CN117136232A - Chimeric Antigen Receptor (CAR) NK cells and uses thereof - Google Patents

Abstract

Plasmids and methods for genetically engineering NK cells using adeno-associated virus (AAV) delivery of the CRISPR/CAS9 system are disclosed. In some aspects, disclosed herein are methods of using such engineered NK cells to treat cancer.

Description

Chimeric Antigen Receptor (CAR) NK cells and uses thereof

I. Cross-reference to related applications

The present application claims the benefit of U.S. provisional patent application No. 63/105,722, filed on 10/26 of 2020, which provisional patent application is expressly incorporated herein by reference in its entirety.

II background art

Human peripheral blood Natural Killer (NK) cells have strong antitumor activity and have been successfully used in several clinical trials. Modification of NK cells with Chimeric Antigen Receptors (CARs) can improve their targeting and increase specificity. However, genetic modification of NK cells has been challenging due to the high expression of the innate sensing mechanisms of viral nucleic acids. New methods and new vectors for engineering NK cells are needed.

III summary of the application

Methods and compositions relating to electroporation of NK cells to deliver a CRISPR/CAS9 gene editing system to cells (e.g., NK cells) are disclosed.

In one aspect, disclosed herein are plasmids for use with Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated 9 (Cas 9) integration systems, wherein the plasmids comprise, in order, a left homology arm, a polynucleotide sequence encoding a Chimeric Antigen Receptor (CAR) polypeptide such as, for example, a CAR comprising an scFv that targets a receptor (e.g., CD 33) on a target cell, a transmembrane domain (e.g., NKG2D transmembrane domain, CD4 transmembrane domain, CD8 transmembrane domain, CD28 transmembrane domain, and/or CD3 ζ transmembrane domain), a costimulatory domain (e.g., 2B4 domain, CD28 costimulatory domain, 4-1BB costimulatory domain, or any combination of 2B4 domain, CD28 costimulatory domain, and/or 4-1BB costimulatory domain), and a CD3 ζ signaling domain; wherein the left and right homology arms are each 1000bp or less in length (e.g., 30bp long, 300bp long, 600bp long).

Also disclosed herein are plasmids for use with the CRISPR/Cas9 integration system of any preceding aspect, wherein the left and right homology arms have the same length or different lengths. In some aspects, the homology arm specifically hybridizes to adeno-associated virus integration site 1 (AAVS 1) of human chromosome 19.

In some embodiments, disclosed herein are plasmids for use with the CRISPR/Cas9 integration system of any preceding aspect, wherein the plasmid further comprises a murine leukemia virus origin (MND) promoter.

Also disclosed herein are adeno-associated virus (AAV) vectors (such as, for example, AAV vectors comprising AAV6 serotypes), which vectors comprise plasmids of any of the foregoing aspects. In some aspects, the AAV plasmid further comprises a polynucleotide sequence encoding a Chimeric Antigen Receptor (CAR) polypeptide. In some embodiments, the vector further comprises a plasmid encoding a crRNA, a tracer RNA (trcrRNA), and a Cas endonuclease. The AAV vector may be a single stranded AAV (ssAAV) or a self-complementary AAV (scAAV).

In one aspect, disclosed herein are modified cells (such as, for example, NK cells and NK T cells) comprising a plasmid or AAV vector of any of the preceding aspects.

Also disclosed herein are methods of treating, reducing, lowering, inhibiting, ameliorating, and/or preventing cancer and/or metastasis in a subject, such as, for example, acute Lymphoblastic Leukemia (ALL), acute Myelogenous Leukemia (AML), chronic Myelogenous Leukemia (CML), hairy Cell Leukemia (HCL), and/or myelodysplastic syndrome (MDS), comprising administering to a subject having cancer the modified cells of any of the foregoing aspects.

In one aspect, disclosed herein are methods of producing Chimeric Antigen Receptor (CAR) Natural Killer (NK) cells or CAR NK T cells, comprising a) obtaining a Ribonucleoprotein (RNP) complex comprising a class 2 CRISPR/Cas endonuclease (Cas 9) complexed with a corresponding CRISPR/Cas guide RNA and an AAV vector comprising a plasmid comprising a transgene (such as, for example, a chimeric antigen receptor for a tumor antigen); wherein the transgene is flanked by homology arms; and wherein the homology arm is 1000bp or less in length; and b) introducing the transgene and RNP complex into NK cells or NK T cells; wherein the transgene (such as, for example, a chimeric antigen receptor for a tumor antigen) is introduced into NK cells or NK T cells via adeno-associated virus (AAV) infection; wherein the RNP complex hybridizes to a target sequence within genomic DNA of the NK cell or NK T cell, and the DNA repair enzyme of the NK cell or NK T cell inserts the transgene into the host genome at the target sequence (e.g., by homologous repair), thereby producing the CAR NK cell or CAR NK T cell. In some aspects, RNP complexes can be introduced into cells via electroporation. In some aspects, RNP complexes can be introduced into cells in the same or different AAV (i.e., repeat infection) via viral delivery.

In one aspect, disclosed herein are methods of genetically modifying cells (T cells, B cells, macrophages, NK cells, NK T cells, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells, and/or myocytes, including but not limited to primary cells or expanded cells) comprising a) obtaining a Ribonucleoprotein (RNP) complex comprising a class 2 CRISPR/Cas endonuclease (Cas 9) complexed with a corresponding CRISPR/Cas guide RNA and an AAV vector comprising a plasmid comprising a Chimeric Antigen Receptor (CAR) polypeptide; wherein the polynucleotide sequence is flanked by homology arms; and wherein the homology arm is 1000bp or less in length; and b) introducing the polynucleotide sequence and the RNP complex into a cell; wherein the polynucleotide sequence is introduced into the cell via AAV infection into the cell; wherein the RNP complex hybridizes to a target sequence within genomic DNA of the cell, and the DNA repair enzyme of the cell inserts a transgene into the host genome at the target sequence within genomic DNA of the cell, thereby producing a modified cell.

In some embodiments, disclosed herein are methods of genetically modifying a cell of any of the foregoing aspects, wherein the cell (e.g., NK cell or NK T cell) is infected with an AAV disclosed herein at a multiplicity of infection (MOI) of about 5 to 500K.

Also disclosed herein are methods of genetically modifying cells of any of the preceding aspects, wherein the primary cells are incubated in the presence of IL-2 and/or irradiated feeder cells, plasma membrane particles, or exosome cells for about 4 days to 10 days prior to infection and/or electroporation. In some embodiments, disclosed herein are methods of genetically modifying cells of any of the foregoing aspects, further comprising expanding the primary cells in the presence of irradiated feeder cells, plasma membrane particles, or exosomes for about 4 to 10 days prior to infection, wherein the irradiated feeder cells, plasma membrane particles, or exosomes express membrane-bound 4-1BBL, membrane-bound IL-21, or membrane-bound IL-15, or any combination thereof. Also disclosed herein are methods of genetically modifying cells of any of the preceding aspects, further comprising expanding the modified cells with irradiated feeder cells, plasma membrane particles, or exosomes after infection, wherein the irradiated feeder cells, plasma membrane particles, or exosomes express membrane-bound 4-1BBL, membrane-bound IL-21, or membrane-bound IL-15, or any combination thereof.

In some aspects, disclosed herein are methods of treating, reducing, inhibiting, ameliorating, and/or preventing cancer and/or metastasis in a subject, such as, for example, acute Lymphoblastic Leukemia (ALL), acute Myelogenous Leukemia (AML), chronic Myelogenous Leukemia (CML), hairy Cell Leukemia (HCL), and/or myelodysplastic syndrome (MDS), comprising administering to the subject a therapeutically effective amount of Natural Killer (NK) cells, wherein the NK cells comprise a plasmid for use with a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/CRISPR-associated 9 (Cas 9) integration system, wherein the plasmid comprises, in order, a left homology arm, a polynucleotide sequence encoding a Chimeric Antigen Receptor (CAR) polypeptide, such as, for example, a CD 33-targeting CAR, and a right homology arm; wherein the length of each of the left and right homology arms is 1000bp or less (e.g., 600 bp).

In some aspects, disclosed herein are plasmids for use with Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated 9 (Cas 9) integration systems, wherein the plasmids comprise a polynucleotide sequence encoding a Chimeric Antigen Receptor (CAR) polypeptide; wherein the polynucleotide sequence is adjacent to or flanked by two PAM and two crRNA encoding sequences by a pre-spacer adjacent motif (PAM) and a crispr RNA (crRNA) encoding sequence. In some aspects, the disclosed plasmids are useful in methods of treating, reducing, lowering, inhibiting, ameliorating and/or preventing any of the foregoing cancers and/or metastases; a method of producing a CAR NK cell and/or CAR NK T cell of any preceding aspect; and/or any of the methods of genetically modifying the cells of any of the preceding aspects.

IV. description of the drawings

The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments and, together with the description, the disclosed compositions and methods.

FIGS. 1A-1E show effective CRISPR targeting of AAVS1 in mBIL-21 expanded human primary NK cells. FIG. 1A shows a schematic diagram of the steps of isolation and ex vivo expansion of NK cells using mbiL 21-K562. Fig. 1B shows the relative gene expression levels of HR-related genes (fig. 1C) and NHEJ-related genes in different NK cells, P <0.001 for all comparisons. Fig. 1D shows ATAC-seq data showing that AAVS1 has similar chromatin accessibility between freshly isolated (primary) NK cells and mBIL-21 expanded NK cells (n=2). FIG. 1E shows the efficiency of Cas 9/RNP-mediated targeting of AAVS1 in NK cells. The sequence in fig. 1E includes: SEQ ID NO. 52, SEQ ID NO. 53, SEQ ID NO. 54, SEQ ID NO. 55, SEQ ID NO. 56, SEQ ID NO. 57, SEQ ID NO. 58.

FIGS. 2A-2C show constructs for mCherry encoding DNA inserted into AAVS1 by HR and CRISPaint. In fig. 2A, left panel shows that Cas9/RNP introduces DSB into AAVS1, DNA encoding a gene of interest can be integrated into NK cells by HR with Ha of optimal length; the right panel shows schematic diagrams of constructs designed to integrate mCherry-encoding DNA with HA between 30bp-1000bp for Cas9 targeting site in AAVS1 and clone in ssav 6 and/or scAAV6 backbones. In fig. 2B, the upper graph shows a schematic diagram of how the CRISPaint gene insertion works through a homology independent DNA repair pathway; the following figure shows a schematic of a construct designed for insertion of DNA encoding mCherry by crisp and cloning in scAAV. Fig. 2C shows a schematic diagram of the workflow of electroporating Cas9/RNP and transducing seventh day mbIL21 amplified IL2 stimulated NK with AAV6 transduced for gene delivery.

Figures 3A-3C show that AAVS1 in the targeted expanded CD3 negative CD56 positive NK cells did not alter the normal function of the cells. Figure 3A shows a representative flow cytometry analysis showing purity of CD3 negative CD56 positive NK cells isolated from healthy donor buffy coats. Fig. 3B shows a schematic diagram of a workflow for electroporation of Cas9/RNP into day 7 expanded human primary NK cells to target AAVS 1. Fig. 3C shows a cytotoxicity assay of AAVS1KO NK cells, which does not show any inhibition of its anti-tumor activity against AML cell lines.

Fig. 4A-4C show that the combination of AAV6 and Cas9/RNP resulted in efficient production of mCherry expressing NK cells. Fig. 4A shows CRISPR electroporation and representative flow cytometry of mCherry expressing human primary NK cells 2 days after AAV6 transduction (moi=3×105). Fig. 4B shows the efficiency of Cas9/RNP and AAV6 mediated mCherry expression in human primary NK cells by HR and crisp (n=3). FIG. 4C shows stable mCherry expression in NK cells after enrichment and expansion using mbiL 21K 562.

FIG. 5 shows representative flow cytometry analysis of mCherry expression levels in freshly isolated NK cells electroporated with Cas9/RNP and transduced with AAV 6.

Figures 6A-6F show successful generation of NK cells expressing a CD33CAR using a combination of Cas9/RNP and AAV 6. Fig. 6A and 6B show schematic diagrams of anti-CD 33CAR constructs (Gen 2 and Gen4v 2) with HA directed against AAVS1 targeting site and cloned in ssav. Fig. 6C shows a representative flow cytometry showing expression of CD33CAR on NK cells 7 days after Cas9/RNP electroporation and AAV6 transduction (moi=3×10 ⁵ ). Fig. 6D shows that the MFI of CD33CAR expression of Gen2 is significantly higher than Gen4v2, p=0.0014. Figure 6E shows that CD33CAR expression levels on NK cells did not show significant decrease (n=3) seven days and fourteen days after transduction and electroporation. FIG. 6F shows that NK cells expressing CD33CAR were grown on feeder cells from 3X 10 ⁵ The fold expansion of individual cells starting for 14 days (n=3) was similar to wild type NK cells.

7A-7B show that representative flow cytometry analysis of CD33CAR-Gen2 expression levels in NK cells before freezing and on day 14 after thawing did not show a decrease. FIG. 7A also shows that freezing and thawing does not affect the enhanced cytotoxic effect of CD33CAR-Gen2 NK cells against Kasumi-1.

Figures 8A-8I show that CD33CAR NK cells have enhanced anti-AML activity. CD33CAR NK cell degranulation was significantly higher than wild-type NK cells when co-cultured with Kasumi-1, conditioned P-value = 0.004. Fig. 8A and 8B: HL60, P-value adjusted = 0.01. Fig. 8B shows that expression of CD33CAR on NK cells also enhanced NK cell anti-tumor activity against Kasumi-1, as shown in representative cytotoxicity assays performed at different effector cell: target cell ratios and in three donors, P values <0.0001 for modulation. Fig. 8C shows that this enhanced cytotoxic activity against HL-60 was observed only in CD33CAR-Gen2 NK cells (fig. 8E and 8F), regulated P-value = 0.01.CD33CAR-Gen2 and Gen4v2 significantly killed higher AML-10 primary cells with P values <0.0001 (fig. 8G and 8H). No improved killing against K562 was observed, adjusted P-value = 0.001.

FIGS. 9A-9D show that integration of the transgene into the AAVS1 locus was confirmed by PCR and TLA. Fig. 9A shows a schematic of PCR primers designed inside and outside the DNA encoding CD33CAR and integrated in AAVS 1. Fig. 9B shows that the amplicon was amplified and only observed on 1% agarose gel in NK cells with CD33CAR gene successfully inserted at AAVS1 locus (conditions 1 and 2). Gene insertion in human primary NK cells was also observed when primers were designed outside the transgene and used to amplify AAVS1 loci in wild-type, mCherry or CD33CAR (condition 3, primer: forward-1200 bp (2), reverse-1200 bp (1)). Figure 9C shows TLA sequence coverage across the human genome when designed primers were used to detect integration of CD33CAR-Gen2 in day 14 cells. FIG. 9D shows the chromosome on the y-axis and the chromosome position on the x-axis. The integration sites identified are circled in red.

Fig. 10A-10B show that representative flow cytometry (fig. 10A) analysis of CD33CAR-Gen2 expression levels in ssav 6-transduced NK cells encoding CD33CAR-Gen2 with a 10K-300K MOI showed successful expression of CARs on NK cells isolated from three healthy donors (fig. 10B).

Fig. 11 shows CD33 expression levels in different cancer cells.

FIG. 12 shows a representative calcein-AM release assay of NK cells against K562.

Fig. 13A-13B show representative flow cytometry analyses of CD33CAR expression levels in human NK cells 7 days (fig. 13A) and 14 days (fig. 13B) after electroporation and AAV6 transduction.

Fig. 14 shows NGS sequencing coverage (grey) on the vector. Black arrows indicate primer positions. Blue arrows indicate the positions of the identified vector-genome breakpoint sequences (described below). The vector diagram is shown at the bottom. The Y-axis is limited to 100 times. High coverage was observed in the region between ITR sites, vector sequence vector: 12-4,255. In the carrier: low coverage/no coverage was observed on 0-11 and 4,256-6,864, indicating that the backbone has not been integrated in the bulk of the sample, potentially a small portion of the sample may also contain the backbone. Moreover, coverage was observed at ITR, indicating that ITR-based integration also occurred in the sample after integration by the homology arm. In the coverage area called sequence variants and structural variants.

FIG. 15 shows the coverage (grey) of the TLA sequence at the vector integration locus human chr19:54,550,476-55,682,266. Blue arrows indicate the position of the breakpoint sequence. The Y-axis is limited to 20 and 100 times, respectively. The coverage profile of this figure shows that no genomic rearrangement has occurred in the integration site region. From this data, it is concluded that: the vector has been integrated as expected in human chromosome chr19:55,115,754-55,115,767. According to RefSeq, this occurs in intron 1 of PPP1R 12C. Other integration sites were observed between chr19:55,115,155-55,116,371. According to RefSeq, this also occurs in intron 1 of PPP1R 12C.

FIG. 16 shows the construct design of pAAV AAVS1 (600 bpHA) MND-CD33CAR (gen 2) (CoOp). The sequence of this construct is SEQ ID NO. 22.

FIG. 17 shows the construct design of pAAV AAVS1 (600 bpHA) MND-CD33CAR (gen 4v 2) (CoOp). The sequence of this construct is SEQ ID NO. 23.

Figure 18 shows kinetic assessment of cytotoxicity of unmodified (WT) and CD33-CAR expressing expanded NK cells against K562. The assay was performed using two E:T ratios with xcell monitoring target viability at 15 minute intervals. % cell lysis was calculated with reference to control wells without NK cells. Although K562 is highly sensitive to WT expanded NK cells and series killing is evident (> 50% lysis at 0.5:1E: T ratio), K562 does also express CD33, so CD33CAR is able to start killing more rapidly at two E: T ratios and increase overall killing at lower E: T ratios.

Figure 19 shows kinetic assessment of cytotoxicity against Kasumi. The assays were performed as described in the previous figures. Kasumi is very resistant to WT-expanded NK cells compared to K562, but increasing CD33CAR targeting into NK cells can initiate high level killing more rapidly with faster kinetics and increase overall killing at two E:T ratios.

Figure 20 shows that co-culture of AML cells with WT-NK or CD33 CAR-NK cells induced AML cell death, as shown by the SPADE plot (pRb expression in color, indicating living circulating cells), green arrows indicate living AML cells, and red arrows indicate dead/dying AML cells. CD33 CAR-NK cells exhibit increased AML cell killing, surviving AML cells have reduced CD33 surface expression and increased CD38 expression, suggesting that the combination of CD33 CAR and CD38 antibodies may act synergistically. The assay uses as a target an AML cell line derived from a patient.

FIG. 21 shows the construct design of PAMgRNA mCherry. The sequence of this construct is SEQ ID NO. 51.

FIG. 22 shows the construct design of PAMgPAMg mCherry. The sequence of this construct is SEQ ID NO. 50.

V. detailed description of the invention

Before the present compounds, compositions, articles, devices and/or methods are disclosed and described, it is to be understood that they are not limited to specific synthetic methods or specific recombinant biotechnology methods unless otherwise specified, or to specific reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

A. Definition of the definition

As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a pharmaceutical carrier" includes mixtures of two or more such carriers, and the like.

Ranges may be expressed herein as from "about" one particular value, and/or to "about" another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about," it will be understood that the particular value forms another embodiment. It will also be understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also to be understood that a plurality of values are disclosed herein, and that each value is also disclosed herein as "about" that particular value in addition to the value itself. For example, if the value "10" is disclosed, then "about 10" is also disclosed. It is also to be understood that when a value is disclosed, a range of possible values between "less than or equal to" the value, "greater than or equal to the value," and the value is also disclosed, as would be well understood by one of ordinary skill in the art. For example, if the value "10" is disclosed, then "less than or equal to 10" and "greater than or equal to 10" are also disclosed. It should also be understood that throughout this application, data is provided in a variety of different formats, and that the data represents the range of endpoints and starting points, and any combination of the data points. For example, if a particular data point "10" and a particular data point 15 are disclosed, it should be understood that greater than, greater than or equal to, less than or equal to, and equal to 10 and 15, and between 10 and 15, are considered disclosed. It should also be understood that each unit between two particular units is also disclosed. For example, if 10 and 15 are disclosed, 11, 12, 13 and 14 are also disclosed.

"administering" to a subject includes any route of introducing or delivering an agent to a subject. Administration may be by any suitable route, including oral, topical, intravenous, subcutaneous, transdermal, intramuscular, intra-articular, parenteral, intra-arteriolar, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation, via an implanted kit, parenteral (e.g., subcutaneous, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intrathecal, intraperitoneal, intrahepatic, intralesional, and intracranial injection or infusion techniques), and the like. As used herein, "concurrently administered," "co-administered," "simultaneous administration," or "administered simultaneously" means that the compounds are administered at the same point in time or substantially immediately following each other. In the case where the compounds are administered substantially immediately following each other, the time of administration of the two compounds is sufficiently close that the observed results are indistinguishable from those obtained when the compounds are administered at the same point in time. "systemic administration" refers to the introduction or delivery of an agent to a subject via a route that introduces or delivers the agent to a broad area of the subject's body (e.g., greater than 50% of the body), such as through an entrance to the circulatory system or lymphatic system. In contrast, "topical administration" refers to the introduction or delivery of an agent to a subject via a route that introduces or delivers the agent to the region of the point of administration or to a region immediately adjacent to the point of administration, and does not introduce the agent systemically in a therapeutically significant amount. For example, a topically administered agent is readily detectable in the local vicinity of the point of administration, but is undetectable or negligible in the distal portion of the subject's body. Administration includes self-administration and administration via others.

"biocompatible" generally refers to materials and any metabolites or degradation products thereof that are generally non-toxic to the recipient and do not cause significant side effects to the subject.

A "control" is an alternative subject or sample in an experiment for comparison purposes. The control may be "positive" or "negative".

"complementary" or "substantially complementary" refers to hybridization or base pairing or duplex formation between nucleotides or nucleic acids, such as, for example, between two strands of a double-stranded DNA molecule or between an oligonucleotide primer and a primer binding site on a single-stranded nucleic acid. The complementary nucleotides are typically A and T/U, or C and G. Two single stranded RNA or DNA molecules are considered to be substantially complementary when optimally aligned and compared nucleotides of one strand with appropriate nucleotide insertions or deletions are paired with at least about 80% of the nucleotides of the other strand, typically at least about 90% to 95% of the nucleotides, and more preferably about 98% to 100% of the nucleotides. Alternatively, substantial complementarity exists when an RNA or DNA strand hybridizes to its complement under selective hybridization conditions. Typically, selective hybridization will occur when there is at least about 65% complementarity, at least about 75% complementarity, or at least about 90% complementarity over a stretch of at least 14 to 25 nucleotides. See Kanehisa (1984), nucleic acids res., volume 12: page 203.

As used herein, the term "comprising" and variants thereof are used synonymously with the term "including" and variants thereof, and are open, non-limiting terms. Although the terms "comprising" and "including" have been used herein to describe various embodiments, the terms "consisting essentially of … …" and "consisting of … …" may be used in place of "comprising" and "including" to provide a more specific embodiment and are also disclosed.

By "composition" is meant any agent that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects (e.g., treating a disorder or other undesirable physiological condition) and prophylactic effects (e.g., preventing a disorder or other undesirable physiological condition). The term also encompasses pharmaceutically acceptable, pharmacologically active derivatives of the beneficial agents specifically mentioned herein, including but not limited to vectors, polynucleotides, cells, salts, esters, amides, prodrugs, active metabolites, isomers, fragments, analogs, and the like. When the term "composition" is used, or when a particular composition is specifically identified, it is understood that the term includes the composition itself as well as pharmaceutically acceptable, pharmacologically active carriers, polynucleotides, salts, esters, amides, prodrugs, conjugates, active metabolites, isomers, fragments, analogs, and the like.

A DNA sequence "encoding" a particular RNA is a DNA nucleic acid sequence that is transcribed into RNA. The DNA polynucleotide may encode an RNA (mRNA) that is translated into a protein (and thus both DNA and mRNA encode a protein), or the DNA polynucleotide may encode an RNA (e.g., tRNA, rRNA, microrna (miRNA), "non-coding" RNA (ncRNA), guide RNA, etc.) that is not translated into a protein.

An "expression vector" refers to a vector comprising a recombinant polynucleotide comprising an expression control sequence operably linked to a nucleotide sequence to be expressed. The expression vector contains sufficient cis-acting elements for expression; other elements for expression may be provided by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) incorporating recombinant polynucleotides.

These "fragments", whether or not linked to other sequences, may include insertions, deletions, substitutions or other selected modifications of specific regions or specific amino acid residues, provided that the activity of the fragment is not significantly altered or compromised compared to the unmodified peptide or protein. These modifications may provide some additional properties, such as to remove or add amino acids capable of forming disulfide bonds, to extend their biological life span, to alter their secretory characteristics, etc. In any case, the fragment must have bioactive properties, such as regulating transcription of the target gene.

The term "gene" or "gene sequence" refers to a coding sequence or a control sequence or a fragment thereof. A gene may include any combination of coding and control sequences, or fragments thereof. Thus, reference herein to a "gene" may be to all or part of a native gene. The polynucleotide sequences referred to herein may be used interchangeably with the term "gene" or may include any coding sequence, non-coding sequence or control sequence, fragments thereof, and combinations thereof. The term "gene" or "gene sequence" includes, for example, control sequences (e.g., ribosome binding sites) upstream of the coding sequence.

In the context of two or more nucleic acid or polypeptide sequences, the term "identical" or "percent identity" refers to the identity of two or more sequences or subsequences that are the same or have a specified percentage of identical amino acid residues or nucleotides when compared and aligned over a comparison window or designated region for maximum correspondence (i.e., about 60% identity over the designated region, preferably 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more, as measured using the BLAST or BLAST 2.0 sequence comparison algorithm with the default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI website, etc.). Such sequences are then referred to as "substantially identical". The definition also refers to or applies to the complement of the test sequence. The definition also includes sequences with deletions and/or additions, as well as sequences with substitutions. As described below, the preferred algorithm may take into account gaps, etc. Preferably, the identity exists over a region of at least about 10 amino acids or 20 nucleotides in length, or more preferably 10-50 amino acids or 20-50 nucleotides in length. As used herein, percent (%) nucleotide sequence identity is defined as the percentage of amino acids in a candidate sequence that are identical to nucleotides in a reference nucleic acid sequence after aligning the sequences and introducing gaps (if necessary) to achieve the maximum percent sequence identity. Alignment for the purpose of determining percent sequence identity can be accomplished in a variety of ways within the skill of the art, for example using publicly available computer software such as BLAST, BLAST-2, ALIGN-2 or Megalign (DNASTAR) software. Suitable parameters for measuring the alignment can be determined by known methods, including any algorithms required to achieve maximum alignment over the full length of the sequences compared.

For sequence comparison, typically one sequence serves as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, the test sequence and reference sequence are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Preferably, default program parameters may be used, or alternative parameters may be specified. The sequence comparison algorithm then calculates the percent sequence identity of the test sequence relative to the reference sequence based on the program parameters.

One example of an algorithm suitable for determining the percent sequence identity and percent sequence similarity is the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al (1977), nuc.acids res., volume 25: pages 3389-3402; and Altschul et al (1990), j.mol.biol., volume 215: pages 403-410. Software for performing BLAST analysis is publicly available through the national center for Biotechnology information (http:// www.ncbi.nlm.nih.gov /). The algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that match or meet some positive threshold score T when aligned with words of the same length in the database sequence. T is called the neighborhood word score threshold (Altschul et al (1990), J.mol.biol., volume 215, pages 403-410). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The number of word samples extends in both directions along each sequence, so long as the cumulative alignment score can be increased. For nucleotide sequences, cumulative scores were calculated using parameters M (reward score for a pair of matching residues; always > 0) and N (penalty for mismatched residues; always < 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Stopping the extension of the number of word samples in each direction when: the cumulative alignment score decreases by an amount X from its maximum realized value; the cumulative score becomes zero or lower due to the accumulation of one or more negative scoring residue alignments; or to the end of either sequence. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses a word length (W) of 11, an expected value (E) of 10, m= 5,N = -4 and a comparison of the two strands as default values. For amino acid sequences, the BLASTP program uses a word length of 3 and an expected value (E) of 10, and a BLOSUM62 scoring matrix (see Henikoff and Henikoff (1989), proc.Natl. Acad.sci.usa, volume 89: page 10915) for a 50 alignment (B), an expected value (E) of 10, m= 5,N = -4 and a comparison of the two chains as default values.

The BLAST algorithm also performs statistical analysis of the similarity between two sequences (see, e.g., karlin and Altschul (1993), proc. Natl. Acad. Sci. USA, vol.90:p.5873-5787). One measure of similarity provided by the BLAST algorithm is the minimum sum probability (P (N)), which provides an indication of the probability of a match between two nucleotide or amino acid sequences occurring by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01.

As used herein, the term "naturally occurring" or "unmodified" or "wild-type" when applied to a nucleic acid, polypeptide, cell or organism refers to a nucleic acid, polypeptide, cell or organism found in nature. For example, polypeptide or polynucleotide sequences present in organisms (including viruses) are wild-type (and naturally occurring), which organisms can be isolated from natural sources and have not been intentionally modified by man in the laboratory.

An "increase" may refer to any change in symptoms, diseases, compositions, conditions, or activity that results in a greater amount. The increase may be any individual, median or average increase in disorder, symptom, activity, composition in a statistically significant amount. Thus, an increase may be a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% increase, provided that the increase is statistically significant.

"reduction" may refer to any change in symptoms, diseases, compositions, conditions, or activity that results in a smaller amount. A substance is also understood to reduce the genetic output of a gene when the genetic output of a gene product containing the substance is less relative to the output of a gene product not containing the substance. As another example, the reduction may be a change in symptoms of the disorder such that the symptoms are less than previously observed. The reduction may be any individual, median or average reduction in disorder, symptom, activity, composition in a statistically significant amount. Thus, the reduction may be a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% reduction, provided that the reduction is statistically significant.

As used herein, the term "nucleic acid" means a polymer composed of nucleotides, such as Deoxyribonucleotides (DNA) or Ribonucleotides (RNA). As used herein, the terms "ribonucleic acid" and "RNA" mean a polymer consisting of ribonucleotides. As used herein, the terms "deoxyribonucleic acid" and "DNA" mean a polymer composed of deoxyribonucleotides.

"optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

As used herein, "operably linked" may indicate that regulatory sequences useful for expressing the coding sequences of a nucleic acid are placed into the nucleic acid molecule in the appropriate position relative to the coding sequences to effect expression of the coding sequences. The same definition sometimes applies to the arrangement of coding sequences and/or transcription control elements (e.g., promoters, enhancers and termination elements) and/or selectable markers in an expression vector. The term "operably linked" may also refer to an arrangement of polypeptide segments within a single polypeptide chain, wherein each polypeptide segment may be, but is not limited to, a protein, a fragment thereof, a linker peptide, and/or a signal peptide. The term "operably linked" may refer to the direct fusion of different individual polypeptides within a single polypeptide or fragment thereof, wherein there are no intervening amino acids between the different segments; and when the individual polypeptides are linked to each other via one or more intervening amino acids.

A "primer" is a subset of probes that are capable of supporting a certain type of enzymatic manipulation and that can hybridize to a target nucleic acid so that enzymatic manipulation can occur. Primers may be prepared from any combination of nucleotides or nucleotide derivatives or analogues available in the art that do not interfere with the operation of the enzyme.

A "probe" is a molecule capable of interacting with a target nucleic acid, typically in a sequence-specific manner, such as by hybridization. Hybridization of nucleic acids is well known in the art and is discussed herein. In general, probes can be prepared from any combination of nucleotides or nucleotide derivatives or analogs available in the art.

A "protein coding sequence" or a sequence encoding a particular protein or polypeptide is a nucleic acid sequence that, when placed under the control of appropriate regulatory sequences, is transcribed into mRNA (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo. The boundaries of the coding sequence are determined by the start codon at the 5 'end (N-terminal) and the translation termination nonsense codon at the 3' end (C-terminal). Coding sequences may include, but are not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and synthetic nucleic acids. The transcription termination sequence is typically located 3' to the coding sequence.

The term "polynucleotide" refers to a single-or double-stranded polymer composed of nucleotide monomers.

The term "polypeptide" refers to a compound consisting of a single chain of D-amino acids or L-amino acids or a mixture of D-amino acids and L-amino acids linked by peptide bonds.

As used herein, the term "promoter" is defined as a DNA sequence recognized by a cellular synthesis mechanism or an introduced synthesis mechanism that requires initiation of specific transcription of a polynucleotide sequence.

As used herein, the term "promoter/regulatory sequence" means a nucleic acid sequence required for expression of a gene product operably linked to a promoter/regulatory sequence. In some cases, the sequence may be a core promoter sequence, while in other cases, the sequence may also include enhancer sequences and other regulatory elements required for expression of the gene product. The promoter/regulatory sequence may be, for example, a sequence which expresses the gene product in a tissue-specific manner.

A "pharmaceutically acceptable" component may refer to a component that is not biologically or otherwise undesirable, i.e., the component may be incorporated into a pharmaceutical formulation of the invention and administered to a subject as described herein without causing significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the formulation in which the component is included. When used in connection with administration to humans, the term generally means that the component has met the required criteria for toxicology and manufacturing testing, or that it is contained in an inactive ingredient guide established by the U.S. food and drug administration.

"pharmaceutically acceptable carrier" (sometimes referred to as "carrier") refers to a carrier or excipient that can be used to prepare a generally safe, non-toxic pharmaceutical or therapeutic composition, and includes carriers acceptable for veterinary and/or human pharmaceutical or therapeutic use. The term "carrier" or "pharmaceutically acceptable carrier" may include, but is not limited to, phosphate buffered saline solution, water, emulsions (e.g., oil/water or water/oil emulsions), and/or various types of wetting agents. As used herein, the term "carrier" includes, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations and as further described herein.

"pharmacological activity" (or simply "activity") as in a "pharmacologically active" derivative or analog may refer to a derivative or analog (e.g., salt, ester, amide, conjugate, metabolite, isomer, fragment, etc.) that has the same type of pharmacological activity as the parent compound and is approximately equal in extent.

