CN117159581A - Application of piRNA antisense nucleotide pharmaceutical composition as aortic valve calcification prevention and treatment drug - Google Patents

Abstract

The application relates to application of a piRNA antisense nucleotide pharmaceutical composition as an aortic valve calcification prevention and treatment drug. The piRNA antisense nucleotide pharmaceutical composition comprises piRNA antisense nucleotides and a vector; the piRNA antisense nucleotide sequence is: 5'-GGCAGGCGAGAATTCTACCACTGAACCACCAA-3'; the carrier is one or more of nano particles, liposome, chitosan and CRISPR-cas9 gene editing system. According to the application, through the research on the relationship between the pi RNA and the aortic valve calcification and the osteogenic differentiation of human valve mesenchymal cells, the pi RNA related to the aortic valve calcification can promote the aortic valve calcification in vivo and in vitro. The piRNA antisense nucleotide pharmaceutical composition is used for preventing and treating human aortic valve mesenchymal cell osteogenic differentiation and mouse aortic valve calcification; the raw materials are scientific and reasonable, the preparation is simple, the preparation can be used as an effective medicament for treating calcified aortic valve diseases, and a new non-operative treatment scheme is provided for treating the calcification of the aortic valve.

Description

Application of piRNA antisense nucleotide pharmaceutical composition as aortic valve calcification prevention and treatment drug

Technical field:

the application relates to the field of biological medicine, in particular to application of a piRNA antisense nucleotide pharmaceutical composition as an aortic valve calcification prevention and treatment medicine.

The background technology is as follows:

calcified aortic valve disease (calcific aortic valve disease, CAVD) is an advanced senile disease with high morbidity and mortality, and the main pathophysiological change is the proliferation and calcification of aortic valve leaflet fibers, which leads to valve stiffening and causes hemodynamic changes, affecting heart function. The only treatment available to date for calcified aortic valve disease is surgery or transcatheter active valve replacement, however, both treatments tend to result in various complications that may occur during and/or at any time after surgery. No drug has been shown to effectively prevent or reduce progression of CAVD; intervention against the risk factors of CAVD, such as lipid lowering therapy, cannot prevent progression of CAVD. Studies have demonstrated that the phenotypic shift of human aortic valve stromal cells (hVICs) to an osteoblast-like phenotype is a fundamental hallmark of Aortic Valve Calcification (AVC). Thus, an effective strategy to delay the differentiation of human valve stromal cells into osteoblasts might help to prevent progression of CAVD. During the last few years, the number of studies on the critical regulatory role of non-coding RNAs (ncrnas) in cardiovascular disease has proliferated. Studies have also revealed a key role for ncRNA in regulating aortic valve calcification and osteogenic differentiation. Of the different types of ncRNAs, PIWI-interacting RNAs (piRNAs) have been identified as a new class of small ncRNAs 21-35 nucleotides in length. In addition to mammalian germ line, piRNA is also expressed in the cardiovascular system, and their role in regulating various cardiovascular pathophysiological processes has been gradually recognized. In addition, piRNA is a novel regulator of cardiac differentiation, repair and regeneration. Nonetheless, little is currently known about whether and how piRNA modulates aortic valve calcification osteogenic differentiation.

The application comprises the following steps:

(one) solving the technical problems

Against the background, the application develops and researches the relationship between the piRNA and the calcification of the aortic valve and the osteogenic differentiation of human valve mesenchymal cells, and proves that the pi RNA related to AVC can promote the calcification of the aortic valve in vivo and in vitro. Therefore, the pi RNA deficiency related to the aortic valve calcification is possibly a novel strategy for treating the CAVD, and simultaneously proves that the antisense nucleotide pharmaceutical composition of the pi RNA related to the aortic valve calcification has remarkable inhibition effect on the bone differentiation of human aortic valve mesenchymal cells and the aortic valve calcification of mice, and opens up wider prospect for the non-operative treatment of the aortic valve calcification.

