CN117126921B - Library construction method for detecting T cell and B cell immune repertoire, primer and kit thereof - Google Patents

Abstract

The invention relates to a library construction method for detecting T cell and B cell immune repertoire, and a primer and a kit thereof, wherein the library construction method comprises the following steps: (1) extracting total RNA in a sample; (2) synthesizing full-length cDNA by using the total RNA as a template; (3) Performing PCR amplification on the full-length cDNA by using a magnetic bead primer; (4) Eluting the system after the reaction in the step (3) by using a TCR eluent and a BCR eluent respectively to obtain a TCR amplification product and a BCR amplification product; (5) Mixing the TCR amplification product and the BCR amplification product to build a library; (6) High throughput sequencing of the library created in step (5). The invention can improve the amplification efficiency and reduce the generation of non-target fragments. The method for constructing the library can adopt the existing commercialized reagent at home, and has the advantage of low reagent cost. In addition, the method for constructing the warehouse has the advantages of low labor cost and high working efficiency.

Description

Library construction method for detecting T cell and B cell immune repertoire, primer and kit thereof

Technical Field

The invention belongs to the field of molecular biology, and particularly relates to a library construction method for detecting T cell and B cell immune libraries, and primers and a kit thereof.

Background

T cells and B cells are two types of cells of the body responsible for specific immunity, and a T Cell Receptor (TCR) and a B Cell Receptor (BCR) are receptor proteins on the surface of a T cell membrane and the surface of a B cell membrane, respectively, and can specifically recognize and bind to an antigen.

The large number of V, D, J gene segments at the T, B cell locus produced various diverse recombination events in T cell and B cell receptor formation, and this recombination of the V-D-J gene conferred unique T, B cell receptors on each T, B cell itself, thereby enabling the sequence of each TCR and BCR to be effectively the sole biomarker for one T, B cell clone. Through immune repertoire (TCR/BCR) sequencing, the clone typing of various T cells and B cells can be detected and found, the immune microenvironment change when tumors or infectious diseases occur is revealed, the target point of immune treatment is found, and meanwhile, the TCR/BCR sequencing can also be used for antibody development, medication, vaccine evaluation and other directions.

Because the biggest characteristic of the TCR and BCR genes is random recombination of V, D, J gene fragments, it is difficult to design an upstream primer for identifying the 5' end sequences of the TCR and BCR genes, the target fragments enriched by the TCR and BCR after PCR reaction are not efficient, and a large number of non-target fragments are also present. The current mature T, B cellular immune repertoire technology mainly uses products provided by foreign 10X genomics (10X genomics), has high reagent cost and high requirements on technical stability of experimental operation, and is not suitable for large-scale clinical diagnosis and large-scale health screening.

CN107058484B discloses a primer combination and a kit for simultaneously detecting T cells and B cell immune repertoires by high-throughput sequencing, which can simultaneously detect TCR and BCR by cDNA adaptor and single-pair primer design, but the amplification efficiency of the patent still needs to be improved, and the patent adopts an imported reagent in experiments, so that the defect of high test cost exists.

Disclosure of Invention

The invention aims to provide a library construction method for detecting T cell and B cell immune libraries with high amplification efficiency, and primers and a kit thereof.

In order to achieve the above purpose, the invention adopts the following technical scheme:

the first aspect of the invention provides a method for constructing a repertoire for detecting T cells and B cells, comprising the following steps:

(1) Extracting total RNA in a sample;

(2) Synthesizing full-length cDNA by taking the total RNA as a template;

(3) Performing PCR amplification on the full-length cDNA by using a magnetic bead primer, wherein the magnetic bead primer is a magnetic bead coupled with a TCR primer for amplifying TCR and a BCR primer for amplifying BCR, and the sequence of the TCR primer is from 5 'end to 3' end: ACTCTAAATCCAGTGAC and AAAACGTGTTCCCACCCAAG, the sequences of the BCR primers are CCTGGTCCAGGGCTTCTTCC, CAAAGGATAACAGCCCT, GGCCACGGGCTACTTCCC, CCGGTGACGGTGTCGTGGAACTCA, GTGAGAATTCCCCGTCG, TGTGCCTGCTGAATAAC and CTCATAAGTGACTTCTA;

(4) Eluting the system after the reaction in the step (3) by using a TCR eluent and a BCR eluent respectively to obtain a TCR amplification product and a BCR amplification product;

(5) Mixing the TCR amplification product and the BCR amplification product to build a library;

(6) High throughput sequencing of the library created in step (5).