An "effective amount" of an agent refers to an amount of the agent sufficient to provide the desired effect. The amount of an "effective" agent varies from subject to subject, depending on many factors, such as the age and general condition of the subject, the particular agent or agents, and the like. Therefore, it is not always possible to determine a quantified "effective amount". However, in any subject case, a suitable "effective amount" can be determined by one of ordinary skill in the art using routine experimentation. Furthermore, as used herein, and unless otherwise specifically indicated, an "effective amount" of an agent may also be meant to encompass an amount that is both a therapeutically effective amount and a prophylactically effective amount. The "effective amount" of the agent necessary to achieve a therapeutic effect may vary depending on factors such as the age, sex, and weight of the subject. The dosing regimen may be adjusted to provide the optimal therapeutic response. For example, several divided doses may be administered daily, or the dose may be proportionally reduced as indicated by the urgency of the treatment situation.

"therapeutic agent" refers to any composition having a beneficial biological effect. Beneficial biological effects include both therapeutic effects (e.g., treating a disorder or other undesirable physiological condition) and prophylactic effects (e.g., preventing a disorder or other undesirable physiological condition (e.g., cancer)). The term also encompasses pharmaceutically acceptable, pharmacologically active derivatives of the beneficial agents specifically mentioned herein, including but not limited to salts, esters, amides, prodrugs, active metabolites, isomers, fragments, analogs, and the like. When the term "therapeutic agent" is used, or when a particular agent is specifically identified, it is understood that the term includes the agent itself as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, prodrugs, conjugates, active metabolites, isomers, fragments, analogs, and the like.

A "therapeutically effective amount" or "therapeutically effective dose" of a composition (e.g., a composition comprising a pharmaceutical agent) refers to an amount effective to achieve a desired therapeutic result. In some embodiments, the desired therapeutic result is control of cancer. In some embodiments, the desired therapeutic result is control transfer. In some embodiments, the desired therapeutic result is a reduction in tumor size. In some embodiments, the desired therapeutic result is prevention and/or treatment of recurrence. The therapeutically effective amount of a given therapeutic agent will generally vary with factors such as the type and severity of the disorder or disease being treated, as well as the age, sex, and weight of the subject. The term may also refer to an amount of a therapeutic agent or a rate of delivery of a therapeutic agent (e.g., an amount that varies over time) effective to promote a desired therapeutic effect, such as pain relief. The exact desired therapeutic effect will vary depending on the condition to be treated, the tolerance of the subject, the agent and/or agent formulation to be administered (e.g., the efficacy of the therapeutic agent, the concentration of the agent in the formulation, etc.), and various other factors understood by one of ordinary skill in the art. In some cases, a desired biological or medical response is obtained after administration of multiple doses of the composition to a subject over a period of days, weeks, or years.

As used herein, "transgene" refers to exogenous genetic material (e.g., one or more polynucleotides) that has been provided to a cell or may be provided to a cell artificially. The term may be used to refer to a "recombinant" polynucleotide encoding any of the polypeptides disclosed herein as the subject matter of the present disclosure. The term "recombinant" refers to a sequence (e.g., a polynucleotide or polypeptide sequence) that is not present in a cell in which the sequence is artificially provided, or is linked to another polynucleotide in an arrangement that is not present in a cell in which the sequence is artificially provided. It is understood that "artificial" refers to non-natural presence in a host cell and includes manipulation by humans, machinery, exogenous factors (e.g., enzymes, viruses, etc.), other non-natural manipulation, or a combination thereof. The transgene may include a gene operably linked to a promoter (e.g., open reading frame), but is not limited thereto. After the transgene is artificially provided to the cell, the transgene may be integrated into the host cell chromosome, exist extrachromosomally, or in any combination thereof.

Throughout this disclosure, various publications are referenced. The entire disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which they pertain. The references disclosed herein are also discussed in sentences that rely on the references, as the materials contained therein are individually and specifically incorporated by reference.

B. Plasmid and method for genetically modifying cells

Due to the powerful exogenous DNA and RNA sensing mechanisms, genetic modification of NK cells using viral or non-viral vectors has been challenging, which may limit the efficiency of gene delivery methods applied to NK cells. To overcome this limitation, a new method was developed to electroporate Cas 9/ribonucleoprotein complex (Cas 9/RNP) directly into human primary NK cells. This approach introduces Double Strand Breaks (DSBs) in the genome of NK cells, which lead to successful gene knockouts and enhanced antitumor activity. After this initial success of gene silencing, further development of gene insertion methods has been performed. After Cas9 introduces DSBs, two independent and innate DNA repair mechanisms can be employed to repair breaks: homologous Recombination (HR) or non-homologous end joining (NHEJ). In the presence of a DNA template encoding a gene of interest, the exogenous gene can be integrated into the Cas9 targeting site using any of these repair mechanisms.

Thus, disclosed herein are plasmids for use with Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated 9 (Cas 9) integration systems, wherein the plasmids comprise, in order, a left homology arm, a polynucleotide sequence encoding a Chimeric Antigen Receptor (CAR) polypeptide such as, for example, a CAR comprising an scFv that targets a receptor (e.g., CD 33) on a target cell, a transmembrane domain (e.g., NKG2D transmembrane domain, CD4 transmembrane domain, CD8 transmembrane domain, CD28 transmembrane domain, or CD3 ζ transmembrane domain), a co-stimulatory domain (e.g., 2B4 domain, CD28 co-stimulatory domain, 4-1BB co-stimulatory domain, or any combination of 2B4 domain, CD28 co-stimulatory domain, and/or 4-1BB co-stimulatory domain), and a CD3 ζ signaling domain; wherein the left and right homology arms are each 1000bp or less in length (e.g., about 30bp long, about 300bp long, or about 600bp long).

In general, "CRISPR systems" or "CRISPR integration systems" are collectively referred to as transcripts and other elements that are involved in the expression or guide the activity of a CRISPR-associated "Cas" gene. In some embodiments, one or more elements of the CRISPR system are derived from a type I, type II, or type III CRISPR system. CRISPR systems are known in the art. See, for example, U.S. Pat. No. 8,697,359, incorporated herein by reference in its entirety.

The endonuclease/RNP (e.g., cas 9/RNP) consists of three components, namely a recombinant endonuclease protein (e.g., cas9 endonuclease) that complexes with the CRISPR locus. Endonucleases that complex with a CRISPR locus may be referred to as CRISPR/Cas guide RNAs. The CRISPR locus comprises a synthetic single stranded guide RNA (gRNA) consisting of RNA that hybridizes to complementary repeated RNA (crRNA) and trans-complementary repeated RNA (tracrRNA) that are complexed with a target sequence. Thus, the CRISPR/Cas guide RNA hybridizes to a target sequence within the genomic DNA of the cell. In some cases, the class 2 CRISPR/Cas endonuclease is a class II CRISPR/Cas endonuclease. In some cases, the class 2 CRISPR/Cas endonuclease is a Cas9 polypeptide and the corresponding CRISPR/Cas guide RNA is a Cas9 guide RNA. These Cas 9/RNPs are able to cleave genomic targets with greater efficiency due to delivery as functional complexes compared to exogenous DNA-dependent methods. In addition, rapid clearance of Cas9/RNP from cells can reduce off-target effects, such as induction of apoptosis.

To prepare the RNP complex, the crRNA and tracrRNA may be mixed at a ratio of 1:1, 2:1, or 1:2 between about 50. Mu.M and about 500. Mu.M (e.g., 50. Mu.M, 60. Mu.M, 70. Mu.M, 80. Mu.M, 90. Mu.M, 100. Mu.M, 125. Mu.M, 150. Mu.M, 175. Mu.M, 200. Mu.M, 225. Mu.M, 250. Mu.M, 275. Mu.M, 300. Mu.M, 325. Mu.M, 350. Mu.M, 375. Mu.M, 400. Mu.M, 425. Mu.M, 450. Mu.M, 475. Mu.M, or 500. Mu.M) at 95℃for about 5 minutes, preferably at a concentration of between 100. Mu.M and about 300. Mu.M, most preferably about 200. Mu.M, to form the crRNA-tracrRNA complex (i.e., guide RNA). The crRNA: tracrRNA complex can then be mixed with a final dilution of Cas endonuclease (such as, for example, cas 9) between about 20 μΜ and about 50 μΜ (e.g., 21 μΜ, 22 μΜ, 23 μΜ, 24 μΜ, 25 μΜ, 26 μΜ, 27 μΜ, 28 μΜ, 29 μΜ, 30 μΜ, 31 μΜ, 32 μΜ, 33 μΜ, 34 μΜ, 35 μΜ, 36 μΜ, 37 μΜ, 38 μΜ, 39 μΜ, 40 μΜ, 41 μΜ, 42 μΜ, 43 μΜ, 44 μΜ, 45 μΜ, 46 μΜ, 47 μΜ, 48 μΜ, 49 μΜ, or 50 μΜ).

Once bound to a target sequence in a target cell, the CRISPR locus can modify the genome by introducing an insertion or deletion of one or more base pairs into the target DNA, by insertion of a heterologous DNA fragment (e.g., a donor polynucleotide), by deletion of an endogenous DNA fragment, by inversion or translocation of an endogenous DNA fragment, or a combination thereof. Thus, when combined with DNA for homologous recombination, the disclosed methods can be used to generate knockouts or knockins. It is shown herein that adeno-associated virus (AAV) transduction via Cas9/RNP is a relatively efficient method that overcomes previous limitations of genetic modification in cells such as, for example, T cells, B cells, macrophages, NK cells, NK T cells, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells, and/or myocytes.

Recently, CRISPR/Cas9 systems have been shown to facilitate high levels of precise genome editing during Homologous Recombination (HR) using adeno-associated virus (AAV) vectors as donor template DNA. However, previous use of AAV is limited because NK cells and NK T cells are resistant to viral and bacterial vectors due to their immune function, and NK cell/NK T cell apoptosis is induced by the vectors. Thus, CRISPR/Cas modification of NK cells or NK T cells has not been successful prior to the methods of the present invention. Furthermore, the maximum AAV packaging capacity of about 4.5 kilobases limits the donor size containing homology arms. It is recommended that any transcript above 100bp and any transgene should have a homology arm of at least 800bp per arm, with many systems employing asymmetric arms of 800bp and 1000bp, totaling 1800bp. Thus, AAV vectors are unable to deliver transgenes greater than about 2.5 kb. In one aspect, disclosed herein is a AAV CRISPR/CAS9 nucleotide delivery system comprising a nucleic acid molecule having a length of between 30bp and 1000bp, including but not limited to 30, 50, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550 560bp, 570bp, 580bp, 590bp, 600bp, 610bp, 620bp, 630bp, 640bp, 650bp, 660bp, 670bp, 680bp, 690bp, 700bp, 710bp, 720bp, 730bp, 740bp, 750bp, 760bp, 770bp, 780bp, 790bp, 800bp, 810bp, 820bp, 830bp, 840bp, 850bp, 860bp, 870bp, 880bp, 890bp, 900bp, 910bp, 920bp, 930bp, 940bp, 950bp, 960bp, 970bp, 980bp, 990bp or 1000bp. For example, the homology arms may be symmetrical 30bp homology arms, symmetrical 300bp homology arms, symmetrical 500bp homology arms, symmetrical 600bp homology arms, symmetrical 800bp homology arms, symmetrical 1000bp homology arms, or asymmetrical 800bp homology arms, including 800bp Left Homology Arms (LHA) and 1000bp Right Homology Arms (RHA) for Homologous Recombination (HR), or no homology arms at all for non-homologous end joining using Homology Independent Targeted Integration (HITI) plasmids. In some examples, plasmids with or without homology arms are those disclosed in International publication No. WO2020/198675, which is incorporated herein by reference in its entirety. In some embodiments, the plasmid has a clinically approved Splice Acceptor (SA) (SEQ ID NO: 10) and a clinically approved polyadenylation terminator (PA) (such as, for example, BGH polyA terminator SEQ ID NO: 11). It is to be understood and contemplated herein that the homology arms may be symmetrical (same length per side) or asymmetrical (different length per side) to accommodate different transgene lengths. That is, the homology arm length may have any combination of Left Homology Arm (LHA) length and Right Homology Arm (RHA) length, including but not limited to LHA 30bp (SEQ ID NO: 2) and RHA 30bp (SEQ ID NO: 1), LHA 30bp and RHA 100bp, LHA 30bp and RHA 300bp (SEQ ID NO: 3), LHA 30bp and RHA 500bp (SEQ ID NO: 5), LHA 30bp and RHA 800bp (SEQ ID NO: 7), LHA 30bp and RHA 1000bp, LHA 100bp and RHA 30bp, LHA 100bp and RHA 100bp, LHA 100bp and RHA 500bp, LHA 100bp and RHA 800bp, LHA 100bp and RHA 1000bp, LHA 300bp (SEQ ID NO: 4) and RHA 30bp, LHA 300bp and RHA 100bp, LHA 300bp and RHA 300bp, LHA 300bp and RHA 500bp, LHA 300bp and RHA 800bp, LHA 300bp and RHA 1000bp, LHA 500bp (SEQ ID NO: 6) and RHA 30bp, LHA 500bp and RHA 100bp, LHA 500bp and RHA 300bp, LHA 500bp and RHA 500bp, LHA 500bp and RHA 1000bp, LHA 1000bp and LHA 1000bp, LHA 800bp and LHA 1000bp, LHA 300bp and LHA 1000bp and LHA 1000 and LHLHA 1000 and LHLHLHLHA 1000 and LHLHLHA 1000 and LHLHLHLHA 1000 and LHLHLHLHLHLHLHLHA 1000 and LHLHLHLHLHA 1000 and LHLHLHLHLHP and LHLHLHLHP and LHLH200 and LHLHLHLH200 and LHLHLHLHLHLHLHLH200 and-1000-LHLHLHLHLHLHLHLHLHLHLH1000 and-LHLH1000-and-LHLHLHLHLHLHLHLH1000-and- -and- -.

There are several ways to provide DNA templates, including viral and non-viral methods. In non-viral methods, single-or double-stranded DNA templates are typically electroporated along with Cas9/RNP, however, this method has lower efficiency compared to viral transduction. For viral gene delivery, adeno-associated viruses (AAV, including AAV 6) are safely used in clinical trials and can be used as vectors for sensitive primary immune cells, including T cells.

Transcripts delivered via AAV vectors may be packaged as linear single stranded (ss) DNA (ssav) or linear self-complementary (sc) DNA (scAAV) of about 4.7kb in length. The benefit of the scAAV vector is that it contains a mutated Inverted Terminal Repeat (ITR), which is required for replication and helps bypass the rate limiting step of second strand generation compared to ssDNA vectors. Due to the packaging capacity limitations of scAAV, 30bp, 300bp, 500bp, and 800bp-1000bp HA to the right and left of Cas9 targeting sites were designed to find the optimal length of HA and to provide the possible length of HA that the researcher selected based on the size of the transgene (e.g., as shown in fig. 2A). In addition, scAAV may not be suitable for larger transgenes, such as CD 33-targeting Chimeric Antigen Receptor (CAR), due to limitations in packaging capacity compared to ssAAV. Thus, based on the size of the transgene, both ssav and scAAV were designed and tested, which provides a broad choice for gene insertion in primary NK cells and/or NK T cells.

Recombination efficiency HAs been shown to increase with increasing HA length. Thus, for the ssav backbone, the longest possible length of the left and right Homology Arms (HA) is for mCherry (e.g., 800bp-1000bp HA) and CD33 CAR-NK (e.g., 600bp HA). Since designing homology arms is a time-consuming process and requires multiple optimizations, the CRISPaint approach, a homology-independent approach for gene insertion or labeling, has also been studied. In this method, the same Cas9 targeting site is provided in the DNA template encoding the gene of interest, including sequences encoding crRNA and PAM sequences (also referred to herein as PAMg, e.g., SEQ ID NO: 9). After introducing the Cas9 complex, the template and genomic DNA are cleaved simultaneously. Thus, the crisp template is presented as linearized double stranded DNA that can be integrated by a non-homologous repair mechanism (e.g., as shown in fig. 2B). In some examples, the crisp DNA template is as shown in fig. 21 and 22. Thus, in one aspect, disclosed herein are plasmids for delivering a donor transgene to a cell and integrating the transgene (e.g., CAR) into the cell in combination with CRISPR/Cas 9. Thus, disclosed herein are plasmids for use with the CRISPR/Cas9 integration system of any preceding aspect, wherein the left and right homology arms have the same length or different lengths.

In some aspects, the homology arm specifically hybridizes to adeno-associated virus integration site 1 (AAVS 1) of human chromosome 19. In some embodiments, the LHA is 600bp in length. In some embodiments, the LHA comprises sequences or fragments thereof that are at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID NO. 31. In some embodiments, the RHA is 600bp in length. In some embodiments, the RHA comprises a sequence or fragment thereof that is at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID NO. 32.

The plasmids disclosed herein comprise a polynucleotide sequence encoding a chimeric antigen receptor CAR polypeptide. As used herein, a "chimeric antigen receptor" or "CAR" refers to a chimeric receptor that targets a cancer antigen and is used to direct cells expressing the receptor to cancer cells expressing the target antigen. In general, CARs include molecules that recognize peptides derived from tumor antigens presented by Major Histocompatibility (MHC) molecules; or an antibody or fragment thereof expressed on the surface of a CAR cell that targets a cancer antigen (such as, for example, fab', scFv, fv). The receptor is fused via a linker to a signaling domain such as, for example, the CD3 ζ domain of T cells and the NKG2C, NKp or CD3 ζ domain of NK cells or NK T cells. Tumor antigen targets are proteins produced by tumor cells that elicit an immune response (particularly B-cells, NK T cells, and T cell mediated immune responses). The choice of antigen binding domain will depend on the particular type of cancer to be treated. Tumor antigens are well known in the art and, and include, for example, glioma-associated antigen, carcinoembryonic antigen (CEA), EGFRvIII, IL-llRa, IL-13Ra, EGFR, FAP, B H3, kit, CA LX, CS-1, MUC1, BCMA, bcr-abl, HER2, beta-human chorionic gonadotropin, alpha-fetoglobin (AFP), ALK, CD19, CD123, cyclin Bl, lectin-reactive AFP, fos-associated antigen 1, ADRB3, thyroglobulin, ephA2, RAGE-1, RUl, RU2, SSX2, AKAP-4, LCK, OY-TESl, PAX5, SART3, CLL-1 fucosyl GM1, globoH, MN-CA IX, EPCAM, EVT6-AML, TGS5, human telomerase reverse transcriptase, polysialic acid, PLAC1, RUl, RU2 (AS), enterocarboxylesterase, lewisY, sLe, LY K, mut hsp70-2, M-CSF, MYCN, rhoC, TRP-2, CYPIBI, BORIS, prostase, prostate Specific Antigen (PSA), PAX3, PAP, NY-ESO-1, LAGE-la, LMP2, NCAM, p53 mutant, ras mutant, gplOO, prostein, OR E2, PANX3, PSMA, PSCA, her2/neu, hTERT, HMWMAA, HAVCR1, VEGFR2, PDGFR-beta, survivin and telomerase, legumain, HPV E6, E7, sperm protein 17, SSEA-4, tyrosinase, TARP, WT1, prostate cancer tumor antigen-1 (PCTA-1), ML-IAP, MAGE, MAGE-A1, MAD-CT-2, melanA/MART 1, XAGE1, ELF2M, ERG (TMPRSS 2ETS fusion gene), NA17, centromere elastase, sarcoma translocation breakpoint, and, ny-BR-1, ephnnB2, CD20, CD22, CD24, CD30, CD33, CD38, CD44v6, CD97, CD171, CD179a, androgen receptor, FAP, insulin Growth Factor (IGF) -I, IGFII, IGF-I receptor, GD2, o-acetyl-GD 2, GD3, GM3, GPRC5D, GPR, CXORF61, folate receptor (FRa), folate receptor beta, ROR1, flt3, TAG72, TNAg, tie 2, TEM1, TEM7R, CLDN6, TSHR, UPK2 and mesothelin. Non-limiting examples of tumor antigens include the following: differentiation antigens such as tyrosinase, TRP-1, TRP-2 and tumor specific multilineage antigens such as MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, pi 5; overexpressed embryonic antigens, such as CEA; overexpressed oncogenes and mutated tumor suppressor genes such as p53, ras, HER-2/neu; unique tumor antigens due to chromosomal translocation, such as BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR; and viral antigens such as Epstein Barr virus antigen EBVA and Human Papilloma Virus (HPV) antigens E6 and E7. Other large protein-based antigens include TSP-180, MAGE-4, MAGE-5, MAGE-6, RAGE, NY-ESO, pl85erbB2, pl80erbB-3, C-MET, nm-23H1, PSA, IL13Ra2, CA 19-9, CA 72-4, CAM 17.1, nuMa, K-ras, β -catenin, CDK4, mum-1, P15, P16, 43-9F, 5T4, 791Tgp72, alpha fetoprotein, β -HCG, BCA225, BTA, CA 125, CA 15-3\BCA, CA 195, CA 242, CA-50, CAM43, CD68\P1, CO-029, FGF-5, G250, ga733\EpCAM, HTgp 175, M344, MA 50, 7-Ag, MOV 18/NB, mum-1, P15, 43-9F, 5T4, 791Tgp72, alpha fetoprotein, β -HCG, BCA225, BCA, CA 125, CA 15-3\, CA 27.29\, CA 50, CA 43, CD68\P1, CO-029, FGF 5, G250, ga\, ga\3, HTC 175, MA-3, MA 6, LMC 35, LMC 6, LMF 1, and related protein, TAL 6, TAL 1.

The CAR polypeptide can also comprise a transmembrane domain (such as, for example, a NKG2D transmembrane domain, a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, and/or a CD3 ζ transmembrane domain) and a costimulatory domain (such as, for example, a 2B4 domain, a CD28 costimulatory domain, a 4-1BB costimulatory domain, or any combination of a 2B4 domain, a CD28 costimulatory domain, and/or a 4-1BB costimulatory domain). For example, in some embodiments, the CAR polypeptide comprises an IgG4 hinge domain, a CD4 transmembrane domain, a CD28 co-stimulatory domain, a cd3ζ polypeptide, and a single chain variable fragment (scFV) that specifically binds to a receptor on a target cell, including, but not limited to, a cancer cell that expresses a target antigen (e.g., CD 33). In some embodiments, the CAR polypeptide comprises an IgG4 hinge domain, a NKG2D transmembrane domain, a 2B4 domain, a cd3ζ polypeptide, and a single chain variable fragment (scFV) that specifically binds to a receptor on a target cell, including, but not limited to, a cancer cell that expresses a target antigen (e.g., CD 33). In some embodiments, the CAR polypeptides are those shown in fig. 6B. In some embodiments, a polynucleotide encoding a CAR polypeptide described herein comprises a sequence or fragment thereof that is at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID No. 22, SEQ ID No. 23. In some examples, the design of a plasmid comprising a CAR encoding polynucleotide is shown in fig. 16 and 17.

In some embodiments, a polynucleotide encoding a scFv described herein comprises a sequence or fragment thereof that is at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID No. 18.

In some embodiments, a polynucleotide encoding an IgG4 hinge described herein comprises a sequence or fragment thereof that is at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID No. 19.

In some embodiments, polynucleotides encoding the CD28 co-stimulatory domains described herein comprise a sequence or fragment thereof that is at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID No. 20.

In some embodiments, a polynucleotide encoding a cd3ζ described herein comprises a sequence or fragment thereof that is at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID No. 21, SEQ ID No. 28.

In some embodiments, a polynucleotide encoding a NKG2D transmembrane domain described herein comprises a sequence or fragment thereof that is at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID No. 24.

In some embodiments, polynucleotides encoding the 2B4 domains described herein comprise a sequence or fragment thereof that is at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID NO. 26.

In some embodiments, the polynucleotide encoding an anti-CD 33 scFv comprises a sequence or fragment thereof that is at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID No. 29.

In some embodiments, the MND promoters described herein comprise sequences or fragments thereof that are at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID NO. 30.

In some embodiments, the expression vectors described herein comprise one or more linker sequences, wherein the linker sequences comprise a sequence or fragment thereof that is at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID No. 25.

Thus, in some embodiments, the plasmids disclosed herein comprise a polynucleotide sequence encoding a CAR polypeptide, wherein the CAR polypeptide comprises a transmembrane domain (e.g., a NKG2D transmembrane domain, a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, or a CD3 ζ transmembrane domain), a costimulatory domain (e.g., a 2B4 domain, a CD28 costimulatory domain, a 4-1BB costimulatory domain, or any combination of a 2B4 domain, a CD28 costimulatory domain, and/or a 4-1BB costimulatory domain), a CD3 ζ, and a single-chain variable fragment (scFV) that specifically binds to a receptor on a target cell (e.g., a CD 33-expressing cancer cell). In some embodiments, the CAR polypeptide specifically binds CD33.

Also disclosed herein are plasmids that can be integrated into the genome of transduced cells via HITI, CRISPaint or other non-homologous end joining (NHEJ). Thus, they have the advantage of being integrated with higher efficiency. In some examples, plasmids for NHEJ are those disclosed in international publication No. WO2020/198675, which is incorporated herein by reference in its entirety. To aid in identifying cleavage sites to remove transgenes for integration, the plasmid contains one or more PAMg sequences (i.e., a pre-spacer adjacent motif (PAM) and a crRNA-encoding sequence (i.e., gRNA)) (SEQ ID NO: 9) to target donor transgene integration. In some examples, for NHEJ DNA templates (e.g., CRISPaint DNA templates), a single (PAMg) or double (pamgpamag) Cas9 targeting sequence is incorporated around a transgene (e.g., a polynucleotide encoding a CAR, such as the CD33 CAR disclosed herein), but within the ITR. Thus, cas9 can cleave both gDNA and crisp DNA templates, enabling integration at genomic DSBs.

Thus, in some aspects, disclosed herein are plasmids for use with Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated 9 (Cas 9) integration systems, wherein the plasmids comprise a polynucleotide sequence encoding a Chimeric Antigen Receptor (CAR) polypeptide; wherein the polynucleotide sequence is adjacent to or flanked by two PAM and two polynucleotide sequences encoding a pre-spacer adjacent motif (PAM) and a polynucleotide sequence encoding a crispr RNA (crRNA). In some aspects, disclosed herein are plasmids for use with Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated 9 (Cas 9) integration systems, wherein the plasmids sequentially comprise a pre-spacer sequence adjacent motif (PAM) sequence and a polynucleotide sequence encoding crRNA, a polynucleotide sequence encoding Chimeric Antigen Receptor (CAR) polypeptide, and a PAM sequence and a polynucleotide sequence encoding crRNA. In some examples, the plasmids are as shown in fig. 2B, 21, and 22.

In addition, while the use of single-stranded (SS) plasmids to insert larger transgenes is beneficial, SS plasmids may still require more time to fold and serve as double-stranded DNA inside cells prior to integration, which enhances DNA sensing mechanisms and cytotoxicity in some cells such as, for example, T cells, B cells, macrophages, NK cells, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells, and/or myocytes. In order to reduce the time of exposure to exogenous DNA in a cell, this problem is overcome herein by using a self-complementary (SC) (double-stranded) construct.

It is understood and contemplated herein that to target Cas9 nuclease activity to a target site and also cleave the donor plasmid to allow recombination of the donor transgene into the host DNA, crispr RNA (crRNA) is used. In some cases, crrnas are combined with tracrRNA to form guide RNAs (grnas). The disclosed plasmids use AAV integration, intron 1 of protein phosphatase 1, the regulatory subunit 12C (PPP 1R 12C) gene on human chromosome 19 (referred to as AAVS 1) as target sites for integration of transgenes. The locus is a "safe harbor gene" and allows stable, long-term transgene expression in many cell types. Since disruption of PPP1R12C is not associated with any known disease, the AAVS1 locus is generally considered a safe harbor for transgene targeting. Because the AAVS1 site is used as a target site, CRSPR RNA (crRNA) must target the DNA. Here, the guide RNA disclosed herein comprises GGGGCCACTAGGGACAGGAT (SEQ ID NO: 17) or any 10 nucleotide sense or antisense contiguous fragment thereof. Thus, in some examples, the PAM+ encoding crRNA sequence comprises SEQ ID NO 9. Although AAVS1 is used herein for exemplary purposes, it is understood and contemplated herein that other "safe harbor genes" with equivalent results may be used, and that these genes may be substituted for AAVS1, if more appropriate in view of the particular cell type or transgene being transfected. Examples of other safe harbor genes include, but are not limited to, the C-C chemokine receptor type 5 (CCR 5), ROSA26 locus, and TRAC.

In one example, the plasmids disclosed herein further comprise a murine leukemia virus origin (MND) promoter.

As described above, the use of AAV as a vector to deliver the CRISPR/Cas9 plasmids and any donor transgenes disclosed herein is limited to a maximum of about 4.5kb. It is to be understood and contemplated herein that one way to increase the allowable size of a transgene is to create additional space by exchanging Cas9 of streptococcus pyogenes (Streptococcus pyogenes) (SpCas 9) commonly used to synthesize Cas9 or Cas9 from a different bacterial source. Substitution of Cas9 can also be used to increase targeting specificity, thus requiring the use of fewer grnas. Thus, for example, cas9 may be derived from staphylococcus aureus (Staphylococcus aureus) (SaCas 9), amino acid coccus (AsCpf 1) species (AsCpf 1), mao Luoke bacteria (Lachnospiracase bacterium) (LbCpf 1), neisseria meningitidis (Neisseria meningitidis) (NmCas 9), streptococcus thermophilus (Streptococcus thermophilus) (StCas 9), campylobacter jejuni (Campylobacter jejuni) (CjCas 9), enhanced SpCas9 (eSpCas 9), spCas9-HF1, fokl fused dCas9, amplified Cas9 (xCas 9), and/or catalytically inactive Cas9 (dCas 9).

It is to be understood and contemplated herein that the use of a particular Cas9 can alter the PAM sequence used by the Cas9 endonuclease (or alternatives) for screening targets. As used herein, suitable PAM sequences include NGG (SpCas 9 PAM), NNGRRT (SaCas 9 PAM), NNNNGATT (NmCAs 9 PAM), nnnnnnryac (CjCas 9 PAM), NNAGAAW (St), TTTV (LbCpf 1PAM and AsCpf1 PAM); TYCV (LbCpf 1PAM variants and AsCpf1PAM variants); wherein N can be any nucleotide; v= A, C or G; y=c or T; w=a or T; and r=a or G.

In one aspect, disclosed herein are methods of genetically modifying cells, the methods comprising obtaining Ribonucleoprotein (RNP) complexes comprising class 2 CRISPR/Cas endonuclease (Cas 9) complexed with corresponding CRISPR/Cas guide RNAs (grnas) specific for target DNA sequences in the cells and plasmids comprising transgenes, such as, for example, chimeric antigen receptors for tumor antigens; wherein the transgene is flanked by homology arms; and b) introducing the transgene and RNP complex into the cell; wherein the transgene is introduced into the cell via infection of the target cell by an adeno-associated virus (AAV); wherein the RNP complex hybridizes to a target sequence within genomic DNA of the cell. In one aspect, the method may further comprise introducing the RNP complex into the cell via electroporation (such as when NK cells or NK T cells are modified). In one aspect, the method may further comprise repeatedly infecting the target cell with a second AAV virus comprising an RNP complex. In one aspect, when the transgene is sufficiently small, the same AAV may comprise both the transgene and the RNP complex. In further aspects, the transgene and RNP complex may be encoded on the same plasmid.

In one aspect, disclosed herein are methods of genetically modifying a cell (e.g., NK cell or NK T cell) comprising a) obtaining a Ribonucleoprotein (RNP) complex comprising a class 2 CRISPR/Cas endonuclease (Cas 9) complexed with a corresponding CRISPR/Cas guide RNA and an AAV vector comprising a plasmid comprising a transgene (such as, for example, a chimeric antigen receptor for a tumor antigen); wherein the transgene is adjacent to or flanked by two PAM and two crRNA encoding sequences; and b) introducing the transgene and RNP complex into the cell; wherein the transgene is introduced into the cell via AAV infection into the target cell; wherein the Ribonucleoprotein (RNP) complex hybridizes to a target sequence within the genomic DNA of the cell, and a DNA repair enzyme of the cell inserts the transgene into the host genome at the target sequence (e.g., by non-homologous end joining), thereby producing a modified cell. In one aspect, the method may further comprise introducing the RNP complex into the cell via electroporation (such as when NK cells or NK T cells are modified). In one aspect, the method may further comprise repeatedly infecting the target cell with a second AAV virus comprising an RNP complex. In one aspect, when the transgene is sufficiently small, the same AAV may comprise both the transgene and the RNP complex. In another aspect, the transgene and RNP complex may be encoded on the same plasmid.

In some examples, the AAV described herein can be used as a vector to deliver the leader editing plasmids disclosed herein and any donor transgenes described herein (e.g., polynucleotides encoding CARs). Lead editing is a "search and replace" genomic editing technique that mediates targeted insertions, deletions, base-to-base conversions, and combinations thereof in human cells without the need for DSBs or donor DNA templates. Leader editing may use fusion proteins comprising a catalytically compromised Cas9 endonuclease, an engineered reverse transcriptase, an RNA programmable nickase, and/or a leader editing guide RNA (pegRNA) to copy genetic information directly from an extension on the pegRNA into a target genomic locus. Methods for designing and using lead editing are known in the art. See, e.g., anzalone, a.v., randolph, p.b., davis, j.r., et al, search-and-replace genome editing without double-strand breaks or donor DNA, nature, volume 576: pages 149-157 (2019), which is incorporated by reference in its entirety.

It is to be understood and contemplated herein that the methods disclosed herein can be used with any cell type, including T cells, B cells, macrophages, NK cells, NK T cells, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells and/or muscle cells, as well as any other cell type. Human NK cells are particularly excellent targets for the plasmids disclosed herein and methods of use thereof. NK cells are a subset of peripheral blood lymphocytes defined by the expression of CD56 or CD16 and the absence of T cell receptor (CD 3). NK cells sense and kill target cells that lack Major Histocompatibility Complex (MHC) class I molecules. NK cell activating receptors include the natural cytotoxic receptors (NKp 30, NKp44 and NKp 46) and lectin-like receptors NKG2D and DNAM-1. Their ligands are expressed on stressed, transformed or infected cells, but not on normal cells, rendering them resistant to NK cell killing. NK cell activation is down-regulated via inhibitory receptors such as killer immunoglobulin (Ig) like receptor (KIR), NKG2A/CD94, TGF and leukocyte Ig like receptor-1 (LIR-1). In one aspect, the target cells may be primary NK cells, NK cell lines (including but not limited to NK RPMI8866; HFWT, K562, and EBV-LCL), or sources of expanded NK cells derived from primary NK cell sources or NK cell lines, from donor sources such as, for example, allogeneic donor sources or autologous donor sources (i.e., the final recipients of the modified cells) for adoptive transfer therapy.