(II) technical scheme

In order to solve the technical problems, the application provides application of a piRNA antisense nucleotide pharmaceutical composition as an aortic valve calcification prevention and treatment drug, wherein the baseID of the piRNA is hsa-piR-25624, the nucleotide sequence of the piRNA is shown as SEQ ID NO. 1,

the method comprises the following steps: TTGGTGGTTCAGTGGTAGAATTCTCGCCTGCC;

the piRNA antisense nucleotide pharmaceutical composition comprises piRNA antisense nucleotides and a vector;

the antisense nucleotide sequence of the piRNA is shown as SEQ ID NO. 4,

the method comprises the following steps: 5'-GGCAGGCGAGAATTCTACCACTGAACCACCAA-3';

the carrier is one or more of nano particles, liposome, chitosan and CRISPR-cas9 gene editing system.

The application provides application of a piRNA antisense nucleotide pharmaceutical composition in preparing an osteoblast differentiation inhibitor for human aortic valve mesenchymal cells. The application comprises the application of the piRNA antisense nucleotide pharmaceutical composition as osteogenic marker genes Osterix and Runx2 inhibitor induced by osteogenic differentiation culture medium in human aortic valve mesenchymal cell osteogenic differentiation.

The application provides application of a piRNA antisense nucleotide pharmaceutical composition in preparing a mouse aortic valve calcification inhibitor. Such uses include knock-down of AVC-related piRNA with piRNA antisense nucleotides (antagomir) effective in inhibiting high-lipid high-cholesterol diet-induced increases in mouse aortic valve calcium deposition and increases in expression of calcification marker genes Runx2 and Osterix.

The application provides application of a reagent for detecting the expression level of an aortic valve calcification-related PiRNA in preparing a medicament for diagnosing calcified aortic valve diseases.

Further, the detection reagent of the aortic valve calcification related PiRNA is a PCR detection reagent.

(III) beneficial effects

The application has the beneficial effects that:

(1) The application proves that the expression level of the aortic valve calcification-related PiRNA gene in the calcified aortic valve tissue of the human is obviously higher than that of the normal aortic valve tissue by detecting the aortic valve calcification-related PiRNA gene expression in the calcified aortic valve tissue of the human, and prompts that the aortic valve calcification-related PiRNA can be used as a diagnosis marker of calcified aortic valve diseases;

(2) According to the application, the influence of the aortic valve calcification related PiRNA on the bone formation differentiation of human aortic valve mesenchymal cells and the aortic valve calcification of mice is researched, so that the aortic valve calcification related PiRNA antisense nucleotide pharmaceutical composition can obviously inhibit the bone formation differentiation capacity of human aortic valve mesenchymal cells and the aortic valve calcification degree of mice, and a new thought is provided for the anti-aortic valve calcification treatment by taking the aortic valve calcification related PiRNA as a target point.

Description of the drawings:

in order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings that are required to be used in the embodiments will be briefly described below.

FIG. 1 is a graph of changes in aortic valve calcification-related PiRNA expression levels in human normal aortic valve tissue and human calcified aortic valve tissue;

FIG. 2 is a graph showing the inhibition of human valve stromal cell osteogenic differentiation by aortic valve calcification-associated PiRNA antisense nucleotide pharmaceutical compositions in vitro:

FIG. 3 is a graph showing the inhibition of aortic valve calcification in mice by aortic valve calcification-associated PiRNA antisense nucleotide pharmaceutical compositions in vivo.

The specific embodiment is as follows:

in order to enable those skilled in the art to more clearly understand the technical scheme of the present application, the technical scheme of the present application will be described in detail with reference to specific embodiments.

Example one identification of aortic valve calcification correlation piRNA (AVCAPIR)

To identify aortic valve calcification-associated piRNA, piRNA sequencing was performed using 4 human Calcified Aortic Valves (CAVs) and 4 normal controls. Screening was performed with Fold Change (FC). Gtoreq.2 and P < 0.05). The first 20 differentially expressed pirnas (10 upregulation and 10 downregulation) arranged in fold change were shown by hierarchical clustering, with the upregulation of hsa-piR-25624 being most pronounced, as shown in figure 1 a.

Next, quantitative polymerase chain reaction (qRT-PCR) was performed in time to verify their expression levels in 50 pairs of human aortic valve samples (50 CAVs and 50 normal controls), as shown in fig. 1B. Further sequence analysis showed that hsa-piR-25624 (chr 16:70778246 to 70778278 located in the human genome) is highly conserved in humans, mice and other mammals, as shown in FIG. 1C. Thus, hsa-piR-25624 is herein renamed as aortic valve calcification-related piRNA, i.e. AVCAPIR, hereinafter AVCAPIR refers to aortic valve calcification-related piRNA with a baseID of hsa-piR-25624.

