGGTGAACGAGTGCGTTAAGAGTCAATCCTCACGTATCAACTTCTGCGGTAACGGTAACCACATCATCAGCCTAGTCCAAAACGCCCCTTACGGACTCTACTTCATCCACTTCTCCTACGTTCCAACCAAGTACGTGACCGCTAAAGTCAGCCCTGGACTCTGCATCGCCGGAGATCGTGGTATCGCTCCTAAATCAGGTTACTTCGTGTACGTGAACAACACATGGATGTTCACTGGTAGCGGCTACTACTACCCAGAACCAATCACCGGAAACAATGTCGTGGTCATGAGCACATGCGCCGTTAACTACACTAAGGCTCCTGACGTCATGCTGAACATCTCTACTCCCAACTTGCCAGACTTTAAGGAGGAACTGAACCAGTGGTTCAAGAACCAAACATCCGTTGCTCCTGACCTGAGCCTCGATTACATCAACGTTACCTTCCTCGACCTGCAAGACGAGATGAACCGCCTGCAAGAAGCCATCAAGGTCCTGAACCAGTCTTACATCAATCTGAAGGACATCGGCACCTACGAGTACTACGTGAAGTGGCCATGGTACGTTTGGTTGCTGATCGGTTTCGCTGGAGTCGCCATGCTGGTCCTGCTCTTCTTCATCTGCTGCTGCACAGGCTGCGGTACTTCCTGCTTTAAGAAGTGCGGCGGCTGCTGCGACGACTACACCGGATACCAGGAACTCGTGATCAAGACTAGCCACGAAGATTAA

2.2 harvesting recombinant bacmid and rescue and identification of recombinant baculoviruses

The recombinant plasmid constructed successfully is transformed into DH10Bac to carry out homologous recombination to obtain recombinant bacmid, recombinant baculovirus rpFastBac-S is harvested after Sf9 cells are transfected, and when the rescued recombinant baculovirus rpFastBac-S is passaged to the fourth generation, typical lesions appear on the Sf9 cells, which are manifested by slow cell growth and enlarged rounding.

To verify whether the recombinant baculovirus rpFastBac-S was constructed successfully, we identified it by a PCR, westernblot, IFA experiment.

The identification result is shown in figure 1, and figure 1A shows that the expected band appears near 4000bp after the DNA of the fourth generation recombinant baculovirus is extracted and the S gene specific primer is used for PCR identification and agarose gel electrophoresis, thus indicating that the harvested recombinant baculovirus correctly expresses the S target protein gene; the primary antibody of the IFA experiment is an Anti-BCoV-S2 protein polyclonal antibody, and the test group can be observed to generate very bright green fluorescence by using an inverted fluorescence microscope (figure 1B), which shows that the constructed baculovirus effectively expresses the S target protein; the supernatant of the culture solution after the recombinant baculovirus rpFastBac-S is infected with Sf9 cells for 48 hours is collected, western blot analysis is carried out by using Anti-BCoV-S2 protein polyclonal antibody, and the result shows that the recombinant baculovirus rpFastBac-S can be specifically combined with the Anti-BCoV-S2 protein polyclonal antibody (figure 1C), so that the S target protein can be effectively expressed after the recombinant baculovirus is infected with Sf9 cells, and the protein has better reactivities.

2.3 baculovirus titer assay

After the completion of the identification, the titer of the fourth-generation recombinant baculovirus rpFastBac-S was 1.013X10 using the kit ⁷ IFU/mL shows that the fourth generation recombinant baculovirus has good quantity and density, meets the requirement, can be used for inoculation of Sf9 cells, and can express a large amount of proteins.

2.4 optimization of the Effect of different infection doses on protein expression

rpFastBac-S was infected with Sf9 cells at moi=0.005, moi=0.05, moi=0.5, moi=1, moi=2, respectively, and after 3d, western blot was used to detect protein expression. FIG. 2 shows that the S protein expression level is highest at an MOI of 0.5, so that it is the optimal infection condition when a large amount of protein is expressed.

Therefore, the invention can effectively prepare a large amount of bovine coronavirus S protein.

EXAMPLE 2 preparation of bovine coronavirus S protein subunit vaccine of the invention

The recombinant bovine coronavirus S protein (rpFastBac-BCoV-S) prepared in example 1 was taken and mixed with an equal volume of MF59 adjuvant and 20. Mu.g of CpG immunopotentiator.

The following test examples specifically illustrate the beneficial effects of the present invention:

test example 1 evaluation of immunogenicity of recombinant bovine coronavirus S protein in mice

1. Scheme design of rpFastBac-BCoV-S immunized mice

24 female Balb/c mice with the age of 4-6 weeks are purchased and randomly divided into 3 groups, namely an S protein group, an inactivated virus group and an adjuvant control group, and 8 female Balb/c mice are purchased in each group. Intramuscular injections were used.

The S proteome immunized 50 μg protein per time; each inactivated virus group was immunized with 200. Mu.L of the inactivated virus liquid (dose 2X 10) ^4.67 TCID ₅₀ ) The adjuvant control group was immunized 50 μl each of MF59 adjuvant, wherein the S protein group and the inactivated virus group were mixed with equal volumes of MF59 adjuvant and 20 μg cpg immunopotentiator.

BCoV inactivated virus liquid: the preparation method is stored for a preventive veterinary laboratory of the university of southwest national livestock and veterinary medical college: fully and uniformly mixing beta-propiolactone and virus liquid according to the volume ratio of 1:1000, and standing for 10-12 h at 4 ℃ to obtain the inactivated virus liquid.