Prior to transduction of cells (such as, for example, T cells, B cells, macrophages, NK cells, NK T cells, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells and/or muscle cells), the cells may be incubated in a medium suitable for cell proliferation. It is understood and contemplated herein that culture conditions may include the addition of cytokines, antibodies, and/or feeder cells. Thus, in one aspect, disclosed herein are methods of genetically modifying a cell (such as, for example, a T cell, B cell, macrophage, NK cell, NK T cell, fibroblast, osteoblast, hepatocyte, neuronal cell, epithelial cell, and/or myocyte), the method further comprising incubating the cell for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, or 14 days prior to transducing the cell in a medium that supports cell proliferation; wherein the medium further comprises cytokines, antibodies and/or feeder cells. For example, the medium can comprise IL-2, IL-12, IL-15, IL-18 and/or IL-21. In one aspect, the medium may further comprise an anti-CD 3 antibody. In one aspect, the feeder cells can be purified from feeder cells that stimulate the cells. For example, the NK cell-stimulating feeder cells disclosed herein for use in the claimed invention can be irradiated autologous or allogeneic Peripheral Blood Mononuclear Cells (PBMCs) or non-irradiated autologous or PBMCs; RPMI8866; HFWT, K562; k562 cells transfected with membrane-bound IL-15 and 41BBL or IL-21 or any combination thereof; or EBV-LCL. In some aspects, feeder cells are provided in combination with a solution of IL-21, IL-15, and/or 41 BBL. Feeder cells can be seeded in cell culture at a ratio of 1:2, 1:1, or 2:1. It is to be understood and contemplated herein that the incubation period may be between 1 day and 14 days (i.e., 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, or 14 days), preferably between 3 days and 7 days, and most preferably between 4 days and 6 days after AAV infection.

It is understood and contemplated herein that the incubation conditions for primary cells and expanded cells (including but not limited to primary and expanded T cells, NK T cells, or B cells) may be different. In one aspect, the culturing of the AAV pre-infection primary NK cells or NK T cells comprises culturing the medium and cytokines (such as, e.g., IL-2, IL-12, IL-15, IL-18, and/or IL-21) and/or anti-CD 3 antibodies for less than 5 days (e.g., 1 day, 2 days, 3 days, or 4 days). For expanded NK cells, the culture can be performed in addition to or instead of the cytokines (such as, for example, IL-2, IL-12, IL-15, IL-18, and/or IL-21) and/or anti-CD 3 antibodies in the presence of NK feeder cells (e.g., at a ratio of 1:1). The culturing of NK cells expanded prior to transduction may be performed for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or 10 days. Thus, in one aspect, disclosed herein are methods of genetically modifying cells (such as, for example, T cells, B cells, macrophages, NK cells, NK T cells, fibroblasts, neuronal cells, osteoblasts, hepatocytes, epithelial cells, and/or myocytes) comprising incubating primary cells in the presence of IL-2 for 4 days prior to infection and/or electroporation with an AAV vector (when the RNP complex is introduced via electroporation), or incubating expanded cells in the presence of irradiated feeder cells for 4 days, 5 days, 6 days, or 7 days prior to infection and/or electroporation with an AAV (when the RNP complex is introduced via electroporation).

Following transduction (e.g., via AAV infection or electroporation) of cells (such as, e.g., T cells, B cells, macrophages, NK cells, NK T cells, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells, and/or myocytes), existing modified cells can proliferate in a medium comprising feeder cells that stimulate the modified cells (such as, e.g., T cells, B cells, macrophages, NK cells, NK T cells, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells, and/or myocytes). Thus, the modified cells retain viability and proliferative potential because they can be expanded using irradiated feeder cells following AAV infection and/or electroporation (when RNP complexes are introduced via electroporation). For example, the NK cell-stimulating feeder cells disclosed herein for use in the claimed invention can be irradiated autologous or allogeneic Peripheral Blood Mononuclear Cells (PBMCs) or non-irradiated autologous or PBMCs; RPMI8866; HFWT, K562; k562 cells transfected with membrane-bound IL-15 and 41BBL or IL-21 or any combination thereof; or EBV-LCL. In some aspects, NK cell feeder cells are provided in combination with solutions of IL-21, IL-15 and/or 41 BBL. Feeder cells can be seeded in NK cell cultures at a ratio of 1:2, 1:1 or 2:1. It is to be understood and contemplated herein that the incubation period may be between 1 day and 14 days (i.e., 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, or 14 days), preferably between 3 days and 7 days, and most preferably between 4 days and 6 days after infection and/or electroporation. In some aspects, the medium used to culture the modified NK cells can also include cytokines such as, for example, IL-2, IL-12, IL-15, IL-18, and/or IL-21.

In one aspect, it is to be understood and contemplated herein that one goal of the disclosed methods of genetically modifying cells is to produce modified cells. Thus, disclosed herein are modified T cells, B cells, macrophages, NK cells, NK T cells, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells and/or myocytes prepared by the methods disclosed herein. Thus, in one aspect, disclosed herein are modified NK cells and/or NK T cells (including but not limited to CAR NK cells and/or CAR NK T cells) comprising any of the plasmids or vectors disclosed herein. For example, disclosed herein are anti-CD 33CAR NK cells and anti-CD 33CAR NK T cells (including but not limited to anti-CD 33CAR NK cells and/or NK T cells, wherein an anti-CD 33CAR comprises a scFv that targets CD33, a transmembrane domain (such as, for example, a NKG2D transmembrane domain, a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, and/or a CD3 ζ transmembrane domain), and a co-stimulatory domain (such as, for example, a 2B4 domain, a CD28 co-stimulatory domain, a 4-1BB co-stimulatory domain, or any combination of a 2B4 domain, a CD28 co-stimulatory domain, and/or a 4-1BB co-stimulatory domain).

In one aspect, disclosed herein are methods of producing Chimeric Antigen Receptor (CAR) Natural Killer (NK) cells, comprising a) obtaining a Ribonucleoprotein (RNP) complex comprising a class 2 CRISPR/Cas endonuclease (Cas 9) complexed with a corresponding CRISPR/Cas guide RNA and an AAV vector comprising a plasmid comprising a transgene (such as, for example, a chimeric antigen receptor for a tumor antigen); wherein the transgene is adjacent to or flanked by two PAM and crRNA strands; and b) introducing the transgene and RNP complex into the cell; wherein the transgene is introduced into the cell via infection of the target cell by an adeno-associated virus (AAV); wherein the Ribonucleoprotein (RNP) complex hybridizes to a target sequence within the genomic DNA of the cell, and a DNA repair enzyme of the cell inserts the transgene into the host genome at the target sequence (e.g., by non-homologous end joining), thereby producing a modified cell. In one aspect, the method may further comprise introducing the RNP complex into the cell via electroporation (such as when NK cells or NK T cells are modified). In one aspect, the method may further comprise repeatedly infecting the target cell with a second AAV virus comprising an RNP complex. In one aspect, when the transgene is sufficiently small, the same AAV may comprise both the transgene and the RNP complex. In another aspect, the transgene and RNP complex may be encoded on the same plasmid.

In some aspects, disclosed herein are methods of genetically modifying a cell, the method comprising a) obtaining a Ribonucleoprotein (RNP) complex comprising a class 2 CRISPR/Cas endonuclease (Cas 9) complexed with a corresponding CRISPR/Cas guide RNA and an AAV vector comprising a plasmid comprising a polynucleotide sequence encoding a Chimeric Antigen Receptor (CAR) polypeptide; wherein the polynucleotide sequence is flanked by homology arms; and wherein the homology arm is 800bp or less in length; and b) introducing the polynucleotide sequence and the RNP complex into a cell; wherein the polynucleotide sequence is introduced into the cell via AAV infection into the cell; wherein the RNP complex hybridizes to a target sequence within genomic DNA of the cell, and the DNA repair enzyme of the cell inserts a transgene into the host genome at the target sequence within genomic DNA of the cell, thereby producing a modified cell. In some embodiments, the cell is an NK cell.

In one aspect, the modified cells (e.g., NK cells) used in the presently disclosed immunotherapeutic methods and produced by the presently disclosed modification methods can be primary cells, cell lines (including but not limited to NK cell line NK RPMI8866; HFWT, K562, and EBV-LCL), or sources of expanded cells derived from primary cell sources or cell lines, such as, for example, allogeneic or autologous donor sources (i.e., the final recipients of the modified cells) for adoptive transfer therapy. Because primary cells can be used, it is understood and contemplated herein that the cell modifications disclosed herein can occur ex vivo or in vitro.

The cells used herein may be primary cells or expanded cells. The primary cells may be incubated in the presence of IL-2 for about 4 to 10 days prior to infection with the AAV vector. In one example, prior to infection, the primary cells are expanded in the presence of irradiated feeder cells, plasma membrane particles, or exosomes for about 4 to 10 days. In some embodiments, the irradiated feeder cells, plasma membrane particles, or exosomes express membrane-bound 4-1BBL, membrane-bound IL-21, or membrane-bound IL-15, or any combination thereof.

After transduction of the cells (e.g., NK cells), the modified cells can be expanded and stimulated prior to administration of the modified (i.e., engineered) cells to a subject. For example, disclosed herein are methods of adoptively transferring immune cells into a subject in need thereof, wherein immune cells (e.g., natural Killer (NK) cells) are expanded with irradiated feeder cells, plasma Membrane (PM) particles, or Exosomes (EX) expressing membrane-bound IL-21 (mbIL-21) (PM particles and EX exosomes expressing mbIL-21 are referred to herein as PM21 particles and EX21 exosomes, respectively) prior to administration to the subject. In some aspects, the expansion may further comprise irradiated feeder cells, plasma Membrane (PM) particles, or exosomes expressing membrane-bound IL-15 (mbiL-15) and/or membrane-bound 4-1BBL (mb 4-1 BBL). In some aspects, it is understood and contemplated herein that stimulation and expansion of the modified (i.e., engineered) cells can occur in vivo after or concurrently with administration of the modified cells to a subject. Thus, disclosed herein are immunotherapeutic methods, wherein cells (e.g., NK cells) are expanded in a subject after transferring the cells into the subject via administration of IL-21 or PM particles with mbIL-21, exosomes with mbIL-21, and/or irradiated mbIL-21 expressing feeder cells. In some aspects, the expansion further comprises administering IL-15 and/or 4-1BBL, or PM particles expressing membrane-bound IL-15 and/or 4-1BBL, exosomes, and/or irradiated feeder cells.

In some embodiments, the methods disclosed herein comprise infecting NK cells with an AAV having a MOI ranging from about 1 to about 1000K MOI (e.g., about 5 to 500K MOI). For example, the methods disclosed herein comprise infecting NK cells with an AAV of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, or 500 MOI.

1. hybridization/Selective hybridization

The term "hybridization" generally means a sequence driven interaction between at least two nucleic acid molecules, such as primers or probes, and a gene. Sequence driven interactions means interactions that occur in a nucleotide specific manner between two nucleotides or nucleotide analogs or nucleotide derivatives. For example, G-C interactions or a-T interactions are sequence driven interactions. Typically, the sequence-driven interactions occur on the Watson-Crick or Hoogsteen faces of the nucleotides. Hybridization of two nucleic acids is affected by a number of conditions and parameters known to those skilled in the art. For example, the salt concentration, pH and temperature of the reaction all affect whether two nucleic acid molecules will hybridize.

Parameters for selective hybridization between two nucleic acid molecules are well known to those skilled in the art. For example, in some embodiments, selective hybridization conditions may be defined as stringent hybridization conditions. For example, the stringency of hybridization is controlled by both the temperature and salt concentration of either or both of the hybridization and wash steps. For example, hybridization conditions to achieve selective hybridization can include hybridization in a high ionic strength solution (6 XSSC or 6 XSSPE) at a temperature about 12℃to 25℃below the Tm (melting temperature at which half of the molecules dissociate from their hybridization partners), followed by washing at a combination of selected temperatures and salt concentrations such that the washing temperature is about 5℃to 20℃below the Tm. The temperature and salt conditions are readily determined empirically in preliminary experiments in which a reference DNA sample immobilized on a filter is hybridized to a labeled nucleic acid of interest and then washed under conditions of varying stringency. For DNA-RNA and RNA-RNA hybridization, the hybridization temperature is typically higher. Conditions as described above may be used to achieve stringency, or as known in the art. The preferred stringent hybridization conditions for DNA hybridization may be hybridization in 6 XSSC or 6 XSSPE at about 68℃in aqueous solution followed by washing at 68 ℃. If desired, the stringency of hybridization and washing can be reduced correspondingly with reduced degree of complementarity required, and further depends on the G-C or A-T enrichment of any region in which variability is sought. Likewise, if desired, the stringency of hybridization and washing can be increased accordingly with increased desired homology, and further depends on the G-C or A-T enrichment of any regions where high homology is desired, all as is known in the art.

Another way to define selective hybridization is by observing the amount (percent) of binding of one nucleic acid to another. For example, in some embodiments, selective hybridization conditions are when at least about 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% of the restriction nucleic acids bind to the non-restriction nucleic acids. Typically, the non-limiting primer is in a 10-fold or 100-fold or 1000-fold excess, for example. This type of assay can be performed under the following conditions: wherein both the restriction primer and the non-restriction primer are below k _d For example 10-fold or 100-fold or 1000-fold, or wherein only one nucleic acid molecule is less than 10-fold or 100-fold or 1000-fold, or wherein one or both nucleic acid molecules is greater than k _d 。

Another way to define selective hybridization is by observing the percentage of primers that are enzymatically manipulated under conditions that require hybridization to promote the desired enzymatic manipulation. For example, in some embodiments, the selective hybridization condition is when at least about 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% of the primers are enzyme-operated under conditions that promote enzyme operation, e.g., if the enzyme operation is DNA extension, the selective hybridization condition is when at least about 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% of the primer molecules are extended. Preferred conditions also include those suggested by the manufacturer or indicated in the art as suitable for the enzyme to be operated on.

As with homology, it is to be understood that various methods are disclosed herein for determining the level of hybridization between two nucleic acid molecules. It will be appreciated that these methods and conditions may provide different percentages of hybridization between two nucleic acid molecules, but unless otherwise indicated, parameters that meet any of these methods will be sufficient. For example, if 80% hybridization is desired, it is considered herein to be disclosed so long as hybridization occurs within the desired parameters of any of these methods.

It will be understood by those of skill in the art that a composition or method is disclosed herein if it meets any of these criteria for co-or separate determination of hybridization.

2. Nucleic acid

Disclosed herein are various nucleic acid-based molecules. The nucleic acids disclosed in the present invention consist of, for example, nucleotides, nucleotide analogs or nucleotide substitutes. Non-limiting examples of these and other molecules are discussed herein. It will be appreciated that, for example, when the vector is expressed in a cell, the expressed mRNA typically consists of A, C, G and U. Also, it will be appreciated that if, for example, the antisense molecule is introduced into a cell or cellular environment by, for example, exogenous delivery, it is advantageous that the antisense molecule consists of nucleotide analogs that reduce degradation of the antisense molecule in the cellular environment.

a) Nucleotides and related molecules

A nucleotide is a molecule that contains a base moiety, a sugar moiety, and a phosphate moiety. Nucleotides may be linked together by their phosphate and sugar moieties, thereby creating internucleotide linkages. The base portion of a nucleotide may be adenine-9-yl (A), cytosine-1-yl (C), guanine-9-yl (G), uracil-1-yl (U) and thymine-1-yl (T). The sugar portion of a nucleotide is ribose or deoxyribose. The phosphate moiety of a nucleotide is a pentavalent phosphate. Non-limiting examples of nucleotides are 3'-AMP (adenosine 3' -monophosphate) or 5'-GMP (guanosine 5' -monophosphate). A variety of these types of molecules are available in the art and can be obtained herein.

Nucleotide analogs are some type of modified nucleotide that contains a moiety that is a base, sugar, or phosphate. Modifications to nucleotides are well known in the art and include, for example, modifications at the 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, and 2-aminoadenine, as well as at the sugar or phosphate moiety. A variety of these types of molecules are available in the art and can be obtained herein.

Nucleotide substitutes are molecules such as Peptide Nucleic Acids (PNAs) that have similar functional properties as nucleotides but do not contain a phosphate moiety. Nucleotide substitutes are molecules that will recognize nucleic acids in Watson-Crick or Hoogsteen fashion but are linked together by a moiety other than a phosphate moiety. Nucleotide substitutions can conform to a double helix structure when interacting with an appropriate target nucleic acid. A variety of these types of molecules are available in the art and can be obtained herein.

Other types of molecules (conjugates) can also be attached to the nucleotide or nucleotide analog to enhance, for example, cellular uptake. The conjugate may be chemically linked to a nucleotide or nucleotide analogue. Such conjugates include, but are not limited to, lipid moieties such as cholesterol moieties. (Letsinger et al, proc. Natl. Acad. Sci. USA,1989, vol.86, pp.6553-6556). A variety of these types of molecules are available in the art and can be obtained herein.

Watson-Crick interactions are interactions with at least one of the Watson-Crick faces of a nucleotide, nucleotide analog, or nucleotide substitute. Watson-Crick faces of nucleotides, nucleotide analogs, or nucleotide substitutes include positions C2, N1, and C6 of purine-based nucleotides, nucleotide analogs, or nucleotide substitutes, and positions C2, N3, and C4 of pyrimidine-based nucleotides, nucleotide analogs, or nucleotide substitutes.

Hoogsteen interactions are interactions that occur on the Hoogsteen face of a nucleotide or nucleotide analog that are exposed in the major groove of duplex DNA. Hoogsteen faces include reactive groups (NH 2 or O) at position N7 and position C6 of purine nucleotides.

b) Sequence(s)

There are many sequences associated with protein molecules involved in the signaling pathways disclosed herein, such as CD33, 4-1BB, NKG2D or 2B4, all of which are encoded by or are nucleic acids. Human analogs of these genes, as well as other analogs, alleles, splice variants, and other types of variants of these genes, are available in a variety of proteins and gene databases (including Genbank). Those skilled in the art understand how to address sequence differences and how to adjust the compositions and methods related to a particular sequence to other related sequences. Primers and/or probes may be designed for any given sequence, taking into account the information disclosed herein and known in the art.

c) Primer and probe

Disclosed are compositions comprising primers and probes that are capable of interacting with a nucleic acid disclosed herein, such as CD33 disclosed herein. In certain embodiments, primers are used to support a DNA amplification reaction. Typically, the primers will be capable of extending in a sequence-specific manner. Primer extension in a sequence-specific manner includes any method in which the sequence and/or composition of the nucleic acid molecule to which the primer hybridizes or otherwise associates directs or affects the composition or sequence of the product resulting from primer extension. Thus, primer extension in a sequence-specific manner includes, but is not limited to, PCR, DNA sequencing, DNA extension, DNA polymerization, RNA transcription, or reverse transcription. Techniques and conditions for amplifying primers in a sequence-specific manner are preferred. In certain embodiments, the primers are used in a DNA amplification reaction, such as PCR or direct sequencing. It will be appreciated that in certain embodiments, primers may also be extended using non-enzymatic techniques, wherein, for example, the nucleotides or oligonucleotides used to extend the primers are modified such that they will chemically react to extend the primers in a sequence-specific manner. Typically, the primers disclosed herein hybridize to the nucleic acids or regions of the nucleic acids disclosed herein, or they hybridize to the complement of the nucleic acids or the complement of regions of the nucleic acids.

In certain embodiments, the size of the primer or probe used to interact with the nucleic acid may be any size that supports the desired enzymatic manipulation of the primer (such as DNA amplification) or simple hybridization of the probe or primer. Typical primers or probes will be at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500 or 4000 nucleotides long.

In the case of a further embodiment of the present invention, the primer or probe may be less than or equal to 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, and 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500 or 4000 nucleotides long.

Primers for the CD33 gene are typically used to generate amplified DNA products containing regions of the CD33 gene or the complete gene. Generally, the size of the product is generally such that the size can be precisely determined to within 3, 2 or 1 nucleotides.

In some embodiments of the present invention, in some embodiments, the products were at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500 or 4000 nucleotides long.

In the case of a further embodiment of the present invention, the product is less than or equal to 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500 or 4000 nucleotides long.

3. Delivering the composition to a cell

There are a number of compositions and methods that can be used to deliver nucleic acids to cells in vitro or in vivo. These methods and compositions can be largely divided into two categories: viral-based delivery systems and non-viral-based delivery systems. For example, the nucleic acid may be delivered by a number of direct delivery systems such as electroporation, lipofection, calcium phosphate precipitation, plasmids, viral vectors, viral nucleic acids, phage nucleic acids, phages, cosmids, or via transfer of genetic material in cells or vectors such as cationic liposomes. Suitable transfection means include viral vectors, chemical transfectants or direct diffusion of DNA such as electroporation and DNA and are described, for example, by Wolff, J.A. et al, science, volume 247, pages 1465-1468 (1990) and Wolff, J.A., nature, volume 352, pages 815-818 (1991). Such methods are well known in the art and are readily adaptable for use with the compositions and methods described herein. In some cases, these methods will be modified to be specific for large DNA molecules. In addition, these methods can target certain diseases and cell populations by using the targeting characteristics of the vector.

a) Nucleic acid-based delivery system

The transfer vector may be any nucleotide construct (e.g., a plasmid) for delivering the gene into the cell, or as part of a general strategy for delivering the gene, e.g., as part of a recombinant retrovirus or adenovirus (Ram et al, cancer Res., vol. 53: pages 83-88 (1993)). In some examples, the plasmids described herein can be DNA templates or nucleotide constructs comprising the polynucleotide sequences provided herein.

As used herein, a plasmid or viral vector is a vehicle that conveys the disclosed nucleic acids into a cell without degradation, and includes a promoter that produces gene expression in the cell into which it is delivered. Viral vectors are, for example, adenoviruses, adeno-associated viruses, herpesviruses, vaccinia viruses, polioviruses, AIDS viruses, neurotrophic viruses, sindbis viruses and other RNA viruses, including those viruses having an HIV backbone. Also preferred are any families of viruses that share the characteristics of these viruses that make them suitable for use as vectors. Retroviruses include murine Moloney leukemia virus MMLV and retroviruses expressing MMLV as a vector for desirable properties. Retroviral vectors are capable of carrying a larger genetic payload, i.e., transgene or marker gene, than other viral vectors and are therefore commonly used vectors. However, they are not useful in non-proliferating cells. Adenovirus vectors are relatively stable and easy to process, have high titers, can be delivered in aerosol formulations, and can transfect non-dividing cells. Poxvirus vectors are large and have several sites for insertion of genes, which are thermostable and can be stored at room temperature. A preferred embodiment is a viral vector that has been engineered to suppress the immune response of a host organism elicited by a viral antigen. Preferred vectors of this type will carry the coding region of interleukin 8 or 10.

Viral vectors may have a higher transactivability (the ability to introduce genes) than chemical or physical methods of introducing genes into cells. Typically, viral vectors contain non-structural early genes, structural late genes, RNA polymerase III transcripts, inverted terminal repeats necessary for replication and packaging, and promoters to control transcription and replication of the viral genome. When engineered as vectors, one or more of the early genes of the virus are typically removed and a gene or gene/promoter cassette is inserted into the viral genome to replace the removed viral DNA. Constructs of this type can carry exogenous genetic material up to about 8 kb. The necessary functions of the removed early genes are typically provided by cell lines that have been engineered to trans-express the gene products of the early genes.

(1) Adeno-associated viral vectors

Another type of viral vector is based on adeno-associated virus (AAV). This defective parvovirus is a preferred vector because it can infect many cell types and is not pathogenic to humans. AAV type vectors can transmit about 4kb to 5kb, and wild-type AAV is known to be stably inserted into chromosome 19, such as, for example, at AAV integration site 1 (AAVs 1). Vectors containing this site-specific integration feature are preferred. The AAV used may be derived from any AAV serotype, including, but not limited to, AAC1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and recombinant AAV (rAAV, e.g., AAV-Rh 74) and/or synthetic AAV (such as, e.g., AAV-DJ, anc 80). AAV serotypes may be selected based on cell or tissue tropism. AAV vectors used in the disclosed compositions and methods can be Single Stranded (SS) or self-complementary (SC).

In another type of AAV virus, AAV contains a pair of Inverted Terminal Repeats (ITRs) flanking at least one cassette containing a promoter operably linked to a heterologous gene that directs cell-specific expression. Heterologous in this context refers to any nucleotide sequence or gene that is not native to AAV or B19 parvovirus.

Typically, AAV and B19 coding regions have been deleted, resulting in a safe, non-cytotoxic vector. AAV ITRs or modifications thereof confer infectivity and site-specific integration, but do not confer cytotoxicity, and promoters direct cell-specific expression.

Thus, the disclosed vectors provide DNA molecules that are capable of integrating into mammalian chromosomes without significant toxicity.

Genes inserted in viruses and retroviruses typically contain promoters and/or enhancers to help control the expression of the desired gene product. A promoter is typically one or more DNA sequences that function when in a relatively fixed position with respect to the transcription initiation site. Promoters contain core elements required for basic interactions of RNA polymerase and transcription factors, and may contain upstream elements and response elements.

It is understood and contemplated herein that the packaging capacity of AAV is limited. One approach to overcome the limited loading capacity of AAV vectors is through the use of two vectors, where the transgene is split between two plasmids, and two segments of the transgene are spliced into a single full length transgene using a 3 'splice donor and a 5' splice acceptor. Alternatively, the two transgenes can be made to have substantial overlap, and homologous recombination joins the two fragments into a full length transcript.

4. Expression system

Nucleic acids delivered to cells typically contain expression control systems. For example, genes inserted in viral and retroviral systems typically contain promoters and/or enhancers to help control the expression of the desired gene product. A promoter is typically one or more DNA sequences that function when in a relatively fixed position with respect to the transcription initiation site. Promoters contain core elements required for basic interactions of RNA polymerase and transcription factors, and may contain upstream elements and response elements.

a) Viral promoters and enhancers

Preferred promoters for controlling transcription from vectors in mammalian host cells are available from a variety of sources, such as, for example, the genomes of the following viruses: polyoma virus, simian virus 40 (SV 40), adenovirus, retrovirus, -hepatitis B virus and most preferably cytomegalovirus, or obtained from heterologous mammalian promoters, such as the beta actin promoter. The early and late promoters of SV40 virus are conveniently obtained as SV40 restriction fragments which also contain the SV40 viral origin of replication (Fiers et al Nature, vol.273:113 (1978)). The immediate early promoter of human cytomegalovirus is conveniently available as a HindIII E restriction fragment (Greenway, P.J. et al, gene, vol.18:355-360 (1982)). Of course, promoters from host cells or related species may also be used herein.

Enhancers generally refer to DNA sequences that function at a non-fixed distance from the transcription initiation site and may be 5 '(Laimins, L. Et al, proc. Natl. Acad. Sci., volume 78: page 993 (1981)) or 3' (Lusky, M.L. et al, mol. Cell Bio., volume 3: page 1108 (1983)) of the transcription unit. Furthermore, enhancers can be located within the intron (Banerji, J.L. et al, cell, volume 33: 729 (1983)), within the coding sequence itself (Osborne, T.F. et al, mol.cell Bio., volume 4: 1293 (1984)). They are typically between 10bp and 300bp in length, and they act in cis. Enhancers function to increase transcription from nearby promoters. Enhancers also typically contain response elements that mediate transcriptional regulation. Promoters may also contain response elements that mediate transcriptional regulation. Enhancers generally determine the regulation of gene expression. While many enhancer sequences from mammalian genes (globin, elastase, albumin, -fetoprotein, and insulin) are now known, one will typically use enhancers from eukaryotic cell viruses for general expression. Preferred examples are the SV40 enhancer on the posterior side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the adenovirus enhancer and the polyoma enhancer on the posterior side of the replication origin.

Promoters and/or enhancers can be specifically activated by light or specific chemical events that trigger their function. The system may be modulated by agents such as tetracycline and dexamethasone. Also methods can enhance viral vector gene expression by exposure to radiation (such as gamma radiation) or alkylated chemotherapeutic agents.

In certain embodiments, the promoter and/or enhancer region may act as a constitutive promoter and/or enhancer to maximize expression of the transcriptional unit region to be transcribed. In certain constructs, the promoter and/or enhancer region is active in all eukaryotic cell types, even if it is expressed in a particular type of cell only at a particular time. A preferred promoter of this type is the CMV promoter (650 bases). Other preferred promoters are the SV40 promoter, the cytomegalovirus (full length promoter) and the retroviral vector LTR.

It has been shown that all specific regulatory elements can be cloned and used to construct expression vectors that are selectively expressed in specific cell types, such as melanoma cells. The glial cellulose acetate (GFAP) promoter has been used to selectively express genes in glial cell-derived cells.

Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant, animal, human or nucleated cells) may also contain sequences necessary for the termination of transcription that may affect mRNA expression. These regions are transcribed as polyadenylation fragments in the untranslated portions of the mRNA encoding tissue factor proteins. The 3' untranslated region also contains a transcription termination site. Preferably, the transcriptional unit further comprises a polyadenylation region. One benefit of this region is that it increases the likelihood that the transcribed unit will be processed and transported like an mRNA. The identification and use of polyadenylation signals in expression constructs has been recognized. It is preferred to use a homologous polyadenylation signal in the transgene construct. In certain transcriptional units, the polyadenylation region is derived from the SV40 early polyadenylation signal and consists of about 400 bases. It is also preferred that the transcriptional unit contains other standard sequences, alone or in combination with the above sequences, to enhance expression or stability of the construct.

b) Markers

The viral vector may comprise a nucleic acid sequence encoding a marker product. The marker product is used to determine whether the gene has been delivered to the cell and is expressed after delivery. The preferred marker gene is the E.coli (E.Coli) lacZ gene encoding beta-galactosidase and green fluorescent protein.

In some embodiments, the marker may be a selectable marker. Examples of suitable selectable markers for mammalian cells are dihydrofolate reductase (DHFR), thymidine kinase, neomycin analog G418, hygromycin and puromycin. When such selectable markers are successfully transferred into mammalian host cells, the transformed mammalian host cells can survive if placed under selective pressure. There are two widely used different classes of alternatives. The first category is based on cell metabolism and the use of mutant cell lines that lack the ability to grow independently of the supplemented media. Two examples are: CHO DHFR-cells and mouse LTK-cells. These cells lack the ability to grow without the addition of nutrients such as thymidine or hypoxanthine. Because these cells lack certain genes necessary for the complete nucleotide synthesis pathway, they cannot survive unless the deleted nucleotides are provided in the supplemented medium. An alternative way to supplement the medium is to introduce the complete DHFR or TK gene into cells lacking the corresponding gene, thereby altering their growth requirements. Individual cells not transformed with DHFR or TK genes will not survive in the non-supplemented medium.

The second category is dominant selection, which refers to a selection scheme for any cell type and does not require the use of mutant cell lines. These protocols typically employ drugs to prevent growth of the host cell. Those cells with the novel gene will express a protein that can transmit resistance and will survive the selection. Examples of such dominant selections use the drugs neomycin (Southern P. And Berg, P., "J.molecular. Appl. Genet.," volume 1: page 327 (1982)), mycophenolic acid (Mulligan, R.C. and Berg, P., "Science", volume 209: page 1422 (1980)), or hygromycin (Sugden, B.et al, "mol. Cell. Biol., volume 5: pages 410-413 (1985)). These three examples use bacterial genes under eukaryotic cell control to deliver resistance to the appropriate drugs G418 or neomycin (geneticin), xgpt (mycophenolic acid) or hygromycin, respectively. Other drugs include the neomycin analog G418 and puromycin.

5. Peptides

a) Protein variants

Protein variants and derivatives are well known to those skilled in the art and may include amino acid sequence modifications. For example, amino acid sequence modifications typically fall into one or more of the following three classes: substituted, inserted or deleted variants. Insertions include amino and/or carboxy-terminal fusions, as well as intrasequence insertions of single or multiple amino acid residues. Insertions are typically smaller insertions than amino-or carboxy-terminal fusions, e.g., insertions of about one to four residues. Immunogenic fusion protein derivatives such as those described in the examples are prepared by in vitro cross-linking or by fusing polypeptides large enough to render the target sequence immunogenic with recombinant cell cultures transformed with DNA encoding the fusion. Deletions are characterized by the removal of one or more amino acid residues from the protein sequence. Typically, no more than about 2 to 6 residues are deleted at any one site within the protein molecule. These variants are typically prepared by site-specific mutagenesis of nucleotides in the DNA encoding the protein, thereby producing DNA encoding the variant, which is then expressed in recombinant cell culture. Techniques for substitution mutation at a predetermined site in DNA having a known sequence are well known, for example, M13 primer mutagenesis and PCR mutagenesis. Amino acid substitutions are typically substitutions of a single residue, but may occur at many different positions simultaneously; insertions are typically of about 1 to 10 amino acid residues; and the deletion is a deletion in the range of about 1 to 30 residues. Deletions or insertions are preferably made in adjacent pairs, i.e., 2 residues are deleted or 2 residues are inserted. Substitutions, deletions, insertions, or any combination thereof may be combined to obtain the final construct. Mutations do not place the sequence out of reading frame, preferably do not form complementary regions that can produce secondary mRNA structure. Substitution variants are those in which at least one residue has been removed and a different residue inserted at its position. Such substitutions are generally made according to tables 5 and 6 below and are referred to as conservative substitutions.

Table 5: amino acid abbreviations

Table 6: amino acid substitutions

Exemplary conservative substitutions of the original residue, other substitutions are known in the art.