The specific experimental scheme is as follows:

1. RNA extraction

1) Tissue treatment: about 50mg of aortic valve tissue is taken, 1ml of Trizol reagent is added after liquid nitrogen is ground to be satisfied, shaking homogenization is carried out, after full lysis, centrifugation is carried out at 12000rpm and 4 ℃ for 15 minutes, and supernatant is taken.

2) 200ul of chloroform was added, and the mixture was stirred and mixed well, and then left at room temperature for 15 minutes.

3) Centrifugation at 12000rpm at 4℃for 15 min, separation of the three layers, taking the upper aqueous phase into a new enzyme-free EP tube, adding an equal volume of isopropanol, mixing well, standing at room temperature for 10 min, and precipitating RNA.

4) Centrifugation was carried out at 12000rpm at 4℃for 15 minutes, the supernatant was carefully removed, and RNA was precipitated and the bottom of the tube.

5) 1ml of 75% ethanol was added to each 1ml of Trizol, and the mixture was inverted and homogenized.

6) Centrifuging at 4deg.C for 5 min at 8000g, removing supernatant, and sun drying at room temperature (5-10 min).

7) An appropriate amount of DEPC water was added to dissolve RNA, and the concentration of RNA was measured. Reverse transcription was performed according to the quantitative result.

8)RNA A260/A280＝1.8-2.1

2. cDNA reverse transcription

9) Kit reverse transcription System (10 ul) from TAKARA Co., ltd., japan:

reaction conditions: reverse transcription reaction at 37℃for 15 min; inactivation of 5s reverse transcriptase at 85 ℃; at 4 ℃, the reaction is finished, and the product is cDNA.

QRT-PCR detection of AVCAPIR expression in normal and calcified aortic valve tissues adopts AVCAPIR amplification forward primer sequence as shown in SEQ ID NO. 2 in the sequence table:

5′-AACAAGTTGGTGGTTCAGTGGTAGAATT-3′；

the reverse primer sequence is shown as SEQ ID NO:3, shown in the following:

5′-GTCGTATCCAGTGCAGGGTCC-3′。

3. the experimental system comprises:

1) Reaction conditions:

95 ℃ for 2 minutes; 40 cycles (95 ℃,10 seconds; 60 ℃,60 seconds); 60-95 DEG C

Dissolution profile.

2) After the amplification in the machine, the amplification curve and the dissolution curve are confirmed after the reaction is finished, and the expression intensity of each gene is calculated according to the CT value (threshold cycle values) and the T test.

3) qRT-PCR results

The results are shown in FIG. 1B. The expression of AVCAPIR was examined in 50 normal aortic valve tissues and 50 calcified aortic valve tissue samples, and the results showed that AVCAPIR was significantly upregulated in calcified aortic valve tissues compared to normal aortic valve tissues.

Example two AVCAPIR antisense nucleotide pharmaceutical composition inhibits human valve mesenchymal cell osteogenic differentiation

This example evaluates the effect of AVCAPIR on human valve stromal cell osteogenic differentiation in vitro. The pharmaceutical composition of the AVCAPIR antisense nucleotide comprises the AVCAPIR antisense nucleotide and a pharmaceutically acceptable carrier; the adopted AVCAPIR antisense nucleotide sequence is shown in SEQ ID NO. 4 in the sequence table:

5′-GGCAGGCGAGAATTCTACCACTGAACCACCAA-3′；

the carrier is one or more of nano particles, liposome, chitosan and CRISPR-cas9 gene editing system, preferably liposome nano particles, and the content of the AVCAPIR antisense nucleotide in the pharmaceutical composition is 0.5-1 g.