The first and second immunity is carried out by 14d, blood collection is carried out before immunization, 7d for first immunity, 14d for first immunity, 7d for second immunity and 14d for second immunity, and serum is collected for standby.

2. Indirect ELISA test for detecting serum specific antibody level of mice

According to the indirect ELISA antibody detection method established in the laboratory and based on the BCoV S2 recombinant protein, the collected serum sample is subjected to specific antibody level detection.

The BCoV S2 protein obtained by prokaryotic expression (the used expression vector is pET-28a (+) and is obtained by prokaryotic expression system preparation) is diluted to 0.1 mu g/mL by 50mM Tris-HCL solution, 100 mu L of each hole is coated with 1h of post-waste liquid at 37 ℃, and PBST is washed three times; 100 mu L of 5% skimmed milk is added into each hole, the mixture is sealed for 1h at 37 ℃, and PBST is washed three times; taking collected mouse serum as a primary antibody, carrying out gradient dilution on the primary antibody by using 2% cold water fish skin gelatin, incubating for 1h at 37 ℃ for discarding liquid at 100 mu L of each hole, and washing by using PBST for three times; HRP-labeled goat anti-mouse IgG was diluted with 2% cold water fish skin gelatin at 1:10000, incubated at 37 ℃ for 1h per well at 100 μl, and washed three times with PBST; adding TMB color development solution, incubating at 37deg.C in dark for 10min, adding stop solution to stop reaction, and reading OD with enzyme-labeled instrument _450nm Values.

The experimental results are shown in FIG. 3. It can be seen that the antibody level of the S protein group mice starts to rise after one week of first immunization, and continuously rises after the second immunization, the specific antibody titers of the second immunization 7d and 14d are obviously higher than those of the inactivated virus group and the adjuvant control group, and the highest specific antibody titer of the second immunization 14d reaches 1:12800.

Therefore, after mice are immunized by the bovine coronavirus S protein, the bovine coronavirus S protein can generate high-level specific IgG antibodies, and the antibody level is higher than that of an adjuvant control group (P < 0.001).

3. Trace neutralization assay to detect mouse serum neutralizing antibody levels

The collected primary, secondary, and secondary 7d, 14d serum groups were subjected to BCoV neutralizing antibody detection.

The method comprises the following steps: passaging HCT-8 cells growing on a cell culture flask to a 96-well plate, and standing and culturing at 37 ℃ for 8-10 h; inactivating the mouse serum at 56 ℃ for 30min, diluting with DMEM medium without serum and double antibody by 2 times, and mixing with 200TCID ₅₀ BCoV mixing, and sensing for 1h in a 37 ℃ incubator; taking out 96-well plate containing HCT-8 cells, discarding liquid, washing with PBS for 2 times, adding the mixed culture solution after sensing into 96-well plate, culturing for 96 hr, observing and recording pathological changes of each well, and performing Reed-muech two-step methodThe titers of serum neutralizing antibodies were calculated.

As shown in fig. 4, it is clear that S proteome mice produced neutralizing antibodies against BCoV 1 week after the first immunization, titers were 1:20-1:40, statistically significantly different (x, P < 0.05) compared to MF59 adjuvant control, and the neutralizing antibody titers increased continuously with time, and reached up to 1:224 after 14d of second immunization. After 14d of immunization, the mean value of neutralization titers of the S protein group was higher than that of the inactivated virus group, but the neutralization antibody titers were comparable, and the statistical differences were not significant (P > 0.05).

Therefore, after mice are immunized by the bovine coronavirus S protein, high-level neutralizing antibodies can be rapidly generated.

In conclusion, the baculovirus expression system is utilized to express the bovine coronavirus complete BCoV S protein, and after mice are immunized, high-level specific IgG antibodies and neutralizing antibodies can be generated, so that the BCoV S protein prepared by the invention has good immunogenicity, and theoretical basis is provided for the research of bovine coronavirus subunit vaccines.

Claims

1. A preparation method of recombinant bovine coronavirus S protein is characterized in that: the coding gene of the bovine coronavirus S protein is optimized, and then the S protein is expressed by recombinant baculovirus, wherein the nucleotide sequence of the optimized S gene is shown as SEQ ID NO. 1.

2. The method of manufacturing according to claim 1, characterized in that: it comprises the following steps:

3. The preparation method according to claim 2, characterized in that: in the step a, the baculovirus expression vector is a pFastBac-Dual plasmid; the competent cells were DH10Bac competent cells.

4. The preparation method according to claim 2, characterized in that: in the steps b and c, the insect cells are Sf9 cells.

5. The preparation method according to claim 2, characterized in that: in the step b, the passage is from the culture to the generation P4.

6. The preparation method according to claim 2, characterized in that: in the step c, the MOI value of the recombinant baculovirus infection is 0.5.

7. A bovine coronavirus subunit vaccine characterized by: it is obtained by fully and uniformly mixing the recombinant S protein prepared by any one of claims 1-6 and a pharmaceutically acceptable adjuvant.

8. The subunit vaccine of claim 7 wherein: the adjuvant is CpG and/or MF59.

9. The subunit vaccine of claim 8 wherein: and mixing and emulsifying the recombinant S protein and MF59 and CpG according to a volume ratio of 50:50:20.

10. Use of a bovine coronavirus recombinant S protein prepared according to any one of claims 1 to 6, a subunit vaccine according to any one of claims 7 to 9 for the preparation of a bovine coronavirus subunit vaccine.