Substantial changes in functional or immunological properties were made by selecting substitutions that are less conservative than those in table 6, i.e., selecting residues that differ more significantly in their effect of maintaining: (a) The structure of the polypeptide backbone in the substituted region, e.g., as a folded or helical conformation; (b) charge or hydrophobicity of the molecule at the target site; or (c) the size of the side chain. Substitutions that are generally expected to produce the greatest change in protein properties are those that: wherein (a) a hydrophilic residue (e.g., seryl or threonyl) replaces (or is replaced by) a hydrophobic residue (e.g., leucyl, isoleucyl, phenylalanyl, valyl or alanyl); (b) Cysteine or proline in place of (or by) any other residue; (c) A residue having an electropositive side chain (e.g., lysyl, arginyl, or histidyl) replaces an electronegative residue (e.g., glutamyl or aspartyl) (or is substituted with an electronegative residue); or (d) substitution of residues with large side chains (e.g., phenylalanine) for residues without side chains (in this case, e.g., glycine) (or substitution by residues without side chains), (e) by increasing the number of sites for sulfation and/or glycosylation.

For example, one skilled in the art knows that substitution of one amino acid residue with another amino acid residue of similar biological and/or chemical nature is a conservative substitution. For example, a conservative substitution is one hydrophobic residue substituted for another, or one polar residue substituted for another. Substitutions include combinations such as, for example, gly, ala; val, ile, leu; asp, glu; asn, gln; ser, thr; lys, arg; and Phe, tyr. Variations of such conservative substitutions for each of the specifically disclosed sequences are included within the mosaic polypeptides provided herein.

Substitution or deletion mutagenesis may be used to insert sites for N-glycosylation (Asn-X-Thr/Ser) or O-glycosylation (Ser or Thr). Deletion of cysteines or other labile residues may also be desirable. Deletion or substitution of potential proteolytic sites such as Arg is achieved, for example, by deleting one of the basic residues or replacing one with a glutaminyl or histidyl group.

Some post-translational derivatization is the result of the effect of the recombinant host cell on the expressed polypeptide. Glutaminyl and asparaginyl residues are often post-translationally deamidated to the corresponding glutamyl and aspartyl residues. Alternatively, these residues are deamidated under weakly acidic conditions. Other post-translational modifications include hydroxylation of proline and lysine; phosphorylation of hydroxyl groups of seryl or threonyl residues; methylation of O-amino groups of lysine, arginine and histidine side chains (T.E. Cright, proteins: structure and Molecular Properties, W.H. Freeman & Co., san Francisco, pages 79-86 [1983 ]); acetylation of the N-terminal amine; and in some cases amidation of the C-terminal carboxyl group.

It is to be understood that one way to define variants and derivatives of the proteins disclosed herein is by defining variants and derivatives in terms of homology/identity to a particular known sequence. Specifically disclosed are variants of these and other proteins disclosed herein that have at least 70% or 75% or 80% or 85% or 90% or 95% homology to the sequence. One skilled in the art will readily understand how to determine the homology of two proteins. For example, homology can be calculated after aligning two sequences such that homology is at its highest level.

Another way of calculating homology may be by the disclosed algorithm. Optimal alignment of sequences for comparison can be obtained by Smith and Waterman, adv.appl.math., volume 2: local homology algorithm on page 482 (1981); volume 48 by Needleman and Wunsch, j.mol biol: homology alignment algorithm at page 443 (1970); proc.Natl. Acad.Sci.U.S.A. by Pearson and Lipman, volume 85: a similarity search method on page 2444 (1988); computerized implementation of these algorithms (GAP, BESTFIT, FASTA and TFASTA in Wisconsin Genetics Software Package, genetics Computer Group,575Science Dr., madison, WI); or by inspection.

For nucleic acids, the nucleic acids are prepared by, for example, zuker, m., science, volume 244: pages 48-52, 1989; jaeger et al proc.Natl. Acad. Sci. USA, volume 86: pages 7706-7710, 1989; jaeger et al, methods enzymes, volume 183: the algorithm disclosed in 1989 can achieve the same type of homology on pages 281-306.

It will be appreciated that descriptions of conservative mutations and homology can be combined in any combination, such as embodiments having at least 70% homology with a particular sequence, where the variant is a conservative mutation.

As various proteins and protein sequences are discussed herein, it is to be understood that nucleic acids encoding such protein sequences are also disclosed. This includes all degenerate sequences related to a particular protein sequence, i.e., all nucleic acids having a sequence encoding a particular protein sequence, as well as all nucleic acids encoding variants and derivatives of the disclosed protein sequences (including degenerate nucleic acids). Thus, while each particular nucleic acid sequence may not be written herein, it is to be understood that each sequence is actually disclosed and described herein by the protein sequences disclosed herein. It is also understood that while no amino acid sequence indicates which specific DNA sequences are encoding the protein in an organism, where specific variants of the disclosed proteins are disclosed herein, known nucleic acid sequences encoding the proteins are also known and are disclosed and described herein.

It should be understood that there are many amino acids and peptide analogs that can be incorporated into the disclosed compositions. For example, there are many D amino acids or amino acids having different functional substituents from those shown in tables 5 and 6. Opposite stereoisomers of naturally occurring peptides are disclosed, as well as stereoisomers of peptide analogs. These amino acids can be easily incorporated into polypeptide chains by loading tRNA molecules with selected amino acids and engineering genetic constructs that utilize, for example, amber codons to insert the analog amino acids into the peptide chain in a site-specific manner.

Molecules can be produced that resemble peptides but are not linked by natural peptide bonds. For example, the bond of an amino acid or amino acid analog may include CH ₂ NH--、--CH ₂ S--、--CH ₂ -CH ₂ --、--CH＝CH--(cis and trans), - -COCH ₂ --、--CH(OH)CH ₂ - -and- -CHH ₂ SO- (these and other bonds can be found in Spatula, A.F., chemistry and Biochemistry of Amino Acids, peptides, and Proteins, B.Weinstein, eds., marcel Dekker, new York, page 267 (1983)), spatula, A.F., vega Data (3, 1983), vol.1, 3, peptide Backbone Modifications (general overview), morley, trends Pharm Sci (1980), pages 463-468, hudson, D.et al, int J Pept Prot Res, vol.14, pages 177-185 (1979) (- -CH) ₂ NH--、CH ₂ CH ₂ - -); spato et al, life Sci, volume 38: pages 1243-1249 (1986) (- -CH H) ₂ -S); hann, J.chem.Soc Perkin Trans.I, pages 307-314 (1982) (- -CH- -CH- -, cis and trans); almquist et al, j.med.chem., volume 23: pages 1392-1398 (1980) (- -COCH) ₂ - -); jennings-White et al Tetrahedron Lett, volume 23: page 2533 (1982) (- -COCH) ₂ - -); szelke et al, european application EP 45665CA (1982): 97:39405 (1982) (- -CH (OH) CH) ₂ - -); hollanday et al tetrahedron, lett, volume 24: pages 4401-4404 (1983) (- -C (OH) CH) ₂ - -); and hrs, life Sci, volume 31: pages 189-199 (1982) (- -CH) ₂ - -S- -; each of these documents is incorporated by reference herein. Particularly preferred non-peptide bonds are- -CH ₂ NH- -. It will be appreciated that peptide analogues may have more than one atom between the bond atoms, such as b-alanine, g-aminobutyric acid, and the like.

Amino acid analogs and peptide analogs generally have enhanced or desirable properties such as more economical production, higher chemical stability, enhanced pharmacological properties (half-life, absorption, potency, efficacy, etc.), altered specificity (e.g., broad spectrum biological activity), reduced antigenicity, etc.

D-amino acids can be used to produce more stable peptides because D-amino acids are not recognized by peptidases and the like. Substitution of one or more amino acids of the consensus sequence with the same type of D-amino acid system (e.g., substitution of L-lysine with D-lysine) can be used to produce a more stable peptide. Cysteine residues may be used to cyclize or join two or more peptides together. This may be beneficial to limit the peptide to a particular conformation.

6. Delivery of drug carriers/drug products

As noted above, the compositions may also be administered in vivo in a pharmaceutically acceptable carrier. By "pharmaceutically acceptable" is meant that the material is not biologically or otherwise undesirable, i.e., the material can be administered to a subject in conjunction with a nucleic acid or vector without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained. As is well known to those skilled in the art, the carrier is naturally selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject, as is well known to those skilled in the art.

The compositions may be administered orally, parenterally (e.g., intravenously), by intramuscular injection, by intraperitoneal injection, transdermally, in vitro, topically, etc., including topical intranasal administration or administration by inhalation. As used herein, "topical intranasal administration" means delivery of the composition into the nose and nasal passages through one or both nostrils, and may include delivery by a spraying mechanism or a droplet mechanism, or by aerosol inhalation of the nucleic acid or vector. Administration of the composition by inhalation may be via nasal or oral delivery via a spray or droplet mechanism. It may also be delivered directly to any region of the respiratory system (e.g., the lungs) via a cannula. The exact amount of the composition required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity of the allergic disorder being treated, the particular nucleic acid or vector used, the manner in which it is administered, and the like. Thus, it is not possible to specify an exact amount for each composition. However, suitable amounts may be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein.

Parenteral administration of the composition, if used, is typically characterized by injection. The injection may be prepared in conventional form, as a liquid solution or suspension, as a solid form suitable for dissolving the suspension in a liquid prior to injection, or as an emulsion. Recently revised parenteral methods of administration involve the use of slow release or slow release systems in order to maintain a constant dose. See, for example, U.S. Pat. No. 3,610,795, incorporated herein by reference.

The material may be in the form of a solution, suspension (e.g., incorporated into microparticles, liposomes, or cells). These can be targeted to specific cell types via antibodies, receptors or receptor ligands. The following references are examples of the use of this technique to target specific proteins to tumor tissue (Senter et al, bioconjugate chem., vol. 2: 447-451 (1991); bagshawe, K.D.; br. J. Cancer, vol. 60: 275-281 (1989); bagshawe et al, br. J. Cancer, vol. 58: 700-703 (1988); senter et al, bioconjugate chem., vol. 4: 3-9 (1993); battelli et al, cancer immunol., 35: 421-425 (1992); piersz and McKenzie, immunol. Reviews, vol. 129: 57-80 (1992) and Pharmacol. 42 (2062); pharmacol et al). Vehicles such as "stealth" and other antibody-coupled liposomes (including lipid-mediated drug targeting to colon cancer), receptor-mediated targeting of tumors by cell-specific ligands, lymphocyte-directed targeting of tumors, and in vivo highly specific therapeutic retroviral targeting of mouse neuroglioma cells. The following references are examples of the use of this technique to target specific proteins to tumor tissue (Hughes et al, cancer Research, volume 49: pages 6214-6220 (1989), and Litzinger and Huang, biochimica et Biophysica Acta, volume 1104: pages 179-187 (1992)). Generally, the receptor is involved in a constitutive or ligand-induced endocytic pathway. These receptors accumulate in clathrin-coated cells, enter the cell via clathrin-coated vesicles, pass through acidified endosomes where they are sorted and then circulate to the cell surface, are stored in the cell, or are degraded in lysosomes. The internalization pathway has a variety of functions such as nutrient absorption, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, dissociation and degradation of ligands, and receptor level modulation. Many receptors follow more than one intracellular pathway, depending on the cell type, receptor concentration, ligand type, ligand potency and ligand concentration. The molecular and cellular mechanisms of receptor-mediated endocytosis have been reviewed (Brown and Greene, DNA and Cell Biology, volume 10, 6: pages 399-409 (1991)).

7. Methods of treating cancer

The plasmids, vectors and modified NK cells and NK T cells disclosed herein are useful for treating, inhibiting, reducing, ameliorating and/or preventing any disease in which uncontrolled cell proliferation occurs, such as cancer. Cancer immunotherapy has progressed in recent years; genetically modified Chimeric Antigen Receptor (CAR) T cells are excellent examples of engineered immune cells that are successfully used in cancer immunotherapy. These cells have recently been FDA approved for the treatment of cd19+ B cell malignancies, but success to date has been limited to the treatment of diseases that carry some targetable antigens, and targeting such limited antigen libraries is prone to failure due to immune escape. Furthermore, CAR T cells have focused on the use of autologous T cells due to the risk of allogeneic T cells causing graft versus host disease (GvHD). In contrast, NK cells are able to kill tumor targets in an antigen-independent manner and do not cause GvHD, making them good candidates for cancer immunotherapy. It is to be understood and contemplated herein that the plasmids and methods disclosed herein can be used to produce, for example, CAR NK T cells and CAR NK cells to target cancer.

Accordingly, disclosed herein are methods of treating, reducing, lowering, inhibiting, ameliorating, and/or preventing cancer and/or metastasis in a subject, such as, for example, acute Lymphoblastic Leukemia (ALL), acute Myelogenous Leukemia (AML), chronic Myelogenous Leukemia (CML), hairy Cell Leukemia (HCL), and/or myelodysplastic syndrome (MDS), comprising administering to a subject having cancer any of the modified cells disclosed herein (e.g., modified NK cells and NK T cells). For example, disclosed herein are methods of treating, reducing, lowering, inhibiting, ameliorating, and/or preventing cancer and/or metastasis in a subject (such as, for example, acute Lymphoblastic Leukemia (ALL), acute Myelogenous Leukemia (AML), chronicA method of myelogenous leukemia (CML), hairy Cell Leukemia (HCL), and/or myelodysplastic syndrome (MDS)), comprising administering to a subject a therapeutically effective amount of Natural Killer (NK) cells or NK T cells, wherein the NK cells or NK T cells comprise a pattern of binding to clustersInterval (C)Partition boardShort circuitText (A)Heavy weightA plasmid for use with a complex sequence (CRISPR)/CRISPR-associated 9 (Cas 9) integration system, wherein the plasmid comprises, in order, a left homology arm, a polynucleotide sequence encoding a Chimeric Antigen Receptor (CAR) polypeptide, such as, for example, a CD 33-targeting CAR, and a right homology arm; wherein the length of each of the left and right homology arms is 1000bp or less (e.g., 600 bp).

"Inhibit/Inhibit" means a decrease in activity, response, disorder, disease or other biological parameter. This may include, but is not limited to, complete ablation of the activity, response, disorder or disease. This may also include, for example, a 10% reduction in activity, response, disorder or disease as compared to a natural or control level. Thus, a decrease may be a decrease of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or any amount in between, as compared to a native or control level.

By "reduce (verb)" or other forms of the word such as a noun or noun form, it is meant that the event or feature (e.g., tumor growth) is diminished. It will be appreciated that this is typically associated with a certain standard or expected value, in other words it is relative, but reference to a standard or relative value is not always required. For example, "reducing tumor growth" means reducing the growth rate of a tumor relative to a standard or control.

By "prevent (verb)" or other forms of the word, such as a noun or noun form, is meant to stop a particular event or feature, stabilize or delay the development or progression of a particular event or feature, or minimize the chance of the particular event or feature occurring. "prevention" does not require comparison to a control, as it is generally more absolute than, for example, "reduction". As used herein, some conditions may be reduced but not prevented, but some conditions may be both reduced and prevented. Also, some conditions may be prevented but not reduced, but some conditions may be both prevented and reduced. It is to be understood that where "reduce" or "prevent" is used, the use of another word is also explicitly disclosed unless otherwise indicated.

The term "treatment" refers to the medical management of a patient intended to cure, ameliorate, stabilize or prevent a disease, pathological condition or disorder. The term includes active treatment, i.e. treatment directed specifically to the amelioration of a disease, pathological condition or disorder, and also causal treatment, i.e. treatment directed to the elimination of the cause of the associated disease, pathological condition or disorder. Furthermore, the term includes palliative treatment, i.e., treatment intended to alleviate symptoms rather than cure a disease, pathological condition or disorder; prophylactic treatment, i.e., treatment intended to minimize or partially or completely inhibit the development of a related disease, pathological condition, or disorder; and supportive therapy, i.e., therapy for supplementing another specific therapy for the amelioration of a related disease, pathological condition, or disorder.

The term "subject" refers to any individual targeted for administration or treatment. The subject may be a vertebrate, for example a mammal. In one aspect, the subject can be a human, non-human primate, bovine, equine, porcine, canine, or feline. The subject may also be guinea pigs, rats, hamsters, rabbits, mice or moles. Thus, the subject may be a human or veterinary patient. The term "patient" refers to a subject being treated by a clinician, such as a physician.

As described above, the plasmids, vectors and modified NK cells and NK T cells disclosed herein are useful for treating, inhibiting, reducing, ameliorating and/or preventing cancer. A representative but non-limiting list of cancers that the disclosed compositions of the present invention can be used to treat is as follows: lymphomas; b cell lymphoma; t cell lymphomas; mycosis fungoides; hodgkin's disease; acute Lymphoblastic Leukemia (ALL); hairy Cell Leukemia (HCL); myelodysplastic syndrome (MDS); myeloid leukemia (including, but not limited to, acute Myeloid Leukemia (AML) and Chronic Myeloid Leukemia (CML)); bladder cancer; brain cancer; cancers of the nervous system; cancer of the head and neck; squamous cell carcinoma of the head and neck; lung cancer such as small cell lung cancer and non-small cell lung cancer; neuroblastoma/glioblastoma; ovarian cancer; skin cancer; liver cancer; melanoma; squamous cell carcinoma of the mouth, pharynx, larynx and lungs; cervical cancer; ovarian neck cancer; breast cancer and epithelial cancer; renal cancer; urinary system cancer; lung cancer; esophageal cancer; cancer of head and neck; colorectal cancer; a hematopoietic tumor; testicular cancer; colon cancer; rectal cancer; prostate cancer; or pancreatic cancer.

As mentioned throughout this disclosure, the disclosed modified NK cells are ideally suited for immunotherapy, such as adoptive transfer of modified (i.e., engineered) NK cells to a subject in need thereof. Thus, in one aspect, disclosed herein is a method of adoptively transferring an engineered NK cell to a subject in need thereof, the method comprising a) obtaining an NK cell to be modified; b) Obtaining a Ribonucleoprotein (RNP) complex comprising class 2 CRISPR/Cas endonuclease (Cas 9) complexed with a corresponding CRISPR/Cas guide RNA and an AAV vector comprising a plasmid comprising a transgene (such as, for example, a chimeric antigen receptor for a tumor antigen); wherein the transgene is flanked by homology arms; and wherein the homology arm is less than 1000bp; c) Introducing a transgene and RNP complex into NK cells; wherein the transgene is introduced into the cell via infection of an adeno-associated virus (AAV) into an NK cell; wherein the RNP complex hybridizes to a target sequence within genomic DNA of the NK cell and the DNA repair enzyme of the NK cell inserts the transgene into the host genome at the target sequence (e.g., by homologous repair), thereby producing an engineered NK cell; and d) transferring the engineered NK cells into the subject. In one aspect, the transgene may be contained on the same plasmid as the Cas9 endonuclease, or a second plasmid encoded in the same or a different AAV vector. In one aspect, the target cells can be transduced with the RNP complex via electroporation prior to or concurrent with infecting the cells with a transgene comprising AAV.

In one aspect, the modified cells (e.g., NK cells) used in the presently disclosed immunotherapeutic methods can be primary cells from a donor source such as, for example, an allogeneic donor source or an autologous donor source (i.e., the final recipient of the modified cells) for adoptive transfer therapy, a cell line including, but not limited to, NK cell line NK RPMI8866, HFWT, K562, and EBV-LCL, or a source of expanded cells derived from a primary cell source or cell line. Because primary cells can be used, it is understood and contemplated herein that the cell modifications disclosed herein can occur ex vivo or in vitro.

Also disclosed herein is a plasmid comprising, in order, a left homology arm, a polynucleotide sequence encoding a Chimeric Antigen Receptor (CAR) polypeptide, and a right homology arm; wherein the length of each of the left homology arm and the right homology arm is 1000bp or less.

In another aspect, disclosed herein are plasmids, AAV vectors, or modified cells as disclosed herein for use as a medicament. Also disclosed herein is the use of a plasmid, AAV vector, or modified cell as disclosed herein for the manufacture of a medicament.

Also disclosed herein are plasmids, AAV vectors, or modified cells as disclosed herein for use in treating cancer. Also disclosed herein is the use of a plasmid, AAV vector, or modified cell as disclosed herein for the manufacture of a medicament for treating cancer.

Also disclosed herein are CAR NK cells for use in treating cancer, the cells produced by using a method of producing a Chimeric Antigen Receptor (CAR) Natural Killer (NK) cell or NK T cell as disclosed herein. Also disclosed herein is the use of CAR NK cells produced using a method of producing Chimeric Antigen Receptor (CAR) Natural Killer (NK) cells or NK T cells as disclosed herein for the manufacture of a medicament for treating cancer.

VI. Examples

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and evaluate the compounds, compositions, articles, devices, and/or methods claimed herein, and are intended to be purely exemplary and are not intended to limit the disclosure. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless otherwise specified, parts are parts by weight, temperature in degrees celsius or at ambient temperature, and pressure at or near atmospheric pressure.

1. Example 1: efficient site-directed gene insertion in primary human natural killer cells using homologous recombination and CRISPaint delivered by AAV6

Using the methods described herein, efficient and stable transgenic modified human primary NK cells were successfully produced, including two CAR-NK cells that displayed enhanced anti-AML activity.

a) Method of

(1) Human NK cells were purified and expanded.

NK cells were purified as described previously. Briefly, use of Rosetteep ^TM Human NK cells enriched mixtures NK cells were isolated from PBMCs collected from healthy individuals (fig. 1A). Phenotyping purified NK cells using flow cytometry>90% of the CD3 negative/Cd 56 positive population (FIG. 3A). These cells were stimulated on the day of purification with irradiated K562 feeder cells expressing 4-1BBL and membrane-bound IL-21 (FC 21) at a ratio of 2:1 (feeder cells: NK cells) (FIG. 1A). The stimulated cells were cultured in serum-free AIM-V/ICSR expansion medium containing 50IU/mL IL-2 for 7 days.

(2) ATAC-seq assay.

Freshly isolated (initial), FC15 and FC21 expanded NK cells were cryopreserved in 100,000 live cells per vial aliquots and then processed for ATAC-seq assay. The ATAC-seq is performed as described previously. The DNA library was sequenced at the paired-end reads of 50bp using Illumina HiSeq 2500.

(3) Cas9/RNP electroporation for targeting AAVS1 in NK cells.

AAVS1 was targeted using a gRNA (crRNA: 5' GGGGCCACTAGGACAGGAT) (SEQ ID NO: 17) by electroporation of Cas9/RNP into seventh day-expanded NK cells as described previously. Briefly, 3X 10 was collected ⁶ The amplified NK cells were washed twice with 13mL of PBS, and then centrifuged at 400g for 5 minutes, and the PBS was aspirated. The cell pellet was resuspended in 20. Mu.L of P3 primary cell 4D-Nucleofector solution. mu.L of pre-compounded Cas9/RNPCRISPR-Cas9 crRNA、/>CRISPR-Cas9 tracrRNA and +.>S.p. hifi Cas9 nuclease V3) (Integrated DNA Technologies, inc., coralville, iowa), 100 μΜ electroporation enhancer targeting AAVS1 and 1 μΙ_>Cas9 electroporation enhancer) is added to the cell suspension. Transfer of CRISPR reaction System to 4D-Nucleofector in total volume of 26. Mu.L ^TM 16 well strips, and electroporated using program EN-138 (fig. 3B). After electroporation, the cells were transferred to 2mL of medium containing 50IU of IL-2 in a 12-well plate and incubated at 37℃and 5% CO ₂ Incubation under pressure. Two days after electroporation, use 2X 10 ⁶ The cells were stimulated by individual feeder cells, 8mL of fresh medium supplemented with 50IU was added to the cell suspension and kept in a T25 flask.

(4) ICE mutation detection assay.

To measure the indel rate in AAVS1KO NK cells, the Cas9/RNP targeting site was amplified using PCR using the forward and reverse primers mentioned in table 1. Amplicons were sequenced using sanger sequencing and the results were analyzed using ICE.

(5) RNA-seq sample preparation and sequencing.

Total RNA was purified from the initial resting cells, the expanded resting cells, the initial IL-21 stimulated cells and the seventh day FC21 expanded NK cells using a Total RNA Purification Plus Kit kit (Norgen Biotek, ontario, canada). The total RNA obtained was quantified in a Nanodrop ND-1000 spectrophotometer, checked for purity and integrity in a Bioanalyzer-2100 unit (Agilent Technologies Inc., santa Clara, calif.) and submitted to the genomics center of the national child hospital for sequencing. Using the TruSeq RNA sample preparation kit (Illumina inc.) libraries were prepared according to the manufacturer's recommended protocol. Library quality was determined via Agilent 4200tape using the high sensitivity D1000 ScreenTape assay kit and quantified by KAPA qPCR (KAPA BioSystems). Approximately 6-8 tens of millions of paired-end 150bp sequence reads per library were generated using the Illumina HiSeq4000 platform.

Sequencing reads from each sample were aligned with grch38.p9 assembly from NCBI's homo sapiens reference using splice perception aligner STAR version 2.5.2 b. Feature coverage counts were calculated with HTSeq using assembled GFF files from NCBI. The default options for feature type, exon, and feature identifier gene id from GFF are used to identify features of the RNA-seq analysis. Quality control checks for sample preparation and alignment were performed using custom Perl scripts that use STAR map quality metrics to count the types of reads and count the number of reads that were aligned to each of the feature categories defined by the assembled feature table from NCBI.

(6) AAV6 production.

The transgene cloned into ssav or scAAV plasmid is packaged into AAV6 capsids as described previously.

(7) Cas9/RNP and AAV6 are combined to produce mCherry and calnk cells.

On day 6 of NK cell expansion, the day before experimental operation was 5X 10 ⁵ Media exchange and resuspension were performed for each cell/mL. NK cells were then electroporated with AAVS1 targeted Cas9/RNP on day 7 as described above. Thirty minutes after electroporation, 3X 10 was collected ⁵ Living cells at 1X 10 per ml ⁶ Individual cells were resuspended in a total volume of 300 μl of medium containing 50iu IL2 (Novartis) in 24 well plates. For each transduction condition using ssav 6 or scAAV6 to deliver HR or crisp DNA encoding mCherry or CD33CAR we transduced 3 x 10 with 300K MOI (10-500 KMOI if needed) ⁵ And electroporated cells. AAV6 transduced with Cas9/RNP but not AAV transduced, or 300K MOI transduced but not Cas9/RNP electroporated served as negative controls included in non-electroporated NK cells. The next day after electroporation and transduction, we added 300 μl of fresh medium containing 50iu of IL2 to each well without changing the original medium. Cells were kept in culture for 48 hours after electroporation and then used 2X 10 ⁶ Individual feeder cell restimulationAnd maintained in a total volume of 2mL of medium containing 50IU in a 12-well plate without changing the original medium. After 48 hours, 8mL of fresh medium supplemented with IL2 was added to the cells and a total volume of 10mL was kept in the T25 flask. On day 7 post transduction, cells were re-stimulated with feeder cells at a 1:1 ratio and grown for one more week with fresh medium added to the cells every 2 days.

(8) Flow cytometry for detecting CAR-NK cells.

7 and 14 days after electroporation, 5X 10 was stained with PBS containing 2% FBS in buffer ⁵ The NK cells were washed twice. Then, 2.5. Mu.g of recombinant human siglec-3/CD33 Fc chimeric protein (CF; R)&D systems # 1137-SL-050) was added to a total volume of 80. Mu.L of the cell suspension and incubated for 30 minutes at 4 ℃. Cells were washed twice with staining buffer and then with 2 μl of fcγ fragment specific Alexa647 affinity pure goat anti-human IgG (Jackson ImmunoResearch #109-605-098) was stained in 200. Mu.L staining buffer at a ratio of 1:100 and kept at 4℃for 30 minutes. Once stained, cells were washed twice with staining buffer and then obtained on a MacsQuant flow cytometer. Flow cytometer data was analyzed using FlowJo software (FlowJo, LLC).

(9) Cytotoxicity assay.

As previously described, cytotoxicity assays were performed for 3-4 hours using calcein-acetoxymethyl-release assay. Cytotoxicity against Kasumi-1, HL60 or AML10 cells was assessed at different target cell to effector ratios as defined in FIG. 8.

(10) CD107a staining.

NK cells and cancer cells were co-cultured in 96-well plates at a ratio of 10:1 in a total volume of 220. Mu.L and supplemented with 20. Mu.L of PE mouse anti-human CD107a antibody (BD Pharmingen ^TM # 555801). We kept the plates in an incubator at 37 ℃ for 90 minutes. The cells were then washed once with staining buffer and collected for acquisition on a MacsQuant flow cytometer.

(11) PCR-based detection of transgene integration.

Internal and external PCR was performed using 2 pairs of primers designed either inside or outside the CD33CAR construct (fig. 9A and 9B and table 2). We also increased a set of primers to amplify the 1200bp right and left flanking regions of Cas9 targeting and transgene integration sites (fig. 9C). Using Platinum ^TM PCR was performed using Taq DNA polymerase high fidelity kit (Thermofisher # 11304011).

TLA. For whole genome mapping of CD33CAR-Gen2 integration, we used TLA technology (centis b.v.). See fig. 9C for details.

b) Results

(1) Amplification of NK cells using FC21 provides the best conditions for gene insertion.

Enzymatic reactions regulate crisp and HR. Crisp is a LIG4 dependent process, while other proteins such as BRCA1 and BRCA2 regulate HR. Thus, the expression levels of these genes in freshly isolated NK cells or NK cells seven days after stimulation with feeder cells expressing membrane-bound IL-21 (FC 21) (n=4) were analyzed to evaluate which repair pathways were more efficient and at which stage of expansion in this cell type (fig. 1A, 3A and 3B). RNA-seq analysis showed that NK cells expanded on the seventh day had higher expression of BRCA1 and BRCA2 than the original NK cells. In addition, LIG4 levels were not reduced in these cells; however, in the expanded cells, the level of LIG1 as DNA repair enzyme was significantly higher (fig. 1B and 1C), providing the optimal conditions for HR or NHEJ-directed gene insertion by crisp in NK cells expanded on day 7.

(2) Successful targeting of genomic safe harbors for gene insertion.

Genomic Safe Harbor (GSH) is a site in the genome that can be modified without altering the normal function of the host cell and allowing the transgene to be fully expressed. For gene insertion in NK cells, adeno-associated virus site 1 (AAVS 1), which is one of GSH and an exemplary locus within the phosphatase 1-regulatory subunit 12C (PPP 1R 12C) gene, was selected. This locus has been successfully used to direct gene insertion into several cell types. First, chromatin accessibility of AAVS1 in the initial NK cells and expanded NK cells (n=2) was assessed by ATAC-seq assay, and the assay showed that chromatin accessibility in FC21 expanded NK cells was not reduced compared to the initial NK cells (fig. 1D). Next, AAVS1 was targeted with one gRNA by electroporation of Cas9/RNP into NK cells expanded on day seven. After 48 hours, NK cell DNA was isolated for detection of indels (indels) in CRISPR-edited NK cells using CRISPR editing Inference (ICE) to analyze the frequency of indels. ICE results showed that up to 85% of CRISPR modified NK cells had at least one indel at the AAVS1 Cas9 targeting site (fig. 1E). To ensure that genomic modifications at this locus do not interfere with the ability of NK cells to target cancer cells, AAVS1KO NK cells were evaluated for cytotoxicity against the Acute Myelogenous Leukemia (AML) cancer cell line Kasumi-1. Using the calcein AM assay, no difference in their killing capacity was observed between wild type NK cells and CRISPR modified NK cells (fig. 3C).

(3) Primary human NK cells expressing mCherry were successfully generated using a combination of single-stranded AAV6 and Cas 9/RNP.

For HDR-mediated gene insertion, DNA encoding mCherry, which HAs 800bp HA in the right-site flanking region and 1000bp HA in the left-site flanking region of the cas9 targeting site in the AAVs1 locus, was cloned into the backbone of a single-stranded AAV plasmid and packaged into the AAV6 viral capsid. The construct was designed to have splice acceptors downstream of the transgene to improve transcription of the mCherry gene (fig. 2A). NK cells were electroporated with Cas9/RNP targeting AAVS1 as described in these methods, and after half an hour, cells were transduced with AAV6 at 300K MOI or 500K MOI (fig. 2C). This resulted in 17% (300K MOI) and 19% (500K MOI) mCherry positive NK cells, assessed 48 hours after electroporation using flow cytometry. These cells were further expanded for one week using FC21 and enriched for mCherry positive cells by FACS sorting. This resulted in an enriched population of mCherry positive NK cells (77% mCherry positive NK cells transduced with 300K MOI and 86% NK cells transduced with 500K MOI ssav 6). The cells were re-stimulated with feeder cells and re-expanded for 30 days, no decrease in the expression level of mCherry was observed (fig. 4A, 4B and 4C).

(4) Gene insertion was improved by using self-complementary AAV6 and Cas 9/RNP.

As previously described, the scAAV vector can become double stranded in a shorter time frame after entry into a host cell compared to ssAAV. Which can increase the efficiency of gene insertion in NK cells. To test this, scAAV6 was used and combined with Cas9/RNP to improve the gene insertion results of the ssAAV6 method. Due to the size limitations of packaging transgenes in scAAV, several lengths of HA were designed to provide a broad possibility for cloning transgenes of different sizes into the scAAV backbone. Thus, the DNA encoding mCherry (fig. 2A) with 30bp, 300bp, 500bp and 1000bp HA on the right and 30bp, 300bp, 500bp and 800bp HA on the left was cloned into the scAAV backbone and packaged into AAV6 capsids. The ssav segments were then electroporated and transduced into day 7 expanded NK cells following the same procedure as previously described. The method significantly increases the efficiency of generating mCherry expressing NK cells, with positive percentages reported as follows: 30bp (19% -20%), 300bp (80% -85%), 500bp (75% -85%), 800bp (80% -89%) (FIGS. 4A and 4B). These cells can be further expanded for more than 3 weeks using feeder cells, and no decrease in the percentage of NK cells expressing mCherry was observed, confirming stable exogenous gene expression. Although these vectors cannot be used to generate CAR NK cells due to size limitations in scAAV, mCherry can be considered a proof of concept for generating NK cells with the ability to produce efficient and stable exogenous proteins. When the same Cas9/RNP electroporation and AAV6 transduction methods were used in freshly isolated NK cells, the percentage of mCherry expression was significantly lower (ss 800bp AAV6 was 1.13% and sc300bp AAV6 was 2.9%, fig. 5). Based on these observations, FC 21-expanded NK cells were used.

(5) CRISPaint can be used for gene insertion in NK cells.