In the step (1), the method for extracting total RNA may be a method conventional in the art.

According to some embodiments, for whole blood samples, the method of extracting total RNA is:

adding 2-4 times of red blood cell lysate into 1 time of fresh whole blood, slightly swirling or reversing and mixing uniformly, incubating on ice for 10-20 minutes, slightly swirling and mixing uniformly for a plurality of times, centrifuging to collect white blood cells, and carefully sucking and removing supernatant;

adding 1-3 times of volume of erythrocyte lysate into the sediment, lightly swirling to fully resuspend the leucocytes, centrifuging to collect the leucocytes, carefully and thoroughly sucking the supernatant, adding 1 XPBS to resuspend the cells, centrifuging, carefully and thoroughly sucking the supernatant, adding the lysate, vibrating and uniformly mixing to fully lyse the cells;

adding absolute ethyl alcohol with equal volume into the lysed cells, fully and uniformly mixing, adding the liquid into an RNA centrifugal column, centrifuging, discarding the filtrate, adding a cleaning solution into the RNA centrifugal column, centrifuging, and discarding the filtrate;

placing the RNA centrifugal column on a clean centrifuge tube without RNase, uncovering and airing, dripping eluent in the center of a membrane of the RNA centrifugal column, standing at room temperature, and centrifuging to obtain total RNA of whole blood.

According to some embodiments, for tissue samples, the method of extracting total RNA is:

placing 1-25 mg of tissue small pieces into a centrifuge tube, adding a lysate, placing the lysate on ice by using a glass grinder, grinding the tissue small pieces into homogenate, centrifuging the homogenate, and transferring the supernatant into a new centrifuge tube;

adding absolute ethyl alcohol with equal volume into the lysed cells, fully and uniformly mixing, adding the liquid into an RNA centrifugal column, centrifuging, discarding the filtrate, adding a cleaning solution into the RNA centrifugal column, centrifuging, and discarding the filtrate;

placing the RNA centrifugal column on a clean centrifuge tube without RNase, uncovering and airing, dripping eluent in the center of a membrane of the RNA centrifugal column, standing at room temperature, centrifuging to obtain total RNA of the tissue, and preserving the quality inspection qualified total RNA at-80 ℃ for standby.

According to some embodiments, in step (2), first, a first strand cDNA is synthesized using the total RNA as a template and a first primer; then amplifying the first strand cDNA by using a second primer, a third primer and a fourth primer to obtain the full-length cDNA; the sequence of the first primer from the 5 'end to the 3' end is TCGTTCATAGTTAATCTAGTTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN, VN represents n T, and n is a number between 30 and 50;

the sequence of the second primer is TCGTTCATAGTTAATCTAGT;

the sequence of the third primer is CCGTCTGATATGGCCCTTTATG;

the sequence of the fourth primer is AAGCCCGTCTGATATGGCCCTTTATGTGGG.

Further, the reaction system for synthesizing the first strand cDNA includes 6.25. Mu.L of the first product, 2. Mu.L of a reverse transcription reaction buffer, 0.5. Mu.L of Dithiothreitol (DTT), 0.25. Mu.L of an RNase inhibitor, 0.5. Mu.L of a fourth primer, and 0.5. Mu.L of a reverse transcriptase.

Further, the procedure for synthesizing the first strand cDNA is: constant temperature of 42 ℃ for 90min,70 ℃ for 15min and 4 ℃.

Wherein the first product is obtained by the following method: taking 5 mu L of total RNA sample to a PCR tube, adding 1 mu L of sample buffer solution, uniformly mixing the walls of the flick tube, centrifugally collecting and incubating for 5min at room temperature; 6 mu L of the RNA sample is taken, 2 mu L of the first primer and 1 mu L of dNTP premix are mixed uniformly, and the mixture is immediately placed on ice for at least 2 minutes after the mixture is run for 3 minutes at the temperature of 72 ℃ by running a hot cover 105 ℃ on a PCR instrument.