The specific experimental scheme is as follows:

1. the AVCAPIR antisense nucleotide sequence was designed and synthesized by the biotechnology company, guangzhou Ji Ma. The AVCAPIR antisense nucleotide sequence is shown in SEQ ID NO. 4 in the sequence table:

5′-GGCAGGCGAGAATTCTACCACTGAACCACCAA-3′，

the antisense strand sequence of the negative control group is shown as SEQ ID NO. 5:

5′-GCTGCAACGTCAACAGGAACTACCCAACAGGT-3′。

2. human valve mesenchymal cells are transfected by AVCAPIR antisense nucleotide drug combination

1) Human valve stromal cells were seeded in 6-well plates, after cell confluence reached 80%, reference was made to literature (Gao XQ, zhang YH, liu F, ponnusamy M, zhao XM, zhou LY, zhai M, liu CY, li XM, wang M, shan C, shan PP, wang Y, dong YH, qian LL, yu T, ju J, wang T, wang K, chen XZ, wang YH, zhang J, li PF and Wang k.the piRNA CHAPIR regulates cardiac hypertrophy by controlling METTL-dependent N (6) -methyladenosine methylation of Parp mrna. Nature cell biology.2020; 22:1319-1331.), transfected with AVCAPIR antisense nucleotide (AVCAPIR antisense nucleotide is a sequence fully reverse complementary to the AVCAPIR sequence, 5'-GGCAGGCGAGAATTCTACCACTGAACCACCAA-3', binding to AVCAPIR to inhibit AVCAPIR expression), after 24 hours of transfection, cells were harvested after 14 days of culture in osteogenic differentiation induction medium, and changes in expression of calcification marker gene RUNX2, osterix proteins were detected by western blot. After 21 days of culture, alizarin red staining and calcium quantitative analysis were performed to examine the effect of different treatments on valve stromal cell osteogenic differentiation.

2) Valve mesenchymal cell osteogenic differentiation induction method

After each group of cells was transfected for 24 hours, the confluency of the cells was observed, human valve stromal cells with a culture density of about 90% were starved overnight with DMEM high sugar medium containing 2% fetal bovine serum, osteogenic differentiation induction was performed on human valve stromal cells with newly prepared osteoinductive medium (50 mg/mL vitamin C,5mmol/L β -glycerophosphate, 100nmol/L dexamethasone, high sugar DMEM medium containing 2% fetal bovine serum as the solvent) every three days, and the liquid was changed every 14 days.

3. Analysis of results

The osteogenesis induction culture medium is induced for 14 days, and the western blot detects the expression change of the calcification marker gene RUNX2 and Osterix protein. And (3) inducing the osteogenesis induction culture medium for 21 days, and carrying out alizarin red staining and calcium quantitative analysis and detection. The results are shown in figure 2, and compared with the control group, the expression of the AVCAPIR antisense nucleotide group calcification marker genes RUNX2 and Osterix protein is obviously reduced, and the expression of the AVCAPIR antisense nucleotide group calcification marker genes RUNX2 and Osterix protein is shown in figure 2A; alizarin red-stained positive calcium nodules were significantly reduced, as shown in fig. 2B; the amount of calcium salt deposited was also significantly reduced, as shown in figure 2C.

Example three AVCAPIR antisense nucleotide pharmaceutical combinations to inhibit aortic valve calcification in mice

This example evaluates the effect of AVCAPIR knockdown on a mouse aortic valve calcification valve in vivo. Using ApoE ^-/- Background mice, using CRISPR-cas9 gene editing system, realize in vivo AVCAPIR knockout of mice, construct AVCAPIR/ApoE double knockout mice (AVCAPIR/ApoE DKO), animal gene knockout experiments are completed by Suzhou Sier creatures, and the sequence of guide RNA (sgRNA) is shown as SEQ ID NO:6 and SEQ ID NO:7 in the sequence table:

gRNA1 (ATTCTCGCCTGCCACGCGGG) and gRNA2 (CTGAACCACCAATGCAGACA).

The specific experimental method is as follows:

1. CAVD animal model grouping

Selecting 40 male ApoE with 4 weeks of age ^-/- Mice, 20 of which passed CRISPR-cas9 gene editing lineAfter construction of AVCAPIR/ApoE double knockout mice (AVCAPIR/ApoE DKO), the mice were divided into 4 groups:

(1) Normal diet + control group (ApoE ^-/- )，n＝10；

(2) High cholesterol diet + control group (ApoE ^-/- )，n＝10；

(3) Normal diet + AVCAPIR/ApoE double knockout mice (AVCAPIR/ApoE DKO), n=10;

(4) High cholesterol diet + AVCAPIR/ApoE double knockout mice (AVCAPIR/ApoE DKO), n=10.