To overcome the complexity of HA optimization observed in HDR-guided gene insertion, a homology-independent gene insertion approach called crisp was tested. For the CRISPaint DNA template, the Cas9 double targeting sequence of AAVS1 (pamgparmg) was incorporated around the mCherry transgene but within the ITR of the scAAV and packaged into AAV6 (fig. 2B). Electroporation and transduction methods of NK cells for HR-directed gene insertion were also performed herein. Flow cytometry was performed to assess mCherry expression in NK cells after electroporation and transduction and two days prior to expansion. Up to 6% of cells electroporated and transduced with scAAV6 delivering CRISPaint PAMgPAMg at 300K MOI were found to be mCherry positive. These cells can be further sorted and enriched for up to 77% of mCherry expressing NK cells and expanded for 30 days using FC21, no percentage decrease in mCherry positive NK cells was observed (fig. 4B and 4C). Although the efficiency of gene integration using crispant is lower compared to HR directed gene insertion, this approach is still desirable because it allows researchers to integrate genes of interest into user-defined loci without the need to design homology arms.

(6) Successful generation of human primary CD33CAR NK cells.

To generate CD33 targeting CAR NK cells, two constructs (Gen 2 and Gen4v 2) were designed. The CAR used herein contained the same scFv derived from the CD33 monoclonal antibody, followed by CD4 and CD28 as co-stimulatory domains, and CD3z for Gen2 and NKG2D, 2B4, followed by CD3z for Gen4v2 (fig. 6A and 6B). In order to increase the expression level of CAR, which is greater than mCherry, a murine leukemia virus-derived (MND) promoter is incorporated instead of using splice acceptors, which is a highly constitutively active promoter in the hematopoietic system before the start codon of CAR. The DNA encoding the CD33CAR, which had 600bp HA for the AAVs1 targeting site, was then cloned into the backbone of ssav and packaged into the AAV6 capsid. Seven days after electroporation and transduction, CAR expression on NK cells was analyzed using flow cytometry, and up to 78% positive NK cells expressing CD33CAR were detected (on day 14 post transduction, gen2 was 59.3% on average, and Gen4v2 was 60%). A higher Mean Fluorescence Intensity (MFI) of CD33CAR-Gen2 expressed on NK cells was observed compared to Gen4v2 (fig. 6C and 6D). Next, the cells were expanded and grown on feeder cells for another week (day 14), showing no significant decrease in CAR expression between day 7 and day 14 (fig. 6E). Gene manipulation did not have any significant effect on the expansion of CAR expressing cells compared to wild type cells (fig. 6F). The freeze and thaw process also did not have any negative impact on CAR expression and enhanced cytotoxicity of CAR NK cells (fig. 7A and 7B). Next, integration of DNA encoding the transgene at the DNA level was confirmed using PCR (fig. 9A and 9B). In addition, whole genome mapping of CD33CAR-Gen2 integration was performed using Targeted Locus Amplification (TLA) techniques with a sensitivity of detection of random integration of more than 5%, and this technique demonstrated that the vector was correctly integrated at the targeted location of chromosome 19 in a subset of samples. There is no evidence to show a large number of off-target integration sites. In the samples, 1 sequence variant and 4 structural variants were detected, indicating that an incorrect targeting event occurred in at least a subset of the samples. In addition, random integration was also identified in chr19 in a subset of samples (fig. 9C). It was also shown that reducing the virus concentration to 10K MOI could also be used to generate CD33CAR-Gen2 NK cells (fig. 10A and 10B).

(7) The human primary CAR-NK cells have enhanced anti-tumor activity.

To investigate the cytotoxic effect of primary human CD33CAR NK cells against AML cells expressing CD33, a calcein AM-based cytotoxicity assay was performed. Two different CD33 expressing AML cell lines designated Kasumi-1 and HL60 (fig. 11) were used and co-cultured with NK cells isolated from peripheral blood collected from three different healthy individuals. With wild-type or AAVS1 ^KO NK cells, when co-cultured with Kasumi-1 or HL60, showed significantly higher expression levels of CD107a (an NK cell degranulation marker) for CD33CAR-gen2 and CD33CAR-gen4v2 NK cells. This also resulted in significantly higher specific lysis of Kasumi-1 by CD33CAR NK cells. A higher killing capacity of CD33CAR-Gen2 against HL60 was also observed (fig. 8A-8F). Cytotoxicity assays performed against K562 Chronic Myelogenous Leukemia (CML) showed the specificity of enhanced tumor killing of CD33CAR NK cells against CD 33-expressing cancer cells, and no improvement in NK cell killing capacity was observed (fig. 8I and fig. 12). Importantly, a significantly higher level of CD33CAR NK cells against AML-10, a primary human AML derived from relapsed patients, was observed Antitumor activity (FIG. 8G and FIG. 8H, FIG. 12). Overall, CD33CAR-Gen2 NK cells showed better cytotoxicity compared to CD33CAR-Gen4v2 NK cells.

c) Discussion of the invention

Genetic modification in primary human NK cells has been challenging; herein, successful and efficient integration of a site-directed gene into human primary NK cells using a combination of electroporation of Cas9/RNP and delivery of single-stranded or self-complementary AAV6 genes by HR and homology-independent gene insertion (CRISPaint) is reported. It is shown for the first time herein how the expression levels of genes regulating the HR and NHEJ pathways in human NK cells change during amplification with FC21 and provide optimal conditions for site-directed gene insertion. AAVS1 was also demonstrated to be able to carry and express exogenous genes at high levels, as previously shown in T cells and NK cells. Furthermore, it was shown that HA in the range of 30bp-1000bp can be used to insert genes into the AAVS1 locus in NK cells, but the shortest optimal length is 300bp when used in scaAAV 6. This helps researchers select the best HA based on its size of exogenous DNA for NK cell introduction. CRISPaint gene insertion can be used to label endogenous genes and to study protein biology in NK cells.

A combination of Cas9/RNP and AAV6 gene delivery was used and two different human primary CD33CAR NK cells with enhanced anti-AML activity were generated. These results also indicate that genetically modified NK cells can be subsequently expanded with FC21, enabling the production of large numbers of genetically modified NK cells for cancer immunotherapy. In summary, the methods shown herein can be used in several applications in immunology, cancer immunotherapy and research of NK cell biology.

Table 1.

Table 2.

Condition 1
		Reverse-1200 bp (1)	TCCTGGGCAAACAGCATAA(SEQ ID NO:36)
Forward-CD 33CAR (1)	GAGCTGCAGAAGGACAAGAT(SEQ ID NO:37)
		Condition 2
reverse-CD 33CAR (2)	CTCTGTGTCATCTGGATGTCTG(SEQ ID NO:38)
		Forward-1200 bp (2)	CTTTGAGCTCTACTGGCTTCTG(SEQ ID NO:39)
Condition 3
		Reverse-1200 bp (1)	TCCTGGGCAAACAGCATAA(SEQ ID NO:40)
Forward-1200 bp (2)	CTTTGAGCTCTACTGGCTTCTG(SEQ ID NO:41)

Table 3.

TLA was performed with 2 independent primer sets specific for the vector sequences (Table 3).

Sequence variants. The sequence variants detected are shown in table 4. The frequency of the variant may be indicative of a change in the carrier used.

Table 4: the sequence variants identified.

Identification of structural variants

4 vector-vector breakpoint was found. All fusions are located at the homology arm of the annotation. Due to sample heterogeneity, these fusions are expected to be present in only a subset of samples. It should be noted that three of the four fusions showed 9bp-12bp homology, which may indicate a technical bias.

And (3) a carrier: 149 Fusion of (head) toAnd (3) a carrier: 4116 (Tail)Having 9 homologous bases

GGCATGGGGTTGGGTGAGGGAGGAGAGATGCCCGGAGAGGACCCAGACACGGGGAGGATCCGCTCAGAGGACATCACGTGGTGCAGCGGCGCGCCGGCCGCAGAAAGGGAGTAGAGGCGGCCACGACCTGGTGAACACCTAGGA CGCACCATTCTCACAAAGGGAGTTTTCCACACGGACACCCCCCTCCTCACCACAGCCCTGCCAGGACGGGGCTGGC TACTGGCCTTATCTC(SEQ ID NO:46)

And (3) a carrier: 149 Fusion of (head) toAnd (3) a carrier: 4,113 (Tail)Has 12 homologous bases

GCGAGTGAAGACGGCATGGGGTTGGGTGAGGGAGGAGAGATGCCCGGAGAGGACCCAGACACGGGGAGGATCCGCTCAGAGGACATCACGTGGTGCAGCGGCGCGCCGGCCGCAGGAAGGGAGTAGAGGCGGCCACGACCTGGT GAACACCTAGGACGCACCATTCTCACAAAGGGAGTTTTCCACACGGACACCCCCCTCCTCACCACAGCCCTGCCAG GACGGGGCTGGCTACTGGCCTTA(SEQ ID NO:47)

And (3) a carrier: 155 Fusion of (head) toAnd (3) a carrier: 4,163 (Tail)Having 9 homologous bases

GCGAGTGAAGACGGCATGGGGTTGGGTGAGGGAGGAGAGATGCCCGGAGAGGACCCAGACACGGGGAGGATCCGCTCAGAGGACATCACGTGGTGCAGCGGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTG CGGCCGCAGAAAGGGAGTAGAGGCGGCCACGACCTGGTGAACACCTAGGACGCACCATTCTCACAAAGGGAGTTTT CCACACGGA(SEQ ID NO:48)

And (3) a carrier: 158 Fusion of (head) toAnd (3) a carrier: 4,121 (Tail)Having 4 homologous bases

GCGAGTGAAGACGGCATGGGGTTGGGTGAGGGAGGAGAGATGCCCGGAGAGGACCCAGACACGGGGAGGATCCGCTCAGAGGACATCACGTGGTGCAGCGGCCGCAGAAAGGGAGTAGAGGCGGCCACGACCTGGTGAACACCT AGGACGCACCATTCTCACAAAGGGAGTTTTCCACACGGACACCCCCCTCCTCACCACAGCCCTGCCAGGACGGGGC TGGCTACTGGCCTT(SEQ ID NO:49)

B. Reference to the literature

Buenrostro,J.D.,Giresi,P.G.,Zaba,L.C.,Chang,H.Y.&Greenleaf,W.J.Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin,DNA-binding proteins and nucleosome position.Nat Methods 10,1213-1218(2013).

de Vree,P.J.et al.Targeted sequencing by proximity ligation for comprehensive variant detection and local haplotyping.Nat Biotechnol 32,1019-1025(2014).Dutour,A.et al.In Vitro and In Vivo Antitumor Effect of Anti-CD33 Chimeric Receptor-Expressing EBV-CTL against CD33 Acute Myeloid Leukemia.Adv Hematol 2012,683065(2012).

Foust,K.D.et al.Therapeutic AAV9-mediated suppression of mutant SOD1 slows disease progression and extends survival in models of inherited ALS.Mol Ther 21,2148-2159(2013).

He,X.et al.Knock-in of large reporter genes in human cells via CRISPR/Cas9-induced homology-dependent and independent DNA repair.Nucleic Acids Res 44,e85(2016).

Hsiau,T.et al.Inference of CRISPR Edits from Sanger Trace Data.bioRxiv,251082(2018).

Li,K.,Wang,G.,Andersen,T.,Zhou,P.&Pu,W.T.Optimization of genome engineering approaches with the CRISPR/Cas9 system.PLoS One 9,e105779(2014).

Li,Y.,Hermanson,D.L.,Moriarity,B.S.&Kaufman,D.S.Human iPSC-Derived Natural Killer Cells Engineered with Chimeric Antigen Receptors Enhance Anti-tumor Activity.Cell Stem Cell 23,181-192 e185(2018).

Liu,J.,Zhou,G.,Zhang,L.&Zhao,Q.Building Potent Chimeric Antigen Receptor T Cells With CRISPR Genome Editing.Front Immunol 10,456(2019).

MacLeod,D.T.et al.Integration of a CD19 CAR into the TCR Alpha Chain Locus Streamlines Production of Allogeneic Gene-Edited CAR T Cells.Mol Ther 25,949-961(2017).

Mali,P.et al.RNA-guided human genome engineering via Cas9.Science 339,823-826(2013).

McCarty,D.M.Self-complementary AAV vectors；advances and applications.Mol Ther 16,1648-1656(2008).

Mendell,J.R.et al.Single-Dose Gene-Replacement Therapy for Spinal Muscular Atrophy.N Engl J Med 377,1713-1722(2017).

Moseman,J.E.,Foltz,J.A.,Sorathia,K.,Heipertz,E.L.&Lee,D.A.Evaluation of serum-free media formulations in feeder cell-stimulated expansion of natural killer cells.Cytotherapy(2020).

Naeimi Kararoudi,M.et al.CD38 deletion of human primary NK cells eliminates daratumumab-induced fratricide and boosts their effector activity.Blood(2020).

Naeimi Kararoudi,M.et al.Generation of Knock-out Primary and Expanded Human NK Cells Using Cas9 Ribonucleoproteins.J Vis Exp(2018).

Oceguera-Yanez,F.et al.Engineering the AAVS1 locus for consistent and scalable transgene expression in human iPSCs and their differentiated derivatives.Methods 101,43-55(2016).

Pomeroy,E.J.et al.A Genetically Engineered Primary Human Natural Killer Cell Platform for Cancer Immunotherapy.Mol Ther 28,52-63(2020).

Ran,F.A.et al.Genome engineering using the CRISPR-Cas9 system.Nat Protoc8,2281-2308(2013).

Schmid-Burgk,J.L.,Honing,K.,Ebert,T.S.&Hornung,V.CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism.Nat Commun 7,12338(2016).

Somanchi,S.S.,Senyukov,V.V.,Denman,C.J.&Lee,D.A.Expansion,purification,and functional assessment of human peripheral blood NK cells.J Vis Exp(2011).

Song,F.&Stieger,K.Optimizing the DNA Donor Template for Homology-Directed Repair of Double-Strand Breaks.Mol Ther Nucleic Acids 7,53-60(2017).

Suzuki,K.et al.In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration.Nature 540,144-149(2016).

C. Sequence(s)

Right homology arm of SEQ ID NO. 1 30bp

gattggtgacagaaaagccccatccttagg

SEQ ID NO. 2 30bp left homology arm

ttatctgtcccctccaccccacagtggggc

3 300bp right homology arm of SEQ ID NO

gattggtgacagaaaagccccatccttaggcctcctccttcctagtctcctgatattgggtctaacccccacctcctgtta

ggcagattccttatctggtgacacacccccatttcctggagccatctctctccttgccagaacctctaaggtttgcttacga

tggagccagagaggatcctgggagggagagcttggcagggggtgggagggaagggggggatgcgtgacctgcc

cggttctcagtggccaccctgcgctaccctctcccagaacctgagctgctctgacgcggctgtc

4 300bp of SEQ ID NO. left homology arm

gttctcctgtggattcgggtcacctctcactcctttcatttgggcagctcccctaccccccttacctctctagtctgtgctag

ctcttccagccccctgtcatggcatcttccaggggtccgagagctcagctagtcttcttcctccaacccgggcccctatg

tccacttcaggacagcatgtttgctgcctccagggatcctgtgtccccgagctgggaccaccttatattcccagggccg

gttaatgtggctctggttctgggtacttttatctgtcccctccaccccacagtggggc

5 500bp right homology arm of SEQ ID NO

gattggtgacagaaaagccccatccttaggcctcctccttcctagtctcctgatattgggtctaacccccacctcctgtta

ggcagattccttatctggtgacacacccccatttcctggagccatctctctccttgccagaacctctaaggtttgcttacga

tggagccagagaggatcctgggagggagagcttggcagggggtgggagggaagggggggatgcgtgacctgcc

cggttctcagtggccaccctgcgctaccctctcccagaacctgagctgctctgacgcggctgtctggtgcgtttcactg

atcctggtgctgcagcttccttacacttcccaagaggagaagcagtttggaaaaacaaaatcagaataagttggtcctg

agttctaactttggctcttcacctttctagtccccaatttatattgttcctccgtgcgtcagttttacctgtgagataaggccag

tagccagccccgtcctggcag

6 500bp left homology arm of SEQ ID NO

tcccttttccttctccttctggggcctgtgccatctctcgtttcttaggatggccttctccgacggatgtctcccttgcgtccc

gcctccccttcttgtaggcctgcatcatcaccgtttttctggacaaccccaaagtaccccgtctccctggctttagccacc

tctccatcctcttgctttctttgcctggacaccccgttctcctgtggattcgggtcacctctcactcctttcatttgggcagct

cccctaccccccttacctctctagtctgtgctagctcttccagccccctgtcatggcatcttccaggggtccgagagctc

agctagtcttcttcctccaacccgggcccctatgtccacttcaggacagcatgtttgctgcctccagggatcctgtgtccc

cgagctgggaccaccttatattcccagggccggttaatgtggctctggttctgggtacttttatctgtcccctccacccca

cagtggggc

7 800bp right homology arm of SEQ ID NO

gattggtgacagaaaagccccatccttaggcctcctccttcctagtctcctgatattgggtctaacccccacctcctgtta

ggcagattccttatctggtgacacacccccatttcctggagccatctctctccttgccagaacctctaaggtttgcttacga

tggagccagagaggatcctgggagggagagcttggcagggggtgggagggaagggggggatgcgtgacctgcc

cggttctcagtggccaccctgcgctaccctctcccagaacctgagctgctctgacgcggctgtctggtgcgtttcactg

atcctggtgctgcagcttccttacacttcccaagaggagaagcagtttggaaaaacaaaatcagaataagttggtcctg

agttctaactttggctcttcacctttctagtccccaatttatattgttcctccgtgcgtcagttttacctgtgagataaggccag

tagccagccccgtcctggcagggctgtggtgaggaggggggtgtccgtgtggaaaactccctttgtgagaatggtgc

gtcctaggtgttcaccaggtcgtggccgcctctactccctttctctttctccatccttctttccttaaagagtccccagtgcta

tctgggacatattcctccgcccagagcagggtcccgcttccctaaggccctgctctgggcttctgggtttgagtccttgg

caagcccaggagaggcgctcaggcttccctgtcccccttcctcgtccaccatctcatgcccctggctctcctgcccctt

ccctacaggggttcctggctctgctcttcagactgagccccgttcccctgcatccccgttcccctgcatcccccttcccct

gcatcccccagaggccccaggccacctacttggcctggaccccacgagaggccaccccagccctgtctaccaggct

gccttttgggtggattctcctccaactgtggggtgactgcttgg

8 800bp left homology arm of SEQ ID NO

tgctttctctgacctgcattctctcccctgggcctgtgccgctttctgtctgcagcttgtggcctgggtcacctctacggct

ggcccagatccttccctgccgcctccttcaggttccgtcttcctccactccctcttccccttgctctctgctgtgttgctgcc

caaggatgctctttccggagcacttccttctcggcgctgcaccacgtgatgtcctctgagcggatcctccccgtgtctgg

gtcctctccgggcatctctcctccctcacccaaccccatgccgtcttcactcgctgggttcccttttccttctccttctggg

gcctgtgccatctctcgtttcttaggatggccttctccgacggatgtctcccttgcgtcccgcctccccttcttgtaggcct

gcatcatcaccgtttttctggacaaccccaaagtaccccgtctccctggctttagccacctctccatcctcttgctttctttg

cctggacaccccgttctcctgtggattcgggtcacctctcactcctttcatttgggcagctcccctaccccccttacctctctagtctgtgctagctcttccagccccctgtcatggcatcttccaggggtccgagagctcagctagtcttcttcctccaacccgggcccctatgtccacttcaggacagcatgtttgctgcctccagggatcctgtgtccccgagctgggaccaccttatattcccagggccggttaatgtggctctggttctgggtacttttatctgtcccctccaccccacagtggggc

SEQ ID NO 9PAMg (PAM+ sequence encoding crRNA)

Ccaatcctgtccctagtggcccc

SEQ ID NO. 10 splice acceptor

atcgatcgcaggcgcaatcttcgcatttcttttttccag

SEQ ID NO. 11BGH polyA terminator

cctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattc

SEQ ID NO:12mCherry

gtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaa

SEQ ID NO. 13 has incorporated the 30bp plasmid of the mCherry transgene.

ttatctgtcccctccaccccacagtggggccactagggacagcgatcgggtacatcgatcgcaggcgcaatcttcgca

tttcttttttccaggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacat

ggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccag

accgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacgg

ctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtggg

agcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcat

ctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctggga

ggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaagg

acggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctac

aacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagg

gccgccactccaccggcggcatggacgagctgtacaagtaacgcggccgccctcgactgtgccttctagttgccagc

catctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgagga

aattgcatcgcattgtctgagtaggtgtcattctattcgattggtgacagaaaagccccatccttagg

SEQ ID NO. 14 has the incorporated 300bp plasmid of the mCherry transgene.

gttctcctgtggattcgggtcacctctcactcctttcatttgggcagctcccctaccccccttacctctctagtctgtgctag

ctcttccagccccctgtcatggcatcttccaggggtccgagagctcagctagtcttcttcctccaacccgggcccctatg

tccacttcaggacagcatgtttgctgcctccagggatcctgtgtccccgagctgggaccaccttatattcccagggccg

gttaatgtggctctggttctgggtacttttatctgtcccctccaccccacagtggggccactagggacagcgatcgggta

catcgatcgcaggcgcaatcttcgcatttcttttttccaggtgagcaagggcgaggaggataacatggccatcatcaag

gagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgag

ggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctggga

catcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagct

gtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggac

tcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaat

gcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgag

atcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaa

gcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcg

tggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaacgcggccgc

cctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactc

ccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattcgattggtgacagaaaa

gccccatccttaggcctcctccttcctagtctcctgatattgggtctaacccccacctcctgttaggcagattccttatctg

gtgacacacccccatttcctggagccatctctctccttgccagaacctctaaggtttgcttacgatggagccagagagg

atcctgggagggagagcttggcagggggtgggagggaagggggggatgcgtgacctgcccggttctcagtggcc

accctgcgctaccctctcccagaacctgagctgctctgacgcggctgtc

SEQ ID NO. 15 has the incorporated mCherry transgene 500bp plasmid.

tcccttttccttctccttctggggcctgtgccatctctcgtttcttaggatggccttctccgacggatgtctcccttgcgtccc

gcctccccttcttgtaggcctgcatcatcaccgtttttctggacaaccccaaagtaccccgtctccctggctttagccacc

tctccatcctcttgctttctttgcctggacaccccgttctcctgtggattcgggtcacctctcactcctttcatttgggcagct

cccctaccccccttacctctctagtctgtgctagctcttccagccccctgtcatggcatcttccaggggtccgagagctc

agctagtcttcttcctccaacccgggcccctatgtccacttcaggacagcatgtttgctgcctccagggatcctgtgtccc

cgagctgggaccaccttatattcccagggccggttaatgtggctctggttctgggtacttttatctgtcccctccacccca

cagtggggccactagggacagcgatcgggtacatcgatcgcaggcgcaatcttcgcatttcttttttccaggtgagcaa

gggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggc

cacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtga

ccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagc

accccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgag

gacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcg

gcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgta

ccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgct

gaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggac

atcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggc

atggacgagctgtacaagtaacgcggccgccctcgactgtgccttctagttgccagccatctgttgtttgcccctccccc

gtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagt

aggtgtcattctattcgattggtgacagaaaagccccatccttaggcctcctccttcctagtctcctgatattgggtctaac

ccccacctcctgttaggcagattccttatctggtgacacacccccatttcctggagccatctctctccttgccagaacctct

aaggtttgcttacgatggagccagagaggatcctgggagggagagcttggcagggggtgggagggaaggggggg

atgcgtgacctgcccggttctcagtggccaccctgcgctaccctctcccagaacctgagctgctctgacgcggctgtct

ggtgcgtttcactgatcctggtgctgcagcttccttacacttcccaagaggagaagcagtttggaaaaacaaaatcaga

ataagttggtcctgagttctaactttggctcttcacctttctagtccccaatttatattgttcctccgtgcgtcagttttacctgt

gagataaggccagtagccagccccgtcctggcag

SEQ ID NO. 16 has an incorporated 800bp plasmid for the mCherry transgene.

tgctttctctgacctgcattctctcccctgggcctgtgccgctttctgtctgcagcttgtggcctgggtcacctctacggct

ggcccagatccttccctgccgcctccttcaggttccgtcttcctccactccctcttccccttgctctctgctgtgttgctgcc

caaggatgctctttccggagcacttccttctcggcgctgcaccacgtgatgtcctctgagcggatcctccccgtgtctgg

gtcctctccgggcatctctcctccctcacccaaccccatgccgtcttcactcgctgggttcccttttccttctccttctggg

gcctgtgccatctctcgtttcttaggatggccttctccgacggatgtctcccttgcgtcccgcctccccttcttgtaggcct

gcatcatcaccgtttttctggacaaccccaaagtaccccgtctccctggctttagccacctctccatcctcttgctttctttg

cctggacaccccgttctcctgtggattcgggtcacctctcactcctttcatttgggcagctcccctaccccccttacctctc

tagtctgtgctagctcttccagccccctgtcatggcatcttccaggggtccgagagctcagctagtcttcttcctccaacc

cgggcccctatgtccacttcaggacagcatgtttgctgcctccagggatcctgtgtccccgagctgggaccaccttata

ttcccagggccggttaatgtggctctggttctgggtacttttatctgtcccctccaccccacagtggggccactagggac

agcgatcgggtacatcgatcgcaggcgcaatcttcgcatttcttttttccaggtgagcaagggcgaggaggataacatg

gccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagg

gcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcc

cttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccga

ctacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccg

tgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgac

ggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccct

gaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctaca

aggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgagga

ctacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagta

acgcggccgccctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctgga

aggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattcgattg

gtgacagaaaagccccatccttaggcctcctccttcctagtctcctgatattgggtctaacccccacctcctgttaggca

gattccttatctggtgacacacccccatttcctggagccatctctctccttgccagaacctctaaggtttgcttacgatgga

gccagagaggatcctgggagggagagcttggcagggggtgggagggaagggggggatgcgtgacctgcccggt

tctcagtggccaccctgcgctaccctctcccagaacctgagctgctctgacgcggctgtctggtgcgtttcactgatcct

ggtgctgcagcttccttacacttcccaagaggagaagcagtttggaaaaacaaaatcagaataagttggtcctgagttct

aactttggctcttcacctttctagtccccaatttatattgttcctccgtgcgtcagttttacctgtgagataaggccagtagcc

agccccgtcctggcagggctgtggtgaggaggggggtgtccgtgtggaaaactccctttgtgagaatggtgcgtcct

aggtgttcaccaggtcgtggccgcctctactccctttctctttctccatccttctttccttaaagagtccccagtgctatctg

ggacatattcctccgcccagagcagggtcccgcttccctaaggccctgctctgggcttctgggtttgagtccttggcaa

gcccaggagaggcgctcaggcttccctgtcccccttcctcgtccaccatctcatgcccctggctctcctgccccttccct

acaggggttcctggctctgctcttcagactgagccccgttcccctgcatccccgttcccctgcatcccccttcccctgca

tcccccagaggccccaggccacctacttggcctggaccccacgagaggccaccccagccctgtctaccaggctgcc

ttttgggtggattctcctccaactgtggggtgactgcttgg

SEQ ID NO:17(crRNA)

GGGGCCACTAGGGACAGGAT

SEQ ID NO:18scFV：

atgctgctgctggtgacctctctgctgctgtgcgagctgccacacccagccttcctgctgatcccagacatccagatga

cacagagccccagctccctgagcgcctccgtgggcgacagagtgaccatcacatgtagggcctctgagagcgtgga

taactatggcatcagcttcatgaattggtttcagcagaagcctggcggcgccccaaagctgctgatctacgcagccag

catgcagggctccggcgtgccctctcggttctccggctctggcagcggcaccgacttcaccctgacaatctctagcct

gcagccagacgatttcgccacatactattgccagcagagcaaggaggtgccctggacctttggccagggcacaaag

gtggagatcaagggctccacctctggcagcggcaagcctggcagcggagagggctccacaaagggacaggtgca

gctggtgcagtccggagccgaggtgaagaagccaggctcctctgtgaaggtgtcttgtaaggccagcggctatacct

tcacagactacaacatgcactgggtgcgccaggcaccaggacagggcctggagtggatcggctacatctatccttac

aacggcggcaccggctataatcagaagtttaagtccaaggccaccatcacagccgatgagtctaccaatacagccta

catggagctgagcagcctgcggtccgaggacacagccgtgtactattgcgcccggggcagacccgctatggactatt

ggggccagggcaccctggtgacagtgtctag

SEQ ID NO. 19IgG4 hinge:

gagagcaagtacggaccaccttgcccaccatgtcctgcaccagagttcctgggaggaccttccgtgttcctgtttcctc

caaagccaaaggacaccctgatgatcagccggaccccagaggtgacatgcgtggtggtggacgtgagccaggag

gaccccgaggtgcagttcaactggtacgtggatggcgtggaggtgcacaatgccaagaccaagccaagagaggag

cagtttaactccacctatagggtggtgtctgtgctgacagtgctgcaccaggactggctgaacggcaaggagtacaag

tgcaaggtgtccaataagggcctgccttcctctatcgagaagaccatctctaaggcaaagggacagccaagggagcc

acaggtgtatacactgccccctagccaggaggagatgaccaagaaccaggtgtccctgacatgtctggtgaagggct

tttacccttctgacatcgccgtggagtgggagagcaatggccagccagagaacaattataagaccacaccacccgtg

ctggactctgatggcagcttctttctgtacagccgcctgaccgtggataagtcccggtggcaggagggcaacgtgttct

cctgctctgtgatgcacgaggccctgcacaatcactacacacagaagagcctgtccctgtctctgggcaag

SEQ ID NO:20CD28：

Atgttttgggtgctggtggtggtgggaggcgtgctggcctgttattccctgctggtgaccgtggccttcatcatcttttgg

gtgcgctccaagcggagccggggcggacactctgactacatgaacatgaccccacggagacccggacctacaagg

aagcactatcagccctacgcccctccacgggacttcgcagcatatcgcagc

SEQ ID NO:21CD3z：

Cgggtgaagtttagcagatccgccgatgcaccagcatatcagcagggacagaatcagctgtacaacgagctgaatct

gggcaggcgcgaggagtacgacgtgctggataagaggcggggccgggaccccgagatgggaggcaagcccag

gcgcaagaaccctcaggagggcctgtataatgagctgcagaaggacaagatggccgaggcctacagcgagatcgg

catgaagggagagcggagaaggggcaagggacacgatggcctgtatcagggcctgtccaccgccacaaaggaca

cctacgatgcactgcacatgcaggccctgccacctcggtga

CD33CAR-Gen2 cloned in ssAAV backbone of SEQ ID NO 22 (FIG. 16): cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccggcgcgccgctgcaccacgtgatgtcctctgagcggatcctccccgtgtctgggtcctctccgggcatctctcctccctcacccaaccccatgccgtcttcactcgctgggttcccttttccttctccttctggggcctgtgccatctctcgtttcttaggatggccttctccgacggatgtctcccttgcgtcccgcctccccttcttgtaggcctgcatcatcaccgtttttctggacaacccc

aaagtaccccgtctccctggctttagccacctctccatcctcttgctttctttgcctggacaccccgttctcctgtggattcg

ggtcacctctcactcctttcatttgggcagctcccctaccccccttacctctctagtctgtgctagctcttccagccccctgt

catggcatcttccaggggtccgagagctcagctagtcttcttcctccaacccgggcccctatgtccacttcaggacagc

atgtttgctgcctccagggatcctgtgtccccgagctgggaccaccttatattcccagggccggttaatgtggctctggtt

ctgggtacttttatctgtcccctccaccccacagtggggccactagggacagcgatcgggtacatcgatcacgagact

agcctcgagaagcttgatatcgaattccacggggttggacgcgtcttaattaaggatccaaggtcaggaacagagaaa

caggagaatatgggccaaacaggatatctgtggtaagcagttcctgccccggctcagggccaagaacagttggaac

agcagaatatgggccaaacaggatatctgtggtaagcagttcctgccccggctcagggccaagaacagatggtcccc

agatgcggtcccgccctcagcagtttctagagaaccatcagatgtttccagggtgccccaaggacctgaaatgaccct

gtgccttatttgaactaaccaatcagttcgcttctcgcttctgttcgcgcgcttctgctccccgagctctatataagcagag

ctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgactctagag

gatcgatcccccgggctgcaggaattcaagcgagaagacaagggcagaaagcaccgccaccatgctgctgctggt

gacctctctgctgctgtgcgagctgccacacccagccttcctgctgatcccagacatccagatgacacagagccccag

ctccctgagcgcctccgtgggcgacagagtgaccatcacatgtagggcctctgagagcgtggataactatggcatca

gcttcatgaattggtttcagcagaagcctggcggcgccccaaagctgctgatctacgcagccagcatgcagggctcc

ggcgtgccctctcggttctccggctctggcagcggcaccgacttcaccctgacaatctctagcctgcagccagacgat

ttcgccacatactattgccagcagagcaaggaggtgccctggacctttggccagggcacaaaggtggagatcaagg

gctccacctctggcagcggcaagcctggcagcggagagggctccacaaagggacaggtgcagctggtgcagtcc

ggagccgaggtgaagaagccaggctcctctgtgaaggtgtcttgtaaggccagcggctataccttcacagactacaa

catgcactgggtgcgccaggcaccaggacagggcctggagtggatcggctacatctatccttacaacggcggcacc

ggctataatcagaagtttaagtccaaggccaccatcacagccgatgagtctaccaatacagcctacatggagctgagc

agcctgcggtccgaggacacagccgtgtactattgcgcccggggcagacccgctatggactattggggccagggca

ccctggtgacagtgtctagcgagagcaagtacggaccaccttgcccaccatgtcctgcaccagagttcctgggagga

ccttccgtgttcctgtttcctccaaagccaaaggacaccctgatgatcagccggaccccagaggtgacatgcgtggtg

gtggacgtgagccaggaggaccccgaggtgcagttcaactggtacgtggatggcgtggaggtgcacaatgccaag

accaagccaagagaggagcagtttaactccacctatagggtggtgtctgtgctgacagtgctgcaccaggactggct

gaacggcaaggagtacaagtgcaaggtgtccaataagggcctgccttcctctatcgagaagaccatctctaaggcaa

agggacagccaagggagccacaggtgtatacactgccccctagccaggaggagatgaccaagaaccaggtgtccc

tgacatgtctggtgaagggcttttacccttctgacatcgccgtggagtgggagagcaatggccagccagagaacaatt

ataagaccacaccacccgtgctggactctgatggcagcttctttctgtacagccgcctgaccgtggataagtcccggtg

gcaggagggcaacgtgttctcctgctctgtgatgcacgaggccctgcacaatcactacacacagaagagcctgtccct

gtctctgggcaagatgttttgggtgctggtggtggtgggaggcgtgctggcctgttattccctgctggtgaccgtggcct

tcatcatcttttgggtgcgctccaagcggagccggggcggacactctgactacatgaacatgaccccacggagaccc

ggacctacaaggaagcactatcagccctacgcccctccacgggacttcgcagcatatcgcagccgggtgaagtttag

cagatccgccgatgcaccagcatatcagcagggacagaatcagctgtacaacgagctgaatctgggcaggcgcga

ggagtacgacgtgctggataagaggcggggccgggaccccgagatgggaggcaagcccaggcgcaagaaccct

caggagggcctgtataatgagctgcagaaggacaagatggccgaggcctacagcgagatcggcatgaagggaga

gcggagaaggggcaagggacacgatggcctgtatcagggcctgtccaccgccacaaaggacacctacgatgcact

gcacatgcaggccctgccacctcggtgaaagtaacgccctcgactgtgccttctagttgccagccatctgttgtttgccc

ctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattg

tctgagtaggtgtcattctattcgattggtgacagaaaagccccatccttaggcctcctccttcctagtctcctgatattgg

gtctaacccccacctcctgttaggcagattccttatctggtgacacacccccatttcctggagccatctctctccttgcca

gaacctctaaggtttgcttacgatggagccagagaggatcctgggagggagagcttggcagggggtgggagggaa

gggggggatgcgtgacctgcccggttctcagtggccaccctgcgctaccctctcccagaacctgagctgctctgacg

cggctgtctggtgcgtttcactgatcctggtgctgcagcttccttacacttcccaagaggagaagcagtttggaaaaaca

aaatcagaataagttggtcctgagttctaactttggctcttcacctttctagtccccaatttatattgttcctccgtgcgtcagt

tttacctgtgagataaggccagtagccagccccgtcctggcagggctgtggtgaggaggggggtgtccgtgtggaaa

actccctttgtgagaatggtgcgtcctaggtgttcaccaggtcgtggccgcctctactccctttctgcggccgcaggaac

ccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccga

cgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcaggggcgcctgatgcggtat

tttctccttacgcatctgtgcggtatttcacaccgcatacgtcaaagcaaccatagtacgcgccctgtagcggcgcatta

agcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttc

ttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtg

ctttacggcacctcgaccccaaaaaacttgatttgggtgatggttcacgtagtgggccatcgccctgatagacggtttttc

gccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcgggct

attcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattt

taacaaaatattaacgtttacaattttatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccga

cacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgt

ctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcc

tatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccct

atttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaa

ggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccaga

aacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcg

gtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtatt

atcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcacca

gtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacact

gcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgta

actcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagc

aatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatgg

aggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccgg

tgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacg

gggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactg

tcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgat

aatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttct

tgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatc

aagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccg

tagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgc

cagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaa

cggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatg

agaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagag

cgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtc

gatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttt

tgctggccttttgctcacatgt

ITR1 sequence corresponds to nucleic acid positions 1-141 of SEQ ID NO. 22;

the MND-CD33CAR-gen2 construct corresponds to nucleic acid positions 156-4118 of SEQ ID NO. 22; left homology arm AAVS1 of 600bp corresponds to nucleic acid positions 156-759 of SEQ ID NO. 22;

the MND promoter corresponds to nucleic acid position 783-1322 of SEQ ID NO. 22;

the sequence encoding CD33 CARgen 2 corresponds to nucleic acid positions 1329-3362 of SEQ ID NO. 22;

the sequence encoding scFV-CD33 corresponds to positions 1329-2128 of nucleic acid of SEQ ID NO. 22;

the sequence encoding IgG hinge CD4 corresponds to nucleic acid positions 2130-2816 of SEQ ID NO. 22;

the sequence encoding CD28 corresponds to nucleic acid positions 2814-3023 of SEQ ID NO. 22;

the sequence encoding CD3 ζ corresponds to nucleic acid positions 3024-3362 of SEQ ID NO. 22;

BGHPA corresponds to nucleic acid positions 3372-3518 of SEQ ID NO. 22;

BGH poly corresponds to nucleic acid positions 3378-3489 of SEQ ID NO. 22;

the 600bp right homology arm AAVS1 corresponds to nucleic acid positions 3519-4118 of SEQ ID NO. 22;

ITR2 sequence corresponds to nucleic acid positions 4127-4267 of SEQ ID NO. 22.

SEQ ID NO:23CD CAR-Gen4v2 (FIG. 17):

cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgcggccggcgcgccgctgcaccacgtgatgtcctctgagcggatcctccccgtgtctgggtcctctccgggcatctctcctccctcacccaaccccatgccgtcttcactcgctgggttcccttttccttctccttctggggcctgtgccatctctcgtttcttaggatggccttctccgacggatgtctcccttgcgtcccgcctccccttcttgtaggcctgcatcatcaccgtttttctggacaaccccaaagtaccccgtctccctggctttagccacctctccatcctcttgctttctttgcctggacaccccgttctcctgtggattcgggtcacctctcactcctttcatttgggcagctcccctaccccccttacctctctagtctgtgctagctcttccagccccctgtcatggcatcttccaggggtccgagagctcagctagtcttcttcctccaacccgggcccctatgtccacttcaggacagcatgtttgctgcctccagggatcctgtgtccccgagctgggaccaccttatattcccagggccggttaatgtggctctggttctgggtacttttatctgtcccctccaccccacagtggggccactagggacagcgatcgggtacatcgatcacgagactagcctcgagaagcttgatatcgaattccacggggttggacgcgtcttaattaaggatccaaggtcaggaacagagaaacaggagaatatgggccaaacaggatatctgtggtaagcagttcctgccccggctcagggccaagaacagttggaacagcagaatatgggccaaacaggatatctgtggtaagcagttcctgccccggctcagggccaagaacagatggtccccagatgcggtcccgccctcagcagtttctagagaaccatcagatgtttccagggtgccccaaggacctgaaatgaccctgtgccttatttgaactaaccaatcagttcgcttctcgcttctgttcgcgcgcttctgctccccgagctctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagacaccgactctagaggatcgatcccccgggctgcaggaattcaagcgagaagacaagggcagaaagcaccgccaccatgctgctgctggtgacctccctgctgctgtgcgagctgccacaccctgcctttctgctgatcccagacatccagatgacacagagccccagctccctgtctgccagcgtgggcgacagagtgaccatcacatgtagggcctccgagtctgtggataactatggcatcag

ctttatgaattggttccagcagaagccaggaggcgcccctaagctgctgatctacgcagcctccatgcagggctctgg

cgtgcccagccgctttagcggctccggctctggcaccgatttcaccctgacaatctctagcctgcagccagacgatttt

gccacatactattgccagcagtccaaggaggtgccctggaccttcggccagggcacaaaggtggagatcaagggca

gcacctccggctctggcaagcctggctccggagagggctctacaaagggacaggtgcagctggtgcagagcggag

ccgaggtgaagaagccaggctcctctgtgaaggtgagctgtaaggcctccggctatacctttacagactacaacatgc

actgggtgagacaggcaccaggacagggcctggagtggatcggctacatctatccttacaacggcggcaccggcta

taatcagaagttcaagagcaaggccaccatcacagccgatgagtccaccaatacagcctacatggagctgagcagc

ctgaggagcgaggacacagccgtgtactattgcgccagaggcaggcctgctatggactattggggccagggcaccc

tggtgacagtgtctagcgagtccaagtacggaccaccttgcccaccatgtccagcaccagagtttctgggaggaccta

gcgtgtttctgttccctccaaagccaaaggacaccctgatgatcagcagaacccccgaggtgacatgcgtggtggtgg

acgtgtcccaggaggaccccgaggtgcagtttaactggtacgtggatggcgtggaggtgcacaatgccaagaccaa

gcctagagaggagcagttcaactccacctatagggtggtgtctgtgctgacagtgctgcaccaggactggctgaacg

gcaaggagtacaagtgcaaggtgtctaataagggcctgccatcctctatcgagaagaccatcagcaaggccaaggg

ccagcctagggagccacaggtgtatacactgcccccttcccaggaggagatgaccaagaaccaggtgtctctgacat

gtctggtgaagggcttctacccatccgacatcgccgtggagtgggagtctaatggccagcccgagaacaattataaga

ccacaccacccgtgctggactctgatggcagcttctttctgtactctcgcctgaccgtggataagagccggtggcagg

agggcaacgtgtttagctgctccgtgatgcacgaggccctgcacaatcactacacacagaagtctctgagcctgtccc

tgggcaagagcaacctgttcgtggcctcctggatcgccgtgatgatcatctttcgcatcggcatggccgtggccatctt

ctgctgtttctttttcccatccggaggctctggaggaggctccggctggcggagaaagcggaaggagaagcagagc

gagacctcccctaaggagtttctgacaatctatgaggacgtgaaggatctgaagaccaggcgcaatcacgagcagga

gcagaccttcccaggaggaggctctacaatctacagcatgatccagtcccagagcagcgccccaaccagccagga

gccagcctatacactgtactctctgatccagcctagccggaagtctggcagccgcaagcggaaccactccccatcttt

caattctaccatctatgaagtgatcggcaagagccagcctaaggcccagaacccagccagactgtccaggaaggag

ctggagaattttgacgtgtactctggaggcagcggaggaggctctggccgcgtgaagttcagccggtccgccgatgc

cccagcctataagcagggccagaaccagctgtacaacgagctgaatctgggccggagagaggagtacgacgtgct

ggataagaggcggggccgggaccccgagatgggaggcaagccccggagaaagaaccctcaggagggcctgtat

aatgagctgcagaaggacaagatggccgaggcctactccgagatcggcatgaagggagagaggcgccggggca

agggacacgatggcctgtatcagggcctgagcaccgccacaaaggacacctacgatgccctgcacatgcaggccct

gcctccacggtgatgaaagtaacgccctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgcc

ttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgt

cattctattcgattggtgacagaaaagccccatccttaggcctcctccttcctagtctcctgatattgggtctaacccccac

ctcctgttaggcagattccttatctggtgacacacccccatttcctggagccatctctctccttgccagaacctctaaggtt

tgcttacgatggagccagagaggatcctgggagggagagcttggcagggggtgggagggaagggggggatgcgt

gacctgcccggttctcagtggccaccctgcgctaccctctcccagaacctgagctgctctgacgcggctgtctggtgc

gtttcactgatcctggtgctgcagcttccttacacttcccaagaggagaagcagtttggaaaaacaaaatcagaataagt

tggtcctgagttctaactttggctcttcacctttctagtccccaatttatattgttcctccgtgcgtcagttttacctgtgagata

aggccagtagccagccccgtcctggcagggctgtggtgaggaggggggtgtccgtgtggaaaactccctttgtgag

aatggtgcgtcctaggtgttcaccaggtcgtggccgcctctactccctttctgcggccgcaggaacccctagtgatgga

gttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttg

cccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcaggggcgcctgatgcggtattttctccttacgcat

ctgtgcggtatttcacaccgcatacgtcaaagcaaccatagtacgcgccctgtagcggcgcattaagcgcggcgggt

gtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctc

gccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctc

gaccccaaaaaacttgatttgggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttg

gagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcgggctattcttttgatttataa

gggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaac

gtttacaattttatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacac

ccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgc

atgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaagggcctcgtgatacgcctatttttataggttaa

tgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttcta

aatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgag

tattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaa

gtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgag

agttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacg

ccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagc

atcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttactt

ctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgtt

gggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgtt

gcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagtt

gcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgt

ITR1 sequence corresponds to nucleic acid positions 1-141 of SEQ ID NO. 23; the MND-CD33CAR-gen2 construct corresponds to nucleic acid positions 156-4415 of SEQ ID NO. 23; left homology arm AAVS1 of 600bp corresponds to nucleic acid positions 156-759 of SEQ ID NO. 23; the MND promoter corresponds to nucleic acid position 783-1322 of SEQ ID NO. 23;

The sequence encoding CD33 CARgen 2 corresponds to nucleic acid positions 1329-3659 of SEQ ID NO. 23; the sequence encoding scFV-CD33 corresponds to positions 1329-2129 of nucleic acid of SEQ ID NO. 23; the sequence encoding IgG hinge CD4 corresponds to nucleic acid positions 2130-2816 of SEQ ID NO. 23; the sequence encoding NKG 2D-TM corresponds to nucleic acid position 2817-2909 of SEQ ID NO. 23; the sequence encoding 2B4 corresponds to nucleic acid positions 2934-3293 of SEQ ID NO. 23; the sequence encoding CD3 ζ corresponds to nucleic acid positions 3318-3659; BGHPA corresponds to nucleic acid positions 3669-3815 of SEQ ID NO. 23; BGH poly corresponds to nucleic acid positions 3675-3786 of SEQ ID NO. 23;

the 600bp right homology arm AAVS1 corresponds to nucleic acid positions 3816-4415 of SEQ ID NO. 23; ITR2 sequence corresponds to nucleic acid positions 4424-4564 of SEQ ID NO. 23.

SEQ ID NO:24NKG2D transmembrane domain:

Agcaacctgttcgtggcctcctggatcgccgtgatgatcatctttcgcatcggcatggccgtggccatcttctgctgtttctttttcccatcc

SEQ ID NO. 25 linker:

Ggaggctctggaggaggctccggc

SEQ ID NO:26 2B4：

Tggcggagaaagcggaaggagaagcagagcgagacctcccctaaggagtttctgacaatctatgaggacgtgaaggatctgaagaccaggcgcaatcacgagcaggagcagaccttcccaggaggaggctctacaatctacagcatgatccagtcccagagcagcgccccaaccagccaggagccagcctatacactgtactctctgatccagcctagccggaagtctggcagccgcaagcggaaccactccccatctttcaattctaccatctatgaagtgatcggcaagagccagcctaaggcccagaacccagccagactgtccaggaaggagctggagaattttgacgtgtactct

SEQ ID NO. 27 linker:

Ggaggcagcggaggaggctctggc

SEQ ID NO:28CD3z：

Cgcgtgaagttcagccggtccgccgatgccccagcctataagcagggccagaaccagctgtacaacgagctgaatctgggccggagagaggagtacgacgtgctggataagaggcggggccgggaccccgagatgggaggcaagccccggagaaagaaccctcaggagggcctgtataatgagctgcagaaggacaagatggccgaggcctactccgagatcggcatgaagggagagaggcgccggggcaagggacacgatggcctgtatcagggcctgagcaccgccacaaaggacacctacgatgccctgcacatgcaggccctgcctccacggtgatga

SEQ ID NO. 29, anti-CD 33 ScFv.

Atgctgctgctggtgacctccctgctgctgtgcgagctgccacaccctgcctttctgctgatcccagacatccagatgacacagagccccagctccctgtctgccagcgtgggcgacagagtgaccatcacatgtagggcctccgagtctgtggataactatggcatcagctttatgaattggttccagcagaagccaggaggcgcccctaagctgctgatctacgcagcctccatgcagggctctggcgtgcccagccgctttagcggctccggctctggcaccgatttcaccctgacaatctctagcctgc

agccagacgattttgccacatactattgccagcagtccaaggaggtgccctggaccttcggccagggcacaaaggtg

gagatcaagggcagcacctccggctctggcaagcctggctccggagagggctctacaaagggacaggtgcagctg

gtgcagagcggagccgaggtgaagaagccaggctcctctgtgaaggtgagctgtaaggcctccggctatacctttac

agactacaacatgcactgggtgagacaggcaccaggacagggcctggagtggatcggctacatctatccttacaacg

gcggcaccggctataatcagaagttcaagagcaaggccaccatcacagccgatgagtccaccaatacagcctacat

ggagctgagcagcctgaggagcgaggacacagccgtgtactattgcgccagaggcaggcctgctatggactattgg

ggccagggcaccctggtgacagtgtctagc

SEQ ID NO. 30, MND promoter

atcgatcacgagactagcctcgagaagcttgatatcgaattccacggggttggacgcgtcttaattaaggatccaaggt

caggaacagagaaacaggagaatatgggccaaacaggatatctgtggtaagcagttcctgccccggctcagggcca

agaacagttggaacagcagaatatgggccaaacaggatatctgtggtaagcagttcctgccccggctcagggccaa

gaacagatggtccccagatgcggtcccgccctcagcagtttctagagaaccatcagatgtttccagggtgccccaag

gacctgaaatgaccctgtgccttatttgaactaaccaatcagttcgcttctcgcttctgttcgcgcgcttctgctccccgag

ctctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaag

acaccgactctagaggatcgatcccccgggctgcaggaattcaagcgagaagacaagggcagaaagcacc

SEQ ID NO. 31, 600bp, LHA, AAVS1 (gen 4v2 and gen 2)

gctgcaccacgtgatgtcctctgagcggatcctccccgtgtctgggtcctctccgggcatctctcctccctcacccaac

cccatgccgtcttcactcgctgggttcccttttccttctccttctggggcctgtgccatctctcgtttcttaggatggccttct

ccgacggatgtctcccttgcgtcccgcctccccttcttgtaggcctgcatcatcaccgtttttctggacaaccccaaagta

ccccgtctccctggctttagccacctctccatcctcttgctttctttgcctggacaccccgttctcctgtggattcgggtcac

ctctcactcctttcatttgggcagctcccctaccccccttacctctctagtctgtgctagctcttccagccccctgtcatggc

atcttccaggggtccgagagctcagctagtcttcttcctccaacccgggcccctatgtccacttcaggacagcatgtttg

ctgcctccagggatcctgtgtccccgagctgggaccaccttatattcccagggccggttaatgtggctctggttctgggt

acttttatctgtcccctccaccccacagtggggc

SEQ ID NO. 32, 600bp, RHA, AAVS1 (gen 4v2 and gen 2)

Gattggtgacagaaaagccccatccttaggcctcctccttcctagtctcctgatattgggtctaacccccacctcctgtta

ggcagattccttatctggtgacacacccccatttcctggagccatctctctccttgccagaacctctaaggtttgcttacga

tggagccagagaggatcctgggagggagagcttggcagggggtgggagggaagggggggatgcgtgacctgcc

cggttctcagtggccaccctgcgctaccctctcccagaacctgagctgctctgacgcggctgtctggtgcgtttcactg

atcctggtgctgcagcttccttacacttcccaagaggagaagcagtttggaaaaacaaaatcagaataagttggtcctg

agttctaactttggctcttcacctttctagtccccaatttatattgttcctccgtgcgtcagttttacctgtgagataaggccag

tagccagccccgtcctggcagggctgtggtgaggaggggggtgtccgtgtggaaaactccctttgtgagaatggtgc

gtcctaggtgttcaccaggtcgtggccgcctctactccctttct

SEQ ID NO. 33, gRNA sequence targeting AAVS1

GGGGCCACTAGGGACAGGAT

SEQ ID NO:34.TTCTCCTGTGGATTCGGGTCAC

SEQ ID NO:35.CTCTCTGGCTCCATCGTAAGCA

SEQ ID NO:36.TCCTGGGCAAACAGCATAA

SEQ ID NO:37.GAGCTGCAGAAGGACAAGAT

SEQ ID NO:38.CTCTGTGTCATCTGGATGTCTG

SEQ ID NO:39.CTTTGAGCTCTACTGGCTTCTG

SEQ ID NO:40.TCCTGGGCAAACAGCATAA

SEQ ID NO:41.CTTTGAGCTCTACTGGCTTCTG

SEQ ID NO:42.GCGAGTGAAGACGGCATG

SEQ ID NO:43.GTCTGTGCTAGCTCTTCCAG

SEQ ID NO:44.GCGATGTCAGAAGGGTAAA

SEQ ID NO:45.GGCGGACACTCTGACTACAT

SEQ ID NO:46

GGCATGGGGTTGGGTGAGGGAGGAGAGATGCCCGGAGAGGACCCAGA

CACGGGGAGGATCCGCTCAGAGGACATCACGTGGTGCAGCGGCGCGCC

GGCCGCAGAAAGGGAGTAGAGGCGGCCACGACCTGGTGAACACCTAG

GACGCACCATTCTCACAAAGGGAGTTTTCCACACGGACACCCCCCTCCT

CACCACAGCCCTGCCAGGACGGGGCTGGCTACTGGCCTTATCTC

SEQ ID NO:47

GCGAGTGAAGACGGCATGGGGTTGGGTGAGGGAGGAGAGATGCCCGG

AGAGGACCCAGACACGGGGAGGATCCGCTCAGAGGACATCACGTGGT

GCAGCGGCGCGCCGGCCGCAGGAAGGGAGTAGAGGCGGCCACGACCT

GGTGAACACCTAGGACGCACCATTCTCACAAAGGGAGTTTTCCACACG

GACACCCCCCTCCTCACCACAGCCCTGCCAGGACGGGGCTGGCTACTG

GCCTTA

SEQ ID NO:48

GCGAGTGAAGACGGCATGGGGTTGGGTGAGGGAGGAGAGATGCCCGG

AGAGGACCCAGACACGGGGAGGATCCGCTCAGAGGACATCACGTGGT

GCAGCGGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCC

TGCGGCCGCAGAAAGGGAGTAGAGGCGGCCACGACCTGGTGAACACC

TAGGACGCACCATTCTCACAAAGGGAGTTTTCCACACGGA

SEQ ID NO:49

GCGAGTGAAGACGGCATGGGGTTGGGTGAGGGAGGAGAGATGCCCGG

AGAGGACCCAGACACGGGGAGGATCCGCTCAGAGGACATCACGTGGT

GCAGCGGCCGCAGAAAGGGAGTAGAGGCGGCCACGACCTGGTGAACA

CCTAGGACGCACCATTCTCACAAAGGGAGTTTTCCACACGGACACCCC

CCTCCTCACCACAGCCCTGCCAGGACGGGGCTGGCTACTGGCCTT

SEQ ID NO. 50 (PAMgPAMg mCherry construct, FIG. 22)

CCAATCCTGTCCCTAGTGGCCCCCACTAGGGACAGCGATCGGGTACAT

CGATCGCAGGCGCAATCTTCGCATTTCTTTTTTCCAGGTGAGCAAGGGC

GAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTG

CACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGA

GGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGG

TGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCA

GTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCC

CGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGT

GATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTC

CCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAA

CTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGA

GGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGA

GATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTG

AGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCG

CCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACT

ACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCG

GCGGCATGGACGAGCTGTACAAGTAACGCGGCCGCCCTCGACTGTGCC

TTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGA

CCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAAT

TGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCCCAATCCTGTCCCT

AGTGGCCCC

The first PAM sequence corresponds to nucleic acid positions 1-3 of SEQ ID NO. 50; the first sequence encoding crRNA corresponds to nucleic acid positions 4-23 of SEQ ID NO. 50; the splice acceptor sequence corresponds to nucleic acid positions 47-85 of SEQ ID NO. 50; the mCherry codon (optimized) corresponds to nucleic acid positions 86-793 of SEQ ID NO. 50; BGHpA sequence corresponds to nucleic acid positions 803-949 of SEQ ID NO. 50; the second PAM sequence corresponds to nucleic acid positions 950-952 of SEQ ID NO. 50; the second sequence encoding crRNA corresponds to nucleic acid positions 953-972 of SEQ ID NO. 50.

SEQ ID NO. 51 (PAMgRNA mCherry construct sequence, FIG. 21)

CCAATCCTGTCCCTAGTGGCCCCCACTAGGGACAGCGATCGGGTACAT

CGATCGCAGGCGCAATCTTCGCATTTCTTTTTTCCAGGTGAGCAAGGGC

GAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTG

CACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGA

GGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGG

TGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCA

GTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCC

CGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGT

GATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTC

CCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAA

CTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGA

GGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGA

GATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTG

AGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCG

CCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACT

ACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAACGCGGCCGCCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTC

PAM sequence corresponds to SEQ ID NO. 51 nucleic acid positions 1-3;

the sequence encoding crRNA corresponds to nucleic acid positions 4-23 of SEQ ID NO. 51;

splice acceptors correspond to nucleic acid positions 47-85 of SEQ ID NO. 51;

the mCherry codon (optimized) corresponds to nucleic acid positions 86-793 of SEQ ID NO. 51;

the BGHpA sequence corresponds to nucleic acid positions 803-949 of SEQ ID NO. 51.

SEQ ID NO:52.