Diet induction began at 8 weeks of age. Aortic valve specimens were obtained 24 weeks later.

2. Mouse aortic valve specimen acquisition

After the cardiac ultrasound test was completed, the mice fasted for one day. The following day, 10% chloral hydrate was induced under anesthesia, a clear surgical field was established under the scope, the aortic root was rapidly detached about 5mm away, and the aortic valve tissue of the mice was obtained and then divided into two groups: one set fixed whole heart tissue with 4% paraformaldehyde. Reference (Wang Y, han D, zhou T, chen C, cao H, zhang JZ, ma N, liu C, song M, shi J, jin X, cao F and Dong N.DUSP26 induces aortic valve calcification by antagonizing MDM2-mediated ubiquitination of DPP4 in human valvular interstitial cells. European heart journ.2021; 42:2935-2951.) paraffin-embedded posterior aortic valve tissue sections. Red staining of the slice; a set of reference examples were performed to extract total RNA from tissues and to detect the expression of RUNX2 and Osterix mRNA from each set of calcification marker genes.

3. Alizarin red staining of aortic valve sections of mice

1) And dewaxing the slices. Sequentially placing paraffin sections of the heart valve of the mouse into a xylene solution for 20 minutes; absolute ethanol, 20 minutes; absolute ethanol, 5 minutes; 75% alcohol for 5 minutes; and (5) flushing with tap water.

2) Alizarin red staining: the tissue was streaked out of the pen and alizarin red was stained for 10 minutes.

3) The slices are baked in an oven at 65 ℃.

4) The gel is transparent to xylene for 5 minutes for 2 times, and the gel is sealed.

5) Microscopic examination, photographing and analysis.

4. Analysis of results

AVCAPIR knockout significantly reduced ApoE in high fat diet groups ^-/- Aortic valve calcification in mice

Success in ApoE ^-/- Mice were fed with a high fat diet for 24 weeks after in vivo knockout of AVCAPIR (see figure 3, a, mulberk sequencing assay). After molding, the calcium salt deposition content and the calcification degree of the valve tissues of the mice are evaluated by alizarin red staining, and the expression of the calcification marker genes RUNX2 and Osterix mRNA of each group is detected by qRT-PCR detection. The results show that in the high-fat diet mice, AVCAPIR knockout significantly reduced the extent of aortic valve She Gaihua (see fig. 3B) and calcification marker gene RUNX2, osterix mRNA expression, reducing the deposition content of valve She Gaiyan (see fig. 3C).

In conclusion, the aortic valve calcification-related PiRNA antisense nucleotide pharmaceutical composition provided by the application can be used as an application of a medicament for preventing and treating human aortic valve mesenchymal cell osteogenic differentiation and mouse aortic valve calcification, can also be used as a target spot for preparing a medicament for treating calcified aortic valve diseases, and provides a new non-operative treatment scheme for treating aortic valve calcification.

Finally, it should be noted that the above embodiments are only for illustrating the application and not for limiting the scope of the application. Further, after reading the technical content of the present application, those skilled in the art may make various changes, modifications or variations to the present application, and all such equivalent forms are also within the scope of protection defined by the claims of the present application.

Claims (3)

1. The application of the piRNA antisense nucleotide pharmaceutical composition as the aortic valve calcification prevention and treatment drug is characterized in that the baseID of the piRNA is hsa-piR-25624, the nucleotide sequence of the piRNA is shown as SEQ ID NO. 1,

the method comprises the following steps: TTGGTGGTTCAGTGGTAGAATTCTCGCCTGCC;

the piRNA antisense nucleotide pharmaceutical composition comprises piRNA antisense nucleotides and a vector;

the antisense nucleotide sequence of the piRNA is shown as SEQ ID NO. 4,

the method comprises the following steps: 5'-GGCAGGCGAGAATTCTACCACTGAACCACCAA-3';

the carrier is one or more of nano particles, liposome, chitosan and CRISPR-cas9 gene editing system.

2. Use of the piRNA antisense nucleotide pharmaceutical composition of claim 1 in the preparation of an inhibitor of human aortic valve stromal cell osteogenic differentiation.

3. Use of the piRNA antisense nucleotide pharmaceutical composition of claim 1 in the preparation of a mouse aortic valve calcification inhibitor.