Cccctccaccccacagtggggccactagggacaggattggtgacagaaaagccccatccttaggc

SEQ ID NO:53

Cccctccaccccacagtggggccactagggacag

SEQ ID NO:54

Attggtgacagaaaagccccatccttaggc

SEQ ID NO:55

Cccctccaccccacagtggggccactaggga

SEQ ID NO:56

Cccctccaccccac

SEQ ID NO:57

Cccctccaccccacagtggggccac

SEQ ID NO:58

gattggtgacagaaaagccccatccttaggc。

Sequence listing

<110> national institute of children hospitals

<120> Chimeric Antigen Receptor (CAR) NK cells and uses thereof

<130> 10935-017WO1

<160> 58

<170> patent in version 3.5

<210> 1

<211> 30

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 1

gattggtgac agaaaagccc catccttagg 30

<210> 2

<211> 30

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 2

ttatctgtcc cctccacccc acagtggggc 30

<210> 3

<211> 300

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 3

gattggtgac agaaaagccc catccttagg cctcctcctt cctagtctcc tgatattggg 60

tctaaccccc acctcctgtt aggcagattc cttatctggt gacacacccc catttcctgg 120

agccatctct ctccttgcca gaacctctaa ggtttgctta cgatggagcc agagaggatc 180

ctgggaggga gagcttggca gggggtggga gggaaggggg ggatgcgtga cctgcccggt 240

tctcagtggc caccctgcgc taccctctcc cagaacctga gctgctctga cgcggctgtc 300

<210> 4

<211> 300

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 4

gttctcctgt ggattcgggt cacctctcac tcctttcatt tgggcagctc ccctaccccc 60

cttacctctc tagtctgtgc tagctcttcc agccccctgt catggcatct tccaggggtc 120

cgagagctca gctagtcttc ttcctccaac ccgggcccct atgtccactt caggacagca 180

tgtttgctgc ctccagggat cctgtgtccc cgagctggga ccaccttata ttcccagggc 240

cggttaatgt ggctctggtt ctgggtactt ttatctgtcc cctccacccc acagtggggc 300

<210> 5

<211> 500

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 5

gattggtgac agaaaagccc catccttagg cctcctcctt cctagtctcc tgatattggg 60

tctaaccccc acctcctgtt aggcagattc cttatctggt gacacacccc catttcctgg 120

agccatctct ctccttgcca gaacctctaa ggtttgctta cgatggagcc agagaggatc 180

ctgggaggga gagcttggca gggggtggga gggaaggggg ggatgcgtga cctgcccggt 240

tctcagtggc caccctgcgc taccctctcc cagaacctga gctgctctga cgcggctgtc 300

tggtgcgttt cactgatcct ggtgctgcag cttccttaca cttcccaaga ggagaagcag 360

tttggaaaaa caaaatcaga ataagttggt cctgagttct aactttggct cttcaccttt 420

ctagtcccca atttatattg ttcctccgtg cgtcagtttt acctgtgaga taaggccagt 480

agccagcccc gtcctggcag 500

<210> 6

<211> 500

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 6

tcccttttcc ttctccttct ggggcctgtg ccatctctcg tttcttagga tggccttctc 60

cgacggatgt ctcccttgcg tcccgcctcc ccttcttgta ggcctgcatc atcaccgttt 120

ttctggacaa ccccaaagta ccccgtctcc ctggctttag ccacctctcc atcctcttgc 180

tttctttgcc tggacacccc gttctcctgt ggattcgggt cacctctcac tcctttcatt 240

tgggcagctc ccctaccccc cttacctctc tagtctgtgc tagctcttcc agccccctgt 300

catggcatct tccaggggtc cgagagctca gctagtcttc ttcctccaac ccgggcccct 360

atgtccactt caggacagca tgtttgctgc ctccagggat cctgtgtccc cgagctggga 420

ccaccttata ttcccagggc cggttaatgt ggctctggtt ctgggtactt ttatctgtcc 480

cctccacccc acagtggggc 500

<210> 7

<211> 1000

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 7

gattggtgac agaaaagccc catccttagg cctcctcctt cctagtctcc tgatattggg 60

tctaaccccc acctcctgtt aggcagattc cttatctggt gacacacccc catttcctgg 120

agccatctct ctccttgcca gaacctctaa ggtttgctta cgatggagcc agagaggatc 180

ctgggaggga gagcttggca gggggtggga gggaaggggg ggatgcgtga cctgcccggt 240

tctcagtggc caccctgcgc taccctctcc cagaacctga gctgctctga cgcggctgtc 300

tggtgcgttt cactgatcct ggtgctgcag cttccttaca cttcccaaga ggagaagcag 360

tttggaaaaa caaaatcaga ataagttggt cctgagttct aactttggct cttcaccttt 420

ctagtcccca atttatattg ttcctccgtg cgtcagtttt acctgtgaga taaggccagt 480

agccagcccc gtcctggcag ggctgtggtg aggagggggg tgtccgtgtg gaaaactccc 540

tttgtgagaa tggtgcgtcc taggtgttca ccaggtcgtg gccgcctcta ctccctttct 600

ctttctccat ccttctttcc ttaaagagtc cccagtgcta tctgggacat attcctccgc 660

ccagagcagg gtcccgcttc cctaaggccc tgctctgggc ttctgggttt gagtccttgg 720

caagcccagg agaggcgctc aggcttccct gtcccccttc ctcgtccacc atctcatgcc 780

cctggctctc ctgccccttc cctacagggg ttcctggctc tgctcttcag actgagcccc 840

gttcccctgc atccccgttc ccctgcatcc cccttcccct gcatccccca gaggccccag 900

gccacctact tggcctggac cccacgagag gccaccccag ccctgtctac caggctgcct 960

tttgggtgga ttctcctcca actgtggggt gactgcttgg 1000

<210> 8

<211> 804

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 8

tgctttctct gacctgcatt ctctcccctg ggcctgtgcc gctttctgtc tgcagcttgt 60

ggcctgggtc acctctacgg ctggcccaga tccttccctg ccgcctcctt caggttccgt 120

cttcctccac tccctcttcc ccttgctctc tgctgtgttg ctgcccaagg atgctctttc 180

cggagcactt ccttctcggc gctgcaccac gtgatgtcct ctgagcggat cctccccgtg 240

tctgggtcct ctccgggcat ctctcctccc tcacccaacc ccatgccgtc ttcactcgct 300

gggttccctt ttccttctcc ttctggggcc tgtgccatct ctcgtttctt aggatggcct 360

tctccgacgg atgtctccct tgcgtcccgc ctccccttct tgtaggcctg catcatcacc 420

gtttttctgg acaaccccaa agtaccccgt ctccctggct ttagccacct ctccatcctc 480

ttgctttctt tgcctggaca ccccgttctc ctgtggattc gggtcacctc tcactccttt 540

catttgggca gctcccctac cccccttacc tctctagtct gtgctagctc ttccagcccc 600

ctgtcatggc atcttccagg ggtccgagag ctcagctagt cttcttcctc caacccgggc 660

ccctatgtcc acttcaggac agcatgtttg ctgcctccag ggatcctgtg tccccgagct 720

gggaccacct tatattccca gggccggtta atgtggctct ggttctgggt acttttatct 780

gtcccctcca ccccacagtg gggc 804

<210> 9

<211> 23

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 9

ccaatcctgt ccctagtggc ccc 23

<210> 10

<211> 39

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 10

atcgatcgca ggcgcaatct tcgcatttct tttttccag 39

<210> 11

<211> 147

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 11

cctcgactgt gccttctagt tgccagccat ctgttgtttg cccctccccc gtgccttcct 60

tgaccctgga aggtgccact cccactgtcc tttcctaata aaatgaggaa attgcatcgc 120

attgtctgag taggtgtcat tctattc 147

<210> 12

<211> 708

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 12

gtgagcaagg gcgaggagga taacatggcc atcatcaagg agttcatgcg cttcaaggtg 60

cacatggagg gctccgtgaa cggccacgag ttcgagatcg agggcgaggg cgagggccgc 120

ccctacgagg gcacccagac cgccaagctg aaggtgacca agggtggccc cctgcccttc 180

gcctgggaca tcctgtcccc tcagttcatg tacggctcca aggcctacgt gaagcacccc 240

gccgacatcc ccgactactt gaagctgtcc ttccccgagg gcttcaagtg ggagcgcgtg 300

atgaacttcg aggacggcgg cgtggtgacc gtgacccagg actcctccct gcaggacggc 360

gagttcatct acaaggtgaa gctgcgcggc accaacttcc cctccgacgg ccccgtaatg 420

cagaagaaga ccatgggctg ggaggcctcc tccgagcgga tgtaccccga ggacggcgcc 480

ctgaagggcg agatcaagca gaggctgaag ctgaaggacg gcggccacta cgacgctgag 540

gtcaagacca cctacaaggc caagaagccc gtgcagctgc ccggcgccta caacgtcaac 600

atcaagttgg acatcacctc ccacaacgag gactacacca tcgtggaaca gtacgaacgc 660

gccgagggcc gccactccac cggcggcatg gacgagctgt acaagtaa 708

<210> 13

<211> 986

<212> DNA

<213> artificial sequence

<220>

<223> Artificial sequence

<400> 13

ttatctgtcc cctccacccc acagtggggc cactagggac agcgatcggg tacatcgatc 60

gcaggcgcaa tcttcgcatt tcttttttcc aggtgagcaa gggcgaggag gataacatgg 120

ccatcatcaa ggagttcatg cgcttcaagg tgcacatgga gggctccgtg aacggccacg 180

agttcgagat cgagggcgag ggcgagggcc gcccctacga gggcacccag accgccaagc 240

tgaaggtgac caagggtggc cccctgccct tcgcctggga catcctgtcc cctcagttca 300

tgtacggctc caaggcctac gtgaagcacc ccgccgacat ccccgactac ttgaagctgt 360

ccttccccga gggcttcaag tgggagcgcg tgatgaactt cgaggacggc ggcgtggtga 420

ccgtgaccca ggactcctcc ctgcaggacg gcgagttcat ctacaaggtg aagctgcgcg 480

gcaccaactt cccctccgac ggccccgtaa tgcagaagaa gaccatgggc tgggaggcct 540

cctccgagcg gatgtacccc gaggacggcg ccctgaaggg cgagatcaag cagaggctga 600

agctgaagga cggcggccac tacgacgctg aggtcaagac cacctacaag gccaagaagc 660

ccgtgcagct gcccggcgcc tacaacgtca acatcaagtt ggacatcacc tcccacaacg 720

aggactacac catcgtggaa cagtacgaac gcgccgaggg ccgccactcc accggcggca 780

tggacgagct gtacaagtaa cgcggccgcc ctcgactgtg ccttctagtt gccagccatc 840

tgttgtttgc ccctcccccg tgccttcctt gaccctggaa ggtgccactc ccactgtcct 900

ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt aggtgtcatt ctattcgatt 960

ggtgacagaa aagccccatc cttagg 986

<210> 14

<211> 1526

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 14

gttctcctgt ggattcgggt cacctctcac tcctttcatt tgggcagctc ccctaccccc 60

cttacctctc tagtctgtgc tagctcttcc agccccctgt catggcatct tccaggggtc 120

cgagagctca gctagtcttc ttcctccaac ccgggcccct atgtccactt caggacagca 180

tgtttgctgc ctccagggat cctgtgtccc cgagctggga ccaccttata ttcccagggc 240

cggttaatgt ggctctggtt ctgggtactt ttatctgtcc cctccacccc acagtggggc 300

cactagggac agcgatcggg tacatcgatc gcaggcgcaa tcttcgcatt tcttttttcc 360

aggtgagcaa gggcgaggag gataacatgg ccatcatcaa ggagttcatg cgcttcaagg 420

tgcacatgga gggctccgtg aacggccacg agttcgagat cgagggcgag ggcgagggcc 480

gcccctacga gggcacccag accgccaagc tgaaggtgac caagggtggc cccctgccct 540

tcgcctggga catcctgtcc cctcagttca tgtacggctc caaggcctac gtgaagcacc 600

ccgccgacat ccccgactac ttgaagctgt ccttccccga gggcttcaag tgggagcgcg 660

tgatgaactt cgaggacggc ggcgtggtga ccgtgaccca ggactcctcc ctgcaggacg 720

gcgagttcat ctacaaggtg aagctgcgcg gcaccaactt cccctccgac ggccccgtaa 780

tgcagaagaa gaccatgggc tgggaggcct cctccgagcg gatgtacccc gaggacggcg 840

ccctgaaggg cgagatcaag cagaggctga agctgaagga cggcggccac tacgacgctg 900

aggtcaagac cacctacaag gccaagaagc ccgtgcagct gcccggcgcc tacaacgtca 960

acatcaagtt ggacatcacc tcccacaacg aggactacac catcgtggaa cagtacgaac 1020

gcgccgaggg ccgccactcc accggcggca tggacgagct gtacaagtaa cgcggccgcc 1080

ctcgactgtg ccttctagtt gccagccatc tgttgtttgc ccctcccccg tgccttcctt 1140

gaccctggaa ggtgccactc ccactgtcct ttcctaataa aatgaggaaa ttgcatcgca 1200

ttgtctgagt aggtgtcatt ctattcgatt ggtgacagaa aagccccatc cttaggcctc 1260

ctccttccta gtctcctgat attgggtcta acccccacct cctgttaggc agattcctta 1320

tctggtgaca cacccccatt tcctggagcc atctctctcc ttgccagaac ctctaaggtt 1380

tgcttacgat ggagccagag aggatcctgg gagggagagc ttggcagggg gtgggaggga 1440

agggggggat gcgtgacctg cccggttctc agtggccacc ctgcgctacc ctctcccaga 1500

acctgagctg ctctgacgcg gctgtc 1526

<210> 15

<211> 1926

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 15

tcccttttcc ttctccttct ggggcctgtg ccatctctcg tttcttagga tggccttctc 60

cgacggatgt ctcccttgcg tcccgcctcc ccttcttgta ggcctgcatc atcaccgttt 120

ttctggacaa ccccaaagta ccccgtctcc ctggctttag ccacctctcc atcctcttgc 180

tttctttgcc tggacacccc gttctcctgt ggattcgggt cacctctcac tcctttcatt 240

tgggcagctc ccctaccccc cttacctctc tagtctgtgc tagctcttcc agccccctgt 300

catggcatct tccaggggtc cgagagctca gctagtcttc ttcctccaac ccgggcccct 360

atgtccactt caggacagca tgtttgctgc ctccagggat cctgtgtccc cgagctggga 420

ccaccttata ttcccagggc cggttaatgt ggctctggtt ctgggtactt ttatctgtcc 480

cctccacccc acagtggggc cactagggac agcgatcggg tacatcgatc gcaggcgcaa 540

tcttcgcatt tcttttttcc aggtgagcaa gggcgaggag gataacatgg ccatcatcaa 600

ggagttcatg cgcttcaagg tgcacatgga gggctccgtg aacggccacg agttcgagat 660

cgagggcgag ggcgagggcc gcccctacga gggcacccag accgccaagc tgaaggtgac 720

caagggtggc cccctgccct tcgcctggga catcctgtcc cctcagttca tgtacggctc 780

caaggcctac gtgaagcacc ccgccgacat ccccgactac ttgaagctgt ccttccccga 840

gggcttcaag tgggagcgcg tgatgaactt cgaggacggc ggcgtggtga ccgtgaccca 900

ggactcctcc ctgcaggacg gcgagttcat ctacaaggtg aagctgcgcg gcaccaactt 960

cccctccgac ggccccgtaa tgcagaagaa gaccatgggc tgggaggcct cctccgagcg 1020

gatgtacccc gaggacggcg ccctgaaggg cgagatcaag cagaggctga agctgaagga 1080

cggcggccac tacgacgctg aggtcaagac cacctacaag gccaagaagc ccgtgcagct 1140

gcccggcgcc tacaacgtca acatcaagtt ggacatcacc tcccacaacg aggactacac 1200

catcgtggaa cagtacgaac gcgccgaggg ccgccactcc accggcggca tggacgagct 1260

gtacaagtaa cgcggccgcc ctcgactgtg ccttctagtt gccagccatc tgttgtttgc 1320

ccctcccccg tgccttcctt gaccctggaa ggtgccactc ccactgtcct ttcctaataa 1380

aatgaggaaa ttgcatcgca ttgtctgagt aggtgtcatt ctattcgatt ggtgacagaa 1440

aagccccatc cttaggcctc ctccttccta gtctcctgat attgggtcta acccccacct 1500

cctgttaggc agattcctta tctggtgaca cacccccatt tcctggagcc atctctctcc 1560

ttgccagaac ctctaaggtt tgcttacgat ggagccagag aggatcctgg gagggagagc 1620

ttggcagggg gtgggaggga agggggggat gcgtgacctg cccggttctc agtggccacc 1680

ctgcgctacc ctctcccaga acctgagctg ctctgacgcg gctgtctggt gcgtttcact 1740

gatcctggtg ctgcagcttc cttacacttc ccaagaggag aagcagtttg gaaaaacaaa 1800

atcagaataa gttggtcctg agttctaact ttggctcttc acctttctag tccccaattt 1860

atattgttcc tccgtgcgtc agttttacct gtgagataag gccagtagcc agccccgtcc 1920

tggcag 1926

<210> 16

<211> 2730

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 16

tgctttctct gacctgcatt ctctcccctg ggcctgtgcc gctttctgtc tgcagcttgt 60

ggcctgggtc acctctacgg ctggcccaga tccttccctg ccgcctcctt caggttccgt 120

cttcctccac tccctcttcc ccttgctctc tgctgtgttg ctgcccaagg atgctctttc 180

cggagcactt ccttctcggc gctgcaccac gtgatgtcct ctgagcggat cctccccgtg 240

tctgggtcct ctccgggcat ctctcctccc tcacccaacc ccatgccgtc ttcactcgct 300

gggttccctt ttccttctcc ttctggggcc tgtgccatct ctcgtttctt aggatggcct 360

tctccgacgg atgtctccct tgcgtcccgc ctccccttct tgtaggcctg catcatcacc 420

gtttttctgg acaaccccaa agtaccccgt ctccctggct ttagccacct ctccatcctc 480

ttgctttctt tgcctggaca ccccgttctc ctgtggattc gggtcacctc tcactccttt 540

catttgggca gctcccctac cccccttacc tctctagtct gtgctagctc ttccagcccc 600

ctgtcatggc atcttccagg ggtccgagag ctcagctagt cttcttcctc caacccgggc 660

ccctatgtcc acttcaggac agcatgtttg ctgcctccag ggatcctgtg tccccgagct 720

gggaccacct tatattccca gggccggtta atgtggctct ggttctgggt acttttatct 780

gtcccctcca ccccacagtg gggccactag ggacagcgat cgggtacatc gatcgcaggc 840

gcaatcttcg catttctttt ttccaggtga gcaagggcga ggaggataac atggccatca 900

tcaaggagtt catgcgcttc aaggtgcaca tggagggctc cgtgaacggc cacgagttcg 960

agatcgaggg cgagggcgag ggccgcccct acgagggcac ccagaccgcc aagctgaagg 1020

tgaccaaggg tggccccctg cccttcgcct gggacatcct gtcccctcag ttcatgtacg 1080

gctccaaggc ctacgtgaag caccccgccg acatccccga ctacttgaag ctgtccttcc 1140

ccgagggctt caagtgggag cgcgtgatga acttcgagga cggcggcgtg gtgaccgtga 1200

cccaggactc ctccctgcag gacggcgagt tcatctacaa ggtgaagctg cgcggcacca 1260

acttcccctc cgacggcccc gtaatgcaga agaagaccat gggctgggag gcctcctccg 1320

agcggatgta ccccgaggac ggcgccctga agggcgagat caagcagagg ctgaagctga 1380

aggacggcgg ccactacgac gctgaggtca agaccaccta caaggccaag aagcccgtgc 1440

agctgcccgg cgcctacaac gtcaacatca agttggacat cacctcccac aacgaggact 1500

acaccatcgt ggaacagtac gaacgcgccg agggccgcca ctccaccggc ggcatggacg 1560

agctgtacaa gtaacgcggc cgccctcgac tgtgccttct agttgccagc catctgttgt 1620

ttgcccctcc cccgtgcctt ccttgaccct ggaaggtgcc actcccactg tcctttccta 1680

ataaaatgag gaaattgcat cgcattgtct gagtaggtgt cattctattc gattggtgac 1740

agaaaagccc catccttagg cctcctcctt cctagtctcc tgatattggg tctaaccccc 1800

acctcctgtt aggcagattc cttatctggt gacacacccc catttcctgg agccatctct 1860

ctccttgcca gaacctctaa ggtttgctta cgatggagcc agagaggatc ctgggaggga 1920

gagcttggca gggggtggga gggaaggggg ggatgcgtga cctgcccggt tctcagtggc 1980

caccctgcgc taccctctcc cagaacctga gctgctctga cgcggctgtc tggtgcgttt 2040

cactgatcct ggtgctgcag cttccttaca cttcccaaga ggagaagcag tttggaaaaa 2100

caaaatcaga ataagttggt cctgagttct aactttggct cttcaccttt ctagtcccca 2160

atttatattg ttcctccgtg cgtcagtttt acctgtgaga taaggccagt agccagcccc 2220

gtcctggcag ggctgtggtg aggagggggg tgtccgtgtg gaaaactccc tttgtgagaa 2280

tggtgcgtcc taggtgttca ccaggtcgtg gccgcctcta ctccctttct ctttctccat 2340

ccttctttcc ttaaagagtc cccagtgcta tctgggacat attcctccgc ccagagcagg 2400

gtcccgcttc cctaaggccc tgctctgggc ttctgggttt gagtccttgg caagcccagg 2460

agaggcgctc aggcttccct gtcccccttc ctcgtccacc atctcatgcc cctggctctc 2520

ctgccccttc cctacagggg ttcctggctc tgctcttcag actgagcccc gttcccctgc 2580

atccccgttc ccctgcatcc cccttcccct gcatccccca gaggccccag gccacctact 2640

tggcctggac cccacgagag gccaccccag ccctgtctac caggctgcct tttgggtgga 2700

ttctcctcca actgtggggt gactgcttgg 2730

<210> 17

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 17

ggggccacta gggacaggat 20

<210> 18

<211> 800

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 18

atgctgctgc tggtgacctc tctgctgctg tgcgagctgc cacacccagc cttcctgctg 60

atcccagaca tccagatgac acagagcccc agctccctga gcgcctccgt gggcgacaga 120

gtgaccatca catgtagggc ctctgagagc gtggataact atggcatcag cttcatgaat 180

tggtttcagc agaagcctgg cggcgcccca aagctgctga tctacgcagc cagcatgcag 240

ggctccggcg tgccctctcg gttctccggc tctggcagcg gcaccgactt caccctgaca 300

atctctagcc tgcagccaga cgatttcgcc acatactatt gccagcagag caaggaggtg 360

ccctggacct ttggccaggg cacaaaggtg gagatcaagg gctccacctc tggcagcggc 420

aagcctggca gcggagaggg ctccacaaag ggacaggtgc agctggtgca gtccggagcc 480

gaggtgaaga agccaggctc ctctgtgaag gtgtcttgta aggccagcgg ctataccttc 540

acagactaca acatgcactg ggtgcgccag gcaccaggac agggcctgga gtggatcggc 600

tacatctatc cttacaacgg cggcaccggc tataatcaga agtttaagtc caaggccacc 660

atcacagccg atgagtctac caatacagcc tacatggagc tgagcagcct gcggtccgag 720

gacacagccg tgtactattg cgcccggggc agacccgcta tggactattg gggccagggc 780

accctggtga cagtgtctag 800

<210> 19

<211> 687

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 19

gagagcaagt acggaccacc ttgcccacca tgtcctgcac cagagttcct gggaggacct 60

tccgtgttcc tgtttcctcc aaagccaaag gacaccctga tgatcagccg gaccccagag 120

gtgacatgcg tggtggtgga cgtgagccag gaggaccccg aggtgcagtt caactggtac 180

gtggatggcg tggaggtgca caatgccaag accaagccaa gagaggagca gtttaactcc 240

acctataggg tggtgtctgt gctgacagtg ctgcaccagg actggctgaa cggcaaggag 300

tacaagtgca aggtgtccaa taagggcctg ccttcctcta tcgagaagac catctctaag 360

gcaaagggac agccaaggga gccacaggtg tatacactgc cccctagcca ggaggagatg 420

accaagaacc aggtgtccct gacatgtctg gtgaagggct tttacccttc tgacatcgcc 480

gtggagtggg agagcaatgg ccagccagag aacaattata agaccacacc acccgtgctg 540

gactctgatg gcagcttctt tctgtacagc cgcctgaccg tggataagtc ccggtggcag 600

gagggcaacg tgttctcctg ctctgtgatg cacgaggccc tgcacaatca ctacacacag 660

aagagcctgt ccctgtctct gggcaag 687

<210> 20

<211> 207

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 20

atgttttggg tgctggtggt ggtgggaggc gtgctggcct gttattccct gctggtgacc 60

gtggccttca tcatcttttg ggtgcgctcc aagcggagcc ggggcggaca ctctgactac 120

atgaacatga ccccacggag acccggacct acaaggaagc actatcagcc ctacgcccct 180

ccacgggact tcgcagcata tcgcagc 207

<210> 21

<211> 339

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 21

cgggtgaagt ttagcagatc cgccgatgca ccagcatatc agcagggaca gaatcagctg 60

tacaacgagc tgaatctggg caggcgcgag gagtacgacg tgctggataa gaggcggggc 120

cgggaccccg agatgggagg caagcccagg cgcaagaacc ctcaggaggg cctgtataat 180

gagctgcaga aggacaagat ggccgaggcc tacagcgaga tcggcatgaa gggagagcgg 240

agaaggggca agggacacga tggcctgtat cagggcctgt ccaccgccac aaaggacacc 300

tacgatgcac tgcacatgca ggccctgcca cctcggtga 339

<210> 22

<211> 6864

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 22

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60

gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca 120

actccatcac taggggttcc tgcggccggc gcgccgctgc accacgtgat gtcctctgag 180

cggatcctcc ccgtgtctgg gtcctctccg ggcatctctc ctccctcacc caaccccatg 240

ccgtcttcac tcgctgggtt cccttttcct tctccttctg gggcctgtgc catctctcgt 300

ttcttaggat ggccttctcc gacggatgtc tcccttgcgt cccgcctccc cttcttgtag 360

gcctgcatca tcaccgtttt tctggacaac cccaaagtac cccgtctccc tggctttagc 420

cacctctcca tcctcttgct ttctttgcct ggacaccccg ttctcctgtg gattcgggtc 480

acctctcact cctttcattt gggcagctcc cctacccccc ttacctctct agtctgtgct 540

agctcttcca gccccctgtc atggcatctt ccaggggtcc gagagctcag ctagtcttct 600

tcctccaacc cgggccccta tgtccacttc aggacagcat gtttgctgcc tccagggatc 660

ctgtgtcccc gagctgggac caccttatat tcccagggcc ggttaatgtg gctctggttc 720

tgggtacttt tatctgtccc ctccacccca cagtggggcc actagggaca gcgatcgggt 780

acatcgatca cgagactagc ctcgagaagc ttgatatcga attccacggg gttggacgcg 840

tcttaattaa ggatccaagg tcaggaacag agaaacagga gaatatgggc caaacaggat 900

atctgtggta agcagttcct gccccggctc agggccaaga acagttggaa cagcagaata 960

tgggccaaac aggatatctg tggtaagcag ttcctgcccc ggctcagggc caagaacaga 1020

tggtccccag atgcggtccc gccctcagca gtttctagag aaccatcaga tgtttccagg 1080

gtgccccaag gacctgaaat gaccctgtgc cttatttgaa ctaaccaatc agttcgcttc 1140

tcgcttctgt tcgcgcgctt ctgctccccg agctctatat aagcagagct cgtttagtga 1200

accgtcagat cgcctggaga cgccatccac gctgttttga cctccataga agacaccgac 1260

tctagaggat cgatcccccg ggctgcagga attcaagcga gaagacaagg gcagaaagca 1320

ccgccaccat gctgctgctg gtgacctctc tgctgctgtg cgagctgcca cacccagcct 1380

tcctgctgat cccagacatc cagatgacac agagccccag ctccctgagc gcctccgtgg 1440

gcgacagagt gaccatcaca tgtagggcct ctgagagcgt ggataactat ggcatcagct 1500

tcatgaattg gtttcagcag aagcctggcg gcgccccaaa gctgctgatc tacgcagcca 1560

gcatgcaggg ctccggcgtg ccctctcggt tctccggctc tggcagcggc accgacttca 1620

ccctgacaat ctctagcctg cagccagacg atttcgccac atactattgc cagcagagca 1680

aggaggtgcc ctggaccttt ggccagggca caaaggtgga gatcaagggc tccacctctg 1740

gcagcggcaa gcctggcagc ggagagggct ccacaaaggg acaggtgcag ctggtgcagt 1800

ccggagccga ggtgaagaag ccaggctcct ctgtgaaggt gtcttgtaag gccagcggct 1860

ataccttcac agactacaac atgcactggg tgcgccaggc accaggacag ggcctggagt 1920

ggatcggcta catctatcct tacaacggcg gcaccggcta taatcagaag tttaagtcca 1980

aggccaccat cacagccgat gagtctacca atacagccta catggagctg agcagcctgc 2040

ggtccgagga cacagccgtg tactattgcg cccggggcag acccgctatg gactattggg 2100

gccagggcac cctggtgaca gtgtctagcg agagcaagta cggaccacct tgcccaccat 2160

gtcctgcacc agagttcctg ggaggacctt ccgtgttcct gtttcctcca aagccaaagg 2220

acaccctgat gatcagccgg accccagagg tgacatgcgt ggtggtggac gtgagccagg 2280

aggaccccga ggtgcagttc aactggtacg tggatggcgt ggaggtgcac aatgccaaga 2340

ccaagccaag agaggagcag tttaactcca cctatagggt ggtgtctgtg ctgacagtgc 2400

tgcaccagga ctggctgaac ggcaaggagt acaagtgcaa ggtgtccaat aagggcctgc 2460

cttcctctat cgagaagacc atctctaagg caaagggaca gccaagggag ccacaggtgt 2520

atacactgcc ccctagccag gaggagatga ccaagaacca ggtgtccctg acatgtctgg 2580

tgaagggctt ttacccttct gacatcgccg tggagtggga gagcaatggc cagccagaga 2640

acaattataa gaccacacca cccgtgctgg actctgatgg cagcttcttt ctgtacagcc 2700

gcctgaccgt ggataagtcc cggtggcagg agggcaacgt gttctcctgc tctgtgatgc 2760

acgaggccct gcacaatcac tacacacaga agagcctgtc cctgtctctg ggcaagatgt 2820

tttgggtgct ggtggtggtg ggaggcgtgc tggcctgtta ttccctgctg gtgaccgtgg 2880

ccttcatcat cttttgggtg cgctccaagc ggagccgggg cggacactct gactacatga 2940

acatgacccc acggagaccc ggacctacaa ggaagcacta tcagccctac gcccctccac 3000

gggacttcgc agcatatcgc agccgggtga agtttagcag atccgccgat gcaccagcat 3060

atcagcaggg acagaatcag ctgtacaacg agctgaatct gggcaggcgc gaggagtacg 3120

acgtgctgga taagaggcgg ggccgggacc ccgagatggg aggcaagccc aggcgcaaga 3180

accctcagga gggcctgtat aatgagctgc agaaggacaa gatggccgag gcctacagcg 3240

agatcggcat gaagggagag cggagaaggg gcaagggaca cgatggcctg tatcagggcc 3300

tgtccaccgc cacaaaggac acctacgatg cactgcacat gcaggccctg ccacctcggt 3360

gaaagtaacg ccctcgactg tgccttctag ttgccagcca tctgttgttt gcccctcccc 3420

cgtgccttcc ttgaccctgg aaggtgccac tcccactgtc ctttcctaat aaaatgagga 3480

aattgcatcg cattgtctga gtaggtgtca ttctattcga ttggtgacag aaaagcccca 3540

tccttaggcc tcctccttcc tagtctcctg atattgggtc taacccccac ctcctgttag 3600

gcagattcct tatctggtga cacaccccca tttcctggag ccatctctct ccttgccaga 3660

acctctaagg tttgcttacg atggagccag agaggatcct gggagggaga gcttggcagg 3720

gggtgggagg gaaggggggg atgcgtgacc tgcccggttc tcagtggcca ccctgcgcta 3780

ccctctccca gaacctgagc tgctctgacg cggctgtctg gtgcgtttca ctgatcctgg 3840

tgctgcagct tccttacact tcccaagagg agaagcagtt tggaaaaaca aaatcagaat 3900

aagttggtcc tgagttctaa ctttggctct tcacctttct agtccccaat ttatattgtt 3960

cctccgtgcg tcagttttac ctgtgagata aggccagtag ccagccccgt cctggcaggg 4020

ctgtggtgag gaggggggtg tccgtgtgga aaactccctt tgtgagaatg gtgcgtccta 4080

ggtgttcacc aggtcgtggc cgcctctact ccctttctgc ggccgcagga acccctagtg 4140

atggagttgg ccactccctc tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag 4200

gtcgcccgac gcccgggctt tgcccgggcg gcctcagtga gcgagcgagc gcgcagctgc 4260

ctgcaggggc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc 4320

atacgtcaaa gcaaccatag tacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg 4380

tggttacgcg cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt 4440

tcttcccttc ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc 4500

tccctttagg gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgatttgg 4560

gtgatggttc acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg 4620

agtccacgtt ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct 4680

cgggctattc ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg 4740

agctgattta acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaattttat 4800

ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccagccc cgacacccgc 4860

caacacccgc tgacgcgccc tgacgggctt gtctgctccc ggcatccgct tacagacaag 4920

ctgtgaccgt ctccgggagc tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg 4980

cgagacgaaa gggcctcgtg atacgcctat ttttataggt taatgtcatg ataataatgg 5040

tttcttagac gtcaggtggc acttttcggg gaaatgtgcg cggaacccct atttgtttat 5100

ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga taaatgcttc 5160

aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc cttattccct 5220

tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg aaagtaaaag 5280

atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc aacagcggta 5340

agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact tttaaagttc 5400

tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc ggtcgccgca 5460

tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag catcttacgg 5520

atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat aacactgcgg 5580

ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt ttgcacaaca 5640

tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa gccataccaa 5700

acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc aaactattaa 5760

ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg gaggcggata 5820

aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt gctgataaat 5880

ctggagccgg tgagcgtggg tctcgcggta tcattgcagc actggggcca gatggtaagc 5940

cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat gaacgaaata 6000

gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca gaccaagttt 6060

actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg atctaggtga 6120

agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg ttccactgag 6180

cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa 6240

tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag 6300

agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg 6360

tccttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat 6420

acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta 6480

ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg 6540

gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc 6600

gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa 6660

gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc 6720

tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt 6780

caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct 6840

tttgctggcc ttttgctcac atgt 6864

<210> 23

<211> 7161

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 23

cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60

gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca 120

actccatcac taggggttcc tgcggccggc gcgccgctgc accacgtgat gtcctctgag 180

cggatcctcc ccgtgtctgg gtcctctccg ggcatctctc ctccctcacc caaccccatg 240

ccgtcttcac tcgctgggtt cccttttcct tctccttctg gggcctgtgc catctctcgt 300

ttcttaggat ggccttctcc gacggatgtc tcccttgcgt cccgcctccc cttcttgtag 360

gcctgcatca tcaccgtttt tctggacaac cccaaagtac cccgtctccc tggctttagc 420

cacctctcca tcctcttgct ttctttgcct ggacaccccg ttctcctgtg gattcgggtc 480

acctctcact cctttcattt gggcagctcc cctacccccc ttacctctct agtctgtgct 540

agctcttcca gccccctgtc atggcatctt ccaggggtcc gagagctcag ctagtcttct 600

tcctccaacc cgggccccta tgtccacttc aggacagcat gtttgctgcc tccagggatc 660

ctgtgtcccc gagctgggac caccttatat tcccagggcc ggttaatgtg gctctggttc 720

tgggtacttt tatctgtccc ctccacccca cagtggggcc actagggaca gcgatcgggt 780

acatcgatca cgagactagc ctcgagaagc ttgatatcga attccacggg gttggacgcg 840

tcttaattaa ggatccaagg tcaggaacag agaaacagga gaatatgggc caaacaggat 900

atctgtggta agcagttcct gccccggctc agggccaaga acagttggaa cagcagaata 960

tgggccaaac aggatatctg tggtaagcag ttcctgcccc ggctcagggc caagaacaga 1020

tggtccccag atgcggtccc gccctcagca gtttctagag aaccatcaga tgtttccagg 1080

gtgccccaag gacctgaaat gaccctgtgc cttatttgaa ctaaccaatc agttcgcttc 1140

tcgcttctgt tcgcgcgctt ctgctccccg agctctatat aagcagagct cgtttagtga 1200

accgtcagat cgcctggaga cgccatccac gctgttttga cctccataga agacaccgac 1260

tctagaggat cgatcccccg ggctgcagga attcaagcga gaagacaagg gcagaaagca 1320

ccgccaccat gctgctgctg gtgacctccc tgctgctgtg cgagctgcca caccctgcct 1380

ttctgctgat cccagacatc cagatgacac agagccccag ctccctgtct gccagcgtgg 1440

gcgacagagt gaccatcaca tgtagggcct ccgagtctgt ggataactat ggcatcagct 1500

ttatgaattg gttccagcag aagccaggag gcgcccctaa gctgctgatc tacgcagcct 1560

ccatgcaggg ctctggcgtg cccagccgct ttagcggctc cggctctggc accgatttca 1620

ccctgacaat ctctagcctg cagccagacg attttgccac atactattgc cagcagtcca 1680

aggaggtgcc ctggaccttc ggccagggca caaaggtgga gatcaagggc agcacctccg 1740

gctctggcaa gcctggctcc ggagagggct ctacaaaggg acaggtgcag ctggtgcaga 1800

gcggagccga ggtgaagaag ccaggctcct ctgtgaaggt gagctgtaag gcctccggct 1860

atacctttac agactacaac atgcactggg tgagacaggc accaggacag ggcctggagt 1920

ggatcggcta catctatcct tacaacggcg gcaccggcta taatcagaag ttcaagagca 1980

aggccaccat cacagccgat gagtccacca atacagccta catggagctg agcagcctga 2040

ggagcgagga cacagccgtg tactattgcg ccagaggcag gcctgctatg gactattggg 2100

gccagggcac cctggtgaca gtgtctagcg agtccaagta cggaccacct tgcccaccat 2160

gtccagcacc agagtttctg ggaggaccta gcgtgtttct gttccctcca aagccaaagg 2220

acaccctgat gatcagcaga acccccgagg tgacatgcgt ggtggtggac gtgtcccagg 2280

aggaccccga ggtgcagttt aactggtacg tggatggcgt ggaggtgcac aatgccaaga 2340

ccaagcctag agaggagcag ttcaactcca cctatagggt ggtgtctgtg ctgacagtgc 2400

tgcaccagga ctggctgaac ggcaaggagt acaagtgcaa ggtgtctaat aagggcctgc 2460

catcctctat cgagaagacc atcagcaagg ccaagggcca gcctagggag ccacaggtgt 2520

atacactgcc cccttcccag gaggagatga ccaagaacca ggtgtctctg acatgtctgg 2580

tgaagggctt ctacccatcc gacatcgccg tggagtggga gtctaatggc cagcccgaga 2640

acaattataa gaccacacca cccgtgctgg actctgatgg cagcttcttt ctgtactctc 2700

gcctgaccgt ggataagagc cggtggcagg agggcaacgt gtttagctgc tccgtgatgc 2760

acgaggccct gcacaatcac tacacacaga agtctctgag cctgtccctg ggcaagagca 2820

acctgttcgt ggcctcctgg atcgccgtga tgatcatctt tcgcatcggc atggccgtgg 2880

ccatcttctg ctgtttcttt ttcccatccg gaggctctgg aggaggctcc ggctggcgga 2940

gaaagcggaa ggagaagcag agcgagacct cccctaagga gtttctgaca atctatgagg 3000

acgtgaagga tctgaagacc aggcgcaatc acgagcagga gcagaccttc ccaggaggag 3060

gctctacaat ctacagcatg atccagtccc agagcagcgc cccaaccagc caggagccag 3120

cctatacact gtactctctg atccagccta gccggaagtc tggcagccgc aagcggaacc 3180

actccccatc tttcaattct accatctatg aagtgatcgg caagagccag cctaaggccc 3240

agaacccagc cagactgtcc aggaaggagc tggagaattt tgacgtgtac tctggaggca 3300

gcggaggagg ctctggccgc gtgaagttca gccggtccgc cgatgcccca gcctataagc 3360

agggccagaa ccagctgtac aacgagctga atctgggccg gagagaggag tacgacgtgc 3420

tggataagag gcggggccgg gaccccgaga tgggaggcaa gccccggaga aagaaccctc 3480

aggagggcct gtataatgag ctgcagaagg acaagatggc cgaggcctac tccgagatcg 3540

gcatgaaggg agagaggcgc cggggcaagg gacacgatgg cctgtatcag ggcctgagca 3600

ccgccacaaa ggacacctac gatgccctgc acatgcaggc cctgcctcca cggtgatgaa 3660

agtaacgccc tcgactgtgc cttctagttg ccagccatct gttgtttgcc cctcccccgt 3720

gccttccttg accctggaag gtgccactcc cactgtcctt tcctaataaa atgaggaaat 3780

tgcatcgcat tgtctgagta ggtgtcattc tattcgattg gtgacagaaa agccccatcc 3840

ttaggcctcc tccttcctag tctcctgata ttgggtctaa cccccacctc ctgttaggca 3900

gattccttat ctggtgacac acccccattt cctggagcca tctctctcct tgccagaacc 3960

tctaaggttt gcttacgatg gagccagaga ggatcctggg agggagagct tggcaggggg 4020

tgggagggaa gggggggatg cgtgacctgc ccggttctca gtggccaccc tgcgctaccc 4080

tctcccagaa cctgagctgc tctgacgcgg ctgtctggtg cgtttcactg atcctggtgc 4140

tgcagcttcc ttacacttcc caagaggaga agcagtttgg aaaaacaaaa tcagaataag 4200

ttggtcctga gttctaactt tggctcttca cctttctagt ccccaattta tattgttcct 4260

ccgtgcgtca gttttacctg tgagataagg ccagtagcca gccccgtcct ggcagggctg 4320

tggtgaggag gggggtgtcc gtgtggaaaa ctccctttgt gagaatggtg cgtcctaggt 4380

gttcaccagg tcgtggccgc ctctactccc tttctgcggc cgcaggaacc cctagtgatg 4440

gagttggcca ctccctctct gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc 4500

gcccgacgcc cgggctttgc ccgggcggcc tcagtgagcg agcgagcgcg cagctgcctg 4560

caggggcgcc tgatgcggta ttttctcctt acgcatctgt gcggtatttc acaccgcata 4620

cgtcaaagca accatagtac gcgccctgta gcggcgcatt aagcgcggcg ggtgtggtgg 4680

ttacgcgcag cgtgaccgct acacttgcca gcgccctagc gcccgctcct ttcgctttct 4740

tcccttcctt tctcgccacg ttcgccggct ttccccgtca agctctaaat cgggggctcc 4800

ctttagggtt ccgatttagt gctttacggc acctcgaccc caaaaaactt gatttgggtg 4860

atggttcacg tagtgggcca tcgccctgat agacggtttt tcgccctttg acgttggagt 4920

ccacgttctt taatagtgga ctcttgttcc aaactggaac aacactcaac cctatctcgg 4980

gctattcttt tgatttataa gggattttgc cgatttcggc ctattggtta aaaaatgagc 5040

tgatttaaca aaaatttaac gcgaatttta acaaaatatt aacgtttaca attttatggt 5100

gcactctcag tacaatctgc tctgatgccg catagttaag ccagccccga cacccgccaa 5160

cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg 5220

tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga 5280

gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 5340

cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 5400

tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 5460

aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 5520

ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 5580

ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 5640

tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 5700

tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 5760

actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 5820

gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 5880

acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 5940

gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 6000

acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 6060

gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 6120

ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 6180

gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 6240

cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 6300

agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 6360

catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 6420

tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 6480

cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 6540

gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 6600

taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc 6660

ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 6720

tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 6780

ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 6840

cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 6900

agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 6960

gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 7020

atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 7080

gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 7140

gctggccttt tgctcacatg t 7161

<210> 24

<211> 93

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 24

agcaacctgt tcgtggcctc ctggatcgcc gtgatgatca tctttcgcat cggcatggcc 60

gtggccatct tctgctgttt ctttttccca tcc 93

<210> 25

<211> 24

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 25

ggaggctctg gaggaggctc cggc 24

<210> 26

<211> 360

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 26

tggcggagaa agcggaagga gaagcagagc gagacctccc ctaaggagtt tctgacaatc 60

tatgaggacg tgaaggatct gaagaccagg cgcaatcacg agcaggagca gaccttccca 120

ggaggaggct ctacaatcta cagcatgatc cagtcccaga gcagcgcccc aaccagccag 180

gagccagcct atacactgta ctctctgatc cagcctagcc ggaagtctgg cagccgcaag 240

cggaaccact ccccatcttt caattctacc atctatgaag tgatcggcaa gagccagcct 300

aaggcccaga acccagccag actgtccagg aaggagctgg agaattttga cgtgtactct 360

<210> 27

<211> 24

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 27

ggaggcagcg gaggaggctc tggc 24

<210> 28

<211> 342

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 28

cgcgtgaagt tcagccggtc cgccgatgcc ccagcctata agcagggcca gaaccagctg 60

tacaacgagc tgaatctggg ccggagagag gagtacgacg tgctggataa gaggcggggc 120

cgggaccccg agatgggagg caagccccgg agaaagaacc ctcaggaggg cctgtataat 180

gagctgcaga aggacaagat ggccgaggcc tactccgaga tcggcatgaa gggagagagg 240

cgccggggca agggacacga tggcctgtat cagggcctga gcaccgccac aaaggacacc 300

tacgatgccc tgcacatgca ggccctgcct ccacggtgat ga 342

<210> 29

<211> 801

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 29

atgctgctgc tggtgacctc cctgctgctg tgcgagctgc cacaccctgc ctttctgctg 60

atcccagaca tccagatgac acagagcccc agctccctgt ctgccagcgt gggcgacaga 120

gtgaccatca catgtagggc ctccgagtct gtggataact atggcatcag ctttatgaat 180

tggttccagc agaagccagg aggcgcccct aagctgctga tctacgcagc ctccatgcag 240

ggctctggcg tgcccagccg ctttagcggc tccggctctg gcaccgattt caccctgaca 300

atctctagcc tgcagccaga cgattttgcc acatactatt gccagcagtc caaggaggtg 360

ccctggacct tcggccaggg cacaaaggtg gagatcaagg gcagcacctc cggctctggc 420

aagcctggct ccggagaggg ctctacaaag ggacaggtgc agctggtgca gagcggagcc 480

gaggtgaaga agccaggctc ctctgtgaag gtgagctgta aggcctccgg ctataccttt 540

acagactaca acatgcactg ggtgagacag gcaccaggac agggcctgga gtggatcggc 600

tacatctatc cttacaacgg cggcaccggc tataatcaga agttcaagag caaggccacc 660

atcacagccg atgagtccac caatacagcc tacatggagc tgagcagcct gaggagcgag 720

gacacagccg tgtactattg cgccagaggc aggcctgcta tggactattg gggccagggc 780

accctggtga cagtgtctag c 801

<210> 30

<211> 540

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 30

atcgatcacg agactagcct cgagaagctt gatatcgaat tccacggggt tggacgcgtc 60

ttaattaagg atccaaggtc aggaacagag aaacaggaga atatgggcca aacaggatat 120

ctgtggtaag cagttcctgc cccggctcag ggccaagaac agttggaaca gcagaatatg 180

ggccaaacag gatatctgtg gtaagcagtt cctgccccgg ctcagggcca agaacagatg 240

gtccccagat gcggtcccgc cctcagcagt ttctagagaa ccatcagatg tttccagggt 300

gccccaagga cctgaaatga ccctgtgcct tatttgaact aaccaatcag ttcgcttctc 360

gcttctgttc gcgcgcttct gctccccgag ctctatataa gcagagctcg tttagtgaac 420

cgtcagatcg cctggagacg ccatccacgc tgttttgacc tccatagaag acaccgactc 480

tagaggatcg atcccccggg ctgcaggaat tcaagcgaga agacaagggc agaaagcacc 540

<210> 31

<211> 604

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 31

gctgcaccac gtgatgtcct ctgagcggat cctccccgtg tctgggtcct ctccgggcat 60

ctctcctccc tcacccaacc ccatgccgtc ttcactcgct gggttccctt ttccttctcc 120

ttctggggcc tgtgccatct ctcgtttctt aggatggcct tctccgacgg atgtctccct 180

tgcgtcccgc ctccccttct tgtaggcctg catcatcacc gtttttctgg acaaccccaa 240

agtaccccgt ctccctggct ttagccacct ctccatcctc ttgctttctt tgcctggaca 300

ccccgttctc ctgtggattc gggtcacctc tcactccttt catttgggca gctcccctac 360

cccccttacc tctctagtct gtgctagctc ttccagcccc ctgtcatggc atcttccagg 420

ggtccgagag ctcagctagt cttcttcctc caacccgggc ccctatgtcc acttcaggac 480

agcatgtttg ctgcctccag ggatcctgtg tccccgagct gggaccacct tatattccca 540

gggccggtta atgtggctct ggttctgggt acttttatct gtcccctcca ccccacagtg 600

gggc 604

<210> 32

<211> 600

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 32

gattggtgac agaaaagccc catccttagg cctcctcctt cctagtctcc tgatattggg 60

tctaaccccc acctcctgtt aggcagattc cttatctggt gacacacccc catttcctgg 120

agccatctct ctccttgcca gaacctctaa ggtttgctta cgatggagcc agagaggatc 180

ctgggaggga gagcttggca gggggtggga gggaaggggg ggatgcgtga cctgcccggt 240

tctcagtggc caccctgcgc taccctctcc cagaacctga gctgctctga cgcggctgtc 300

tggtgcgttt cactgatcct ggtgctgcag cttccttaca cttcccaaga ggagaagcag 360

tttggaaaaa caaaatcaga ataagttggt cctgagttct aactttggct cttcaccttt 420

ctagtcccca atttatattg ttcctccgtg cgtcagtttt acctgtgaga taaggccagt 480

agccagcccc gtcctggcag ggctgtggtg aggagggggg tgtccgtgtg gaaaactccc 540

tttgtgagaa tggtgcgtcc taggtgttca ccaggtcgtg gccgcctcta ctccctttct 600

<210> 33

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 33

ggggccacta gggacaggat 20

<210> 34

<211> 22

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 34

ttctcctgtg gattcgggtc ac 22

<210> 35

<211> 22

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 35

ctctctggct ccatcgtaag ca 22

<210> 36

<211> 19

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 36

tcctgggcaa acagcataa 19

<210> 37

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 37

gagctgcaga aggacaagat 20

<210> 38

<211> 22

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 38

ctctgtgtca tctggatgtc tg 22

<210> 39

<211> 22

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 39

ctttgagctc tactggcttc tg 22

<210> 40

<211> 19

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 40

tcctgggcaa acagcataa 19

<210> 41

<211> 22

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 41

ctttgagctc tactggcttc tg 22

<210> 42

<211> 18

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 42

gcgagtgaag acggcatg 18

<210> 43

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 43

gtctgtgcta gctcttccag 20

<210> 44

<211> 19

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 44

gcgatgtcag aagggtaaa 19

<210> 45

<211> 20

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 45

ggcggacact ctgactacat 20

<210> 46

<211> 235

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 46

ggcatggggt tgggtgaggg aggagagatg cccggagagg acccagacac ggggaggatc 60

cgctcagagg acatcacgtg gtgcagcggc gcgccggccg cagaaaggga gtagaggcgg 120

ccacgacctg gtgaacacct aggacgcacc attctcacaa agggagtttt ccacacggac 180

acccccctcc tcaccacagc cctgccagga cggggctggc tactggcctt atctc 235

<210> 47

<211> 243

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 47

gcgagtgaag acggcatggg gttgggtgag ggaggagaga tgcccggaga ggacccagac 60

acggggagga tccgctcaga ggacatcacg tggtgcagcg gcgcgccggc cgcaggaagg 120

gagtagaggc ggccacgacc tggtgaacac ctaggacgca ccattctcac aaagggagtt 180

ttccacacgg acacccccct cctcaccaca gccctgccag gacggggctg gctactggcc 240

tta 243

<210> 48

<211> 229

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 48

gcgagtgaag acggcatggg gttgggtgag ggaggagaga tgcccggaga ggacccagac 60

acggggagga tccgctcaga ggacatcacg tggtgcagcg gcgcgcagag agggagtggc 120

caactccatc actaggggtt cctgcggccg cagaaaggga gtagaggcgg ccacgacctg 180

gtgaacacct aggacgcacc attctcacaa agggagtttt ccacacgga 229

<210> 49

<211> 234

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 49

gcgagtgaag acggcatggg gttgggtgag ggaggagaga tgcccggaga ggacccagac 60

acggggagga tccgctcaga ggacatcacg tggtgcagcg gccgcagaaa gggagtagag 120

gcggccacga cctggtgaac acctaggacg caccattctc acaaagggag ttttccacac 180

ggacaccccc ctcctcacca cagccctgcc aggacggggc tggctactgg cctt 234

<210> 50

<211> 972

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 50

ccaatcctgt ccctagtggc ccccactagg gacagcgatc gggtacatcg atcgcaggcg 60

caatcttcgc atttcttttt tccaggtgag caagggcgag gaggataaca tggccatcat 120

caaggagttc atgcgcttca aggtgcacat ggagggctcc gtgaacggcc acgagttcga 180

gatcgagggc gagggcgagg gccgccccta cgagggcacc cagaccgcca agctgaaggt 240

gaccaagggt ggccccctgc ccttcgcctg ggacatcctg tcccctcagt tcatgtacgg 300

ctccaaggcc tacgtgaagc accccgccga catccccgac tacttgaagc tgtccttccc 360

cgagggcttc aagtgggagc gcgtgatgaa cttcgaggac ggcggcgtgg tgaccgtgac 420

ccaggactcc tccctgcagg acggcgagtt catctacaag gtgaagctgc gcggcaccaa 480

cttcccctcc gacggccccg taatgcagaa gaagaccatg ggctgggagg cctcctccga 540

gcggatgtac cccgaggacg gcgccctgaa gggcgagatc aagcagaggc tgaagctgaa 600

ggacggcggc cactacgacg ctgaggtcaa gaccacctac aaggccaaga agcccgtgca 660

gctgcccggc gcctacaacg tcaacatcaa gttggacatc acctcccaca acgaggacta 720

caccatcgtg gaacagtacg aacgcgccga gggccgccac tccaccggcg gcatggacga 780

gctgtacaag taacgcggcc gccctcgact gtgccttcta gttgccagcc atctgttgtt 840

tgcccctccc ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt cctttcctaa 900

taaaatgagg aaattgcatc gcattgtctg agtaggtgtc attctattcc caatcctgtc 960

cctagtggcc cc 972

<210> 51

<211> 949

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 51

ccaatcctgt ccctagtggc ccccactagg gacagcgatc gggtacatcg atcgcaggcg 60

caatcttcgc atttcttttt tccaggtgag caagggcgag gaggataaca tggccatcat 120

caaggagttc atgcgcttca aggtgcacat ggagggctcc gtgaacggcc acgagttcga 180

gatcgagggc gagggcgagg gccgccccta cgagggcacc cagaccgcca agctgaaggt 240

gaccaagggt ggccccctgc ccttcgcctg ggacatcctg tcccctcagt tcatgtacgg 300

ctccaaggcc tacgtgaagc accccgccga catccccgac tacttgaagc tgtccttccc 360

cgagggcttc aagtgggagc gcgtgatgaa cttcgaggac ggcggcgtgg tgaccgtgac 420

ccaggactcc tccctgcagg acggcgagtt catctacaag gtgaagctgc gcggcaccaa 480

cttcccctcc gacggccccg taatgcagaa gaagaccatg ggctgggagg cctcctccga 540

gcggatgtac cccgaggacg gcgccctgaa gggcgagatc aagcagaggc tgaagctgaa 600

ggacggcggc cactacgacg ctgaggtcaa gaccacctac aaggccaaga agcccgtgca 660

gctgcccggc gcctacaacg tcaacatcaa gttggacatc acctcccaca acgaggacta 720

caccatcgtg gaacagtacg aacgcgccga gggccgccac tccaccggcg gcatggacga 780

gctgtacaag taacgcggcc gccctcgact gtgccttcta gttgccagcc atctgttgtt 840

tgcccctccc ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt cctttcctaa 900

taaaatgagg aaattgcatc gcattgtctg agtaggtgtc attctattc 949

<210> 52

<211> 65

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 52

cccctccacc ccacagtggg gccactaggg acaggattgg tgacagaaaa gccccatcct 60

taggc 65

<210> 53

<211> 34

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 53

cccctccacc ccacagtggg gccactaggg acag 34

<210> 54

<211> 30

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 54

attggtgaca gaaaagcccc atccttaggc 30

<210> 55

<211> 31

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 55

cccctccacc ccacagtggg gccactaggg a 31

<210> 56

<211> 14

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 56

cccctccacc ccac 14

<210> 57

<211> 25

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 57

cccctccacc ccacagtggg gccac 25

<210> 58

<211> 31

<212> DNA

<213> artificial sequence

<220>

<223> synthetic sequence

<400> 58

gattggtgac agaaaagccc catccttagg c 31

Claims (117)

1. A plasmid for use with a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR associated 9 (Cas 9) integration system, wherein the plasmid comprises, in order, a left homology arm, a polynucleotide sequence encoding a Chimeric Antigen Receptor (CAR) polypeptide, and a right homology arm; wherein the left and right homology arms are each 1000bp or less in length.

2. The plasmid of claim 1, wherein the CAR polypeptide comprises a transmembrane domain, a costimulatory domain, a CD3 ∈signaling domain, and a single-chain variable fragment (scFV) that specifically binds to a receptor on a target cell.

3. The plasmid of claim 2, wherein the receptor comprises CD33.

4. A plasmid according to claim 3 wherein the scFV that specifically binds to CD33 comprises a sequence at least 90% identical to SEQ ID No. 29 or a fragment thereof.

5. The plasmid of any one of claims 1-4, wherein the transmembrane domain of the CAR polypeptide comprises a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, a CD3 ∈9 transmembrane domain, or a NKG2D transmembrane domain.

6. The plasmid of any one of claims 1 to 5, wherein the co-stimulatory domain of the CAR polypeptide comprises a 2B4 domain, a CD28 co-stimulatory domain, a 4-1BB co-stimulatory domain, or any combination thereof.

7. The plasmid according to any one of claims 1 to 6, further comprising a polyadenylation signal between the transgene and the right homology arm.

8. The plasmid of any one of claims 1-7, wherein the left and right homology arms have the same length.

9. The plasmid of claim 8, wherein the homology arms are each 30bp long.

10. The plasmid of claim 8, wherein the homology arms are each 300bp long.

11. The plasmid of claim 8, wherein the homology arms are each 600bp long.

12. The plasmid of claim 8, wherein the homology arms are each 1000bp long.

13. The plasmid of any one of claims 1-7, wherein the left and right homology arms have different lengths.

14. The plasmid according to any one of claims 1 to 13, wherein the homology arm specifically hybridizes to the adeno-associated virus integration site 1 (AAVS 1) of human chromosome 19.

15. The plasmid according to any one of claims 1 to 14, further comprising a murine leukemia virus origin (MND) promoter.

16. An adeno-associated virus (AAV) vector comprising the plasmid according to any one of claims 1 to 15.

17. The AAV vector of claim 16, wherein a serotype of the AAV comprises AAV6.

18. The AAV vector of claim 16 or 17, wherein the vector further comprises a plasmid encoding crRNA, tracer RNA (trcrRNA), and CAS endonuclease.

19. The AAV vector of any one of claims 16-18, wherein the vector is a single stranded AAV (ssav).

20. The AAV vector of any one of claims 16-18, wherein the vector is a self-complementary AAV (scAAV).

21. The AAV vector of any one of claims 16-20, wherein the vector comprises a sequence at least 90% identical to SEQ ID No. 22 or SEQ ID No. 23, a fragment thereof.

22. A modified cell comprising the plasmid of any one of claims 1 to 15 or the AAV vector of any one of claims 16 to 21.

23. The modified cell of claim 22, wherein the modified cell is a Natural Killer (NK) cell or an NK T cell.

24. The modified cell of claim 23, wherein the NK cell or NK T cell has been expanded in the presence of irradiated feeder cells, plasma membrane particles, or exosomes that express membrane-bound IL-21, membrane-bound 4-1BBL, and/or membrane-bound IL-15.

25. A method of treating cancer in a subject, the method comprising administering the modified cell of any one of claims 22 to 24 to a subject having cancer.

26. The method of claim 25, wherein the cancer comprises leukemia.

27. A method of genetically modifying a cell, the method comprising:

a) Obtaining a Ribonucleoprotein (RNP) complex comprising a class 2 CRISPR/Cas endonuclease (Cas 9) complexed with a corresponding CRISPR/Cas guide RNA and an AAV vector comprising a plasmid comprising a polynucleotide sequence encoding a Chimeric Antigen Receptor (CAR) polypeptide; wherein the polynucleotide sequence is flanked by homology arms; and wherein the homology arm is 800bp or less in length; and

b) Introducing the polynucleotide sequence encoding the CAR polypeptide and the RNP complex into the cell; wherein the polynucleotide sequence encoding the CAR polypeptide is introduced into the cell via infection of the AAV into the cell; wherein the RNP complex hybridizes to a target sequence within the genomic DNA of the cell, and a DNA repair enzyme of the cell inserts the polynucleotide sequence encoding the CAR polypeptide into the host genome at the target sequence within the genomic DNA of the cell, thereby producing a modified cell.

28. The method of claim 27, wherein the cell is a primary cell or an expanded cell.

29. The method of claim 28, wherein the primary cells are incubated in the presence of IL-2 for about 4 to 10 days prior to infection.

30. The method of claim 28 or 29, wherein the primary cells are expanded in the presence of irradiated feeder cells, plasma membrane particles, or exosomes for about 4 to 10 days prior to infection.

31. The method of claim 30, wherein the irradiated feeder cells, plasma membrane particles, or exosomes express membrane-bound 4-1BBL, membrane-bound IL-21, or membrane-bound IL-15, or any combination thereof.

32. The method of any one of claims 27 to 31, further comprising expanding the modified cells after infection with irradiated feeder cells, plasma membrane particles, or exosomes, wherein the irradiated feeder cells, plasma membrane particles, or exosomes express membrane-bound 4-1BBL, membrane-bound IL-21, or membrane-bound IL-15, or any combination thereof.

33. The method of any one of claims 27-32, further comprising expanding the modified cells with IL-2 after infection.

34. The method of any one of claims 27-33, wherein the cell is infected with the AAV at a multiplicity of infection (MOI) of about 5 to 500,000.

35. The method of any one of claims 27 to 34, wherein the RNP complex is introduced into the cell via electroporation.

36. The method of any one of claims 27 to 35, wherein the RNP complex is introduced into the cell via transfection; and wherein the RNP complex is encoded on the same or different AAV.

37. The method of any one of claims 27 to 36, wherein the cell is a Natural Killer (NK) cell or an NK T cell.

38. The method of any one of claims 27 to 37, wherein the CAR polypeptide comprises a transmembrane domain, a costimulatory domain, a CD3 zeta signaling domain, and a single chain variable fragment (scFV) that specifically binds to a receptor on a target cell.

39. The method of claim 38, wherein the receptor comprises CD33.

40. The method of claim 39, wherein the scFV that specifically binds to CD33 comprises a sequence or fragment thereof at least 90% identical to SEQ ID NO. 29.

41. The method of any one of claims 27 to 40, wherein the transmembrane domain of the CAR polypeptide comprises a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, a CD3 ζ transmembrane domain, or a NKG2D transmembrane domain.

42. The method of any one of claims 27 to 41, wherein the co-stimulatory domain of the CAR polypeptide comprises a 2B4 domain, a CD28 co-stimulatory domain, a 4-1BB co-stimulatory domain, or any combination thereof.

43. The method of any one of claims 27 to 42, wherein the left and right homology arms have the same length.

44. The method of claim 43, wherein the homology arms are each 600bp long.

45. The method of any one of claims 27 to 42, wherein the left and right homology arms have different lengths.

46. The method of any one of claims 27 to 45, wherein the homology arm specifically hybridizes to the adeno-associated virus integration site 1 (AAVS 1) of human chromosome 19.

47. The method of any one of claims 27 to 46, wherein the plasmid further comprises a murine leukemia virus-derived (MND) promoter.

48. The method of any one of claims 27-47, wherein the serotype of the AAV comprises AAV6.

49. The method of any one of claims 27 to 48, wherein the vector is single stranded AAV (ssav) or self-complementary AAV (scAAV).

50. The method of any one of claims 27 to 49, wherein the vector comprises a sequence or fragment thereof that is at least 90% identical to SEQ ID No. 22 or SEQ ID No. 23.

51. A method of producing a Chimeric Antigen Receptor (CAR) Natural Killer (NK) cell or CAR NK T cell, the method comprising

a) Obtaining a Ribonucleoprotein (RNP) complex comprising a class 2 CRISPR/Cas endonuclease (Cas 9) complexed with a corresponding CRISPR/Cas guide RNA and an AAV vector comprising a plasmid comprising a polynucleotide sequence encoding a Chimeric Antigen Receptor (CAR) polypeptide; wherein the polynucleotide sequence is flanked by homology arms; and wherein the homology arm is 1000bp or less in length; and

b) Introducing the polynucleotide sequence encoding the CAR polypeptide and the RNP complex into NK cells or NK T cells; wherein the polynucleotide sequence encoding the CAR polypeptide is introduced into the NK cell or NK T cell via infection of the AAV into the NK cell or NK T cell; wherein the RNP complex hybridizes to a target sequence within the genomic DNA of the NK cell or NK T cell, and the DNA repair enzyme of the NK cell or NK T cell inserts the polynucleotide sequence encoding the CAR polypeptide into the host genome at the target sequence within the genomic DNA of the cell, thereby producing a CAR NK cell or CAR NK T cell.

52. The method of claim 51, wherein the NK cells or NK T cells are primary or expanded NK cells or NK T cells.

53. The method of claim 52, wherein the primary NK cells or NK T cells in the presence of IL-2 before infection in about 4 days to 10 days incubation.

54. The method of claim 52 or 53, wherein the primary NK cells or NK T cells are expanded in the presence of irradiated feeder cells, plasma membrane particles or exosomes for about 4 to 10 days prior to infection.

55. The method of claim 54, wherein the irradiated feeder cells, plasma membrane particles, or exosomes express membrane-bound 4-1BBL, membrane-bound IL-21, or membrane-bound IL-15, or any combination thereof.

56. The method of any one of claims 51 to 55, further comprising expanding the CAR NK cells after infection with irradiated feeder cells, plasma membrane particles, or exosomes, wherein the irradiated feeder cells, plasma membrane particles, or exosomes express membrane-bound 4-1BBL, membrane-bound IL-21, or membrane-bound IL-15, or any combination thereof.

57. The method of any one of claims 51 to 56, further comprising expanding the CAR NK cells or CAR NK T cells with IL-2 after infection.

58. The method of any one of claims 51 to 57, wherein the NK cells or NK T cells are infected with the AAV at an MOI of about 5 to 500K.

59. The method of any one of claims 51 to 58, wherein the RNP complex is introduced into the NK cells or NK T cells via electroporation.

60. The method of any one of claims 51 to 59, wherein the RNP complex is introduced into the NK cells or NK T cells via transfection; and wherein the RNP complex is encoded on the same or different AAV.

61. The method of any one of claims 51 to 60, wherein the CAR polypeptide comprises a transmembrane domain, a costimulatory domain, a CD3 zeta signaling domain, and a single chain variable fragment (scFV) that specifically binds to a receptor on a target cell.

62. The method of claim 61, wherein the receptor comprises CD33.

63. The method of claim 62, wherein the scFV that specifically binds to CD33 comprises a sequence or fragment thereof at least 90% identical to SEQ ID NO. 29.

64. The method of any one of claims 51 to 63, wherein said transmembrane domain of said CAR polypeptide comprises a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, a CD3 ∈9 transmembrane domain, or a NKG2D transmembrane domain.

65. The method of any one of claims 51 to 64, wherein the co-stimulatory domain of the CAR polypeptide comprises a 2B4 domain, a CD28 co-stimulatory domain, a 4-1BB co-stimulatory domain, or any combination thereof.

66. The method of any one of claims 51 to 65, wherein the left and right homology arms have the same length.

67. The method of claim 66, wherein the homology arms are each 600bp long.

68. The method of any one of claims 51 to 65, wherein the left and right homology arms have different lengths.

69. The method of any one of claims 51 to 68, wherein the homology arm specifically hybridizes to the adeno-associated virus integration site 1 (AAVS 1) of human chromosome 19.

70. The method of any one of claims 51 to 69, wherein the plasmid further comprises a murine leukemia virus-derived (MND) promoter.

71. The method of any one of claims 51-70, wherein the serotype of the AAV comprises AAV6.

72. The method of any one of claims 51-71, wherein the vector is single stranded AAV (ssAAV) or self-complementary AAV (scAAV).

73. The method of any one of claims 51 to 72, wherein the vector comprises a sequence or fragment thereof that is at least 90% identical to SEQ ID No. 22 or SEQ ID No. 23.

74. A method of treating cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of the CAR NK cells or the CAR NK T cells produced by using the method of any one of claims 51 to 73.

75. A method of treating cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of a Natural Killer (NK) cell or NK T cell, wherein the NK cell or NK T cell comprises a plasmid for use with a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/CRISPR-associated 9 (Cas 9) integration system, wherein the plasmid comprises, in order, a left homology arm, a polynucleotide sequence encoding a Chimeric Antigen Receptor (CAR) polypeptide, and a right homology arm; wherein the left and right homology arms are each 1000bp or less in length.

76. The method of claim 75, wherein the CAR polypeptide comprises a transmembrane domain, a costimulatory domain, a CD3 zeta signaling domain, and a single chain variable fragment (scFV) that specifically binds to a receptor on a target cell.

77. The method of claim 76, wherein the receptor comprises CD33.

78. The method of claim 77, wherein the scFV that specifically binds to CD33 comprises a sequence at least 90% identical to SEQ ID No. 29 or a fragment thereof.

79. The method of any one of claims 75-78, wherein the transmembrane domain of the CAR polypeptide comprises a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, a CD3 ζ transmembrane domain, or a NKG2D transmembrane domain.

80. The method of any one of claims 75 to 79, wherein the co-stimulatory domain of the CAR polypeptide comprises a 2B4 domain, a CD28 co-stimulatory domain, a 4-1BB co-stimulatory domain, or any combination thereof.

81. The method of any one of claims 75-80, further comprising a polyadenylation signal between the transgene and the right homology arm.

82. The method of any one of claims 75 to 81, wherein the left and right homology arms have the same length.

83. The method of claim 82, wherein the homology arms are each 30bp long.

84. The method of claim 82, wherein the homology arms are each 300bp long.

85. The method of claim 82, wherein the homology arms are each 600bp long.

86. The method of claim 82, wherein the homology arms are each 1000bp long.

87. The method of any one of claims 75 to 80, wherein the left and right homology arms have different lengths.

88. The method of any one of claims 75-87, wherein the homology arm specifically hybridizes to the adeno-associated virus integration site 1 (AAVS 1) of human chromosome 19.

89. The method of any one of claims 75-88, further comprising a murine leukemia virus-derived (MND) promoter.

90. The method of any one of claims 75-89, wherein the plasmid is transduced into the NK by an adeno-associated virus (AAV) vector.

91. The method of claim 90, wherein the serotype of AAV comprises AAV6.

92. The method of claim 90 or 91, wherein the vector further comprises plasmids encoding crRNA, tracer RNA (trcrRNA), and CAS endonuclease.

93. The method of any one of claims 90-92, wherein the vector is single stranded AAV (ssav).

94. The method of any one of claims 90-93, wherein the vector is a self-complementary AAV (scAAV).

95. The method of any one of claims 90 to 94, wherein the vector comprises a sequence or fragment thereof that is at least 90% identical to SEQ ID No. 22 or SEQ ID No. 23.

96. The method of any one of claims 75-95, wherein the cancer comprises Acute Lymphoblastic Leukemia (ALL), acute Myelogenous Leukemia (AML), chronic Myelogenous Leukemia (CML), hairy Cell Leukemia (HCL), or myelodysplastic syndrome (MDS).

97. A plasmid for use with a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated 9 (Cas 9) integration system, wherein the plasmid comprises a polynucleotide sequence encoding a Chimeric Antigen Receptor (CAR) polypeptide; wherein the polynucleotide sequence is adjacent to or flanked by two PAM and two polynucleotide sequences encoding a crRNA (crRNA) and a pre-spacer adjacent motif (PAM).

98. The plasmid of claim 97, comprising, in order, a PAM sequence and a polynucleotide sequence encoding a crRNA, a polynucleotide sequence encoding the CAR polypeptide, and a PAM sequence and a polynucleotide sequence encoding a crRNA.

99. The plasmid of claim 97 or 98, wherein the CAR polypeptide comprises a transmembrane domain, a costimulatory domain, a CD3 zeta signaling domain, and a single chain variable fragment (scFV) that specifically binds to a receptor on a target cell.

100. The plasmid of claim 99, wherein the receptor comprises CD33.

101. The method of claim 100, wherein the scFV that specifically binds to CD33 comprises a sequence at least 90% identical to SEQ ID No. 29 or a fragment thereof.

102. The plasmid of any one of claims 97 to 101, wherein the transmembrane domain of the CAR polypeptide comprises a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, a CD3 ζ transmembrane domain, or a NKG2D transmembrane domain.

103. The plasmid of any one of claims 97 to 102, wherein the co-stimulatory domain of the CAR polypeptide comprises a 2B4 domain, a CD28 co-stimulatory domain, a 4-1BB co-domain

104. The plasmid according to any one of claims 97-103, further comprising a murine leukemia virus origin (MND) promoter.

105. An adeno-associated virus (AAV) vector comprising the plasmid of any one of claims 97-104.

106. The AAV vector of claim 105, wherein a serotype of the AAV comprises AAV6.

107. The AAV vector of claim 105 or 106, wherein the vector further comprises a plasmid encoding crRNA, tracer RNA (trcrRNA), and CAS endonuclease.

108. The AAV vector of any one of claims 105-107, wherein the vector is a single stranded AAV (ssAAV) or a self-complementary AAV (scAAV).

109. A modified cell comprising the plasmid of any one of claims 97-104 or the AAV vector of any one of claims 105-108.

110. The modified cell of claim 109, wherein the modified cell is a Natural Killer (NK) cell or an NK T cell.

111. The modified cell of claim 110, wherein the NK cell or NK T cell has been expanded in the presence of irradiated feeder cells, plasma membrane particles, or exosomes that express membrane-bound IL-21, membrane-bound 4-1BBL, and/or membrane-bound IL-15.

112. A method of treating cancer in a subject, the method comprising administering the modified cell of any one of claims 109-111 to a subject having cancer.

113. The method of claim 112, wherein the cancer comprises leukemia.

114. A method of producing a Chimeric Antigen Receptor (CAR) Natural Killer (NK) cell or NK T cell, the method comprising

a) Obtaining a Ribonucleoprotein (RNP) complex comprising a class 2 CRISPR/Cas endonuclease (Cas 9) complexed with a corresponding CRISPR/Cas guide RNA and an AAV vector comprising a plasmid comprising a polynucleotide sequence encoding a Chimeric Antigen Receptor (CAR); wherein the polynucleotide sequence is adjacent to or flanked by two PAM and two polynucleotide sequences encoding a crRNA (PAM) and a pre-spacer adjacent motif (PAM) and a polynucleotide sequence encoding a crpr RNA (crRNA); and

b) Introducing the polynucleotide sequence encoding the CAR polypeptide and the RNP complex into the NK cell or NK T cell; wherein the plasmid is introduced into a target cell via infection of the cell with the adeno-associated virus (AAV); wherein the Ribonucleoprotein (RNP) complex hybridizes to a target sequence within the genomic DNA of the cell, and a DNA repair enzyme of the cell inserts the polynucleotide sequence encoding the CAR into the host genome at the target sequence, thereby producing a CAR NK cell or CAR NK T cell.

115. The method of claim 114, wherein the plasmid comprises, in order, a PAM sequence and a polynucleotide sequence encoding a crRNA, the polynucleotide sequence encoding the CAR polypeptide, and a PAM sequence and a polynucleotide sequence encoding a crRNA.

116. A method of genetically modifying a Natural Killer (NK) cell or NK T cell, the method comprising

a) Obtaining a Ribonucleoprotein (RNP) complex comprising a class 2 CRISPR/Cas endonuclease (Cas 9) complexed with a corresponding CRISPR/Cas guide RNA and an AAV vector comprising a plasmid comprising a polynucleotide sequence encoding a Chimeric Antigen Receptor (CAR); wherein the polynucleotide sequence is adjacent to or flanked by two PAM and two polynucleotide sequences encoding crrnas; and

b) Introducing the polynucleotide sequence encoding the CAR polypeptide and the RNP complex into the NK cell or NK T cell; wherein the polynucleotide sequence encoding the CAR polypeptide is introduced into a target cell via infection of the cell by the adeno-associated virus (AAV); wherein the Ribonucleoprotein (RNP) complex hybridizes to a target sequence within the genomic DNA of the cell, and a DNA repair enzyme of the cell inserts the polynucleotide sequence encoding the Chimeric Antigen Receptor (CAR) into the host genome at the target sequence, thereby producing a modified cell.

117. The method of claim 116, wherein the plasmid comprises, in order, a PAM sequence and a polynucleotide sequence encoding a crRNA, the polynucleotide sequence encoding the CAR polypeptide, and a PAM sequence and a polynucleotide sequence encoding a crRNA.