Further, the reaction system for full-length cDNA amplification of the first strand cDNA synthesis product by PCR included 10. Mu.L of the first strand cDNA, 1. Mu.L of the third primer, 1. Mu.L of the second primer, and 12. Mu.L of the 2 XPCR premix.

Further, the procedure for full-length cDNA amplification of the first strand cDNA synthesis product by PCR was 98℃for 1min;98 ℃ for 10s,65 ℃ for 15s and 72 ℃ for 6min, and 11-18 cycles are performed; 72 ℃ for 5min; constant temperature at 4 ℃.

According to some embodiments, the pooling method further comprises a step of purifying the full-length cDNA after step (2) and before step (3).

According to some embodiments, the TCR primer and BCR primer in the magnetic bead primer are covalently coupled to the magnetic bead via biotin and streptavidin, respectively.

According to some embodiments, the 5' ends of the TCR primer and the BCR primer are immobilized on the magnetic beads.

Further, the magnetic beads are streptavidin magnetic beads with hydrophilic groups on the surfaces, and the particle size of the magnetic beads is 1-5 mu m. The magnetic beads are commercially available, for example, SA magnetic beads having the product numbers 22307, 22305, etc. from the company of biomedical engineering, inc. of beaver, suzhou.

Further, the magnetic bead primer can be prepared by the steps of:

step one: preparing buffer solution

10mM Tris-HCl (pH 7.5), 1mM EDTA,1M NaCl,0.01% -0.1% Tween-20;

step two: immobilized nucleic acid

Placing the magnetic bead bottle on a vortex oscillator for 30s, oscillating to re-suspend the magnetic beads, taking 100 mu L of the magnetic beads into a new centrifuge tube, placing the centrifuge tube into 300 mu L of buffer solution, uniformly mixing, incubating for 5min at room temperature, placing the centrifuge tube on a magnetic rack, and removing the supernatant after 1min;

step three: magnetic bead washing

Adding 1mL of buffer solution into a centrifuge tube, covering a centrifuge tube cover, vortex vibrating the magnetic beads for 15s, removing supernatant, adding 500 mu L of biotinylated TCR primer and BCR primer diluted with the buffer solution (enabling the concentration of the magnetic beads to be 2 mg/mL), fully oscillating and re-suspending the magnetic beads, placing the centrifuge tube on a rotary mixer, rotatably mixing at room temperature for 30min, placing on a magnetic rack, transferring the supernatant to a new centrifuge tube after 1min, and washing the magnetic beads with the buffer solution for three times;

step four: heavy suspension magnetic bead

The appropriate low salt buffer was added and the beads were resuspended to prepare a final concentration of 10mg/mL (streptavidin 100. Mu.g/mL) of the bead primer and stored at 4-8deg.C prior to use.

According to some embodiments, the PCR amplification in step (3) is also performed in the presence of a third primer, the sequence of which is CCGTCTGATATGGCCCTTTATG from the 5 'end to the 3' end.

Further, in the step (3), the reaction system for PCR amplification comprises X. Mu.L of a liquid containing the full-length cDNA, 25. Mu.L of a premix solution of high-fidelity enzyme, 2. Mu.L of the third primer and (23-X) mu.L of the bead primer, wherein X is determined by the concentration of the full-length cDNA in the liquid containing the full-length cDNA, the mass of the full-length cDNA in the reaction system is controlled to be 10-45 ng, and the concentration of the liquid containing the full-length cDNA is more than or equal to 5 ng/. Mu.L.

Wherein the liquid containing the full-length cDNA is an amplification product containing the full-length cDNA, which is obtained by purifying the reaction system prepared in the step (2).

Further, in the step (3), the PCR amplification is performed at 94℃for 1min;94 ℃ for 30s,63 ℃ for 30s and 72 ℃ for 1min, and 15-25 cycles are performed; 72 ℃ for 5min; constant temperature at 4 ℃.

According to some embodiments, the BCR eluent comprises a first buffer solution with a ph of 7.5-8.5 and formamide accounting for 90-100% of the total mass of the first buffer solution; the first buffer solution comprises 5-15 mM Tris-HCl and 3-8 mM EDTA.

According to some embodiments, the TCR eluent has a pH of 8.5-9.5, comprising a second buffer at pH 8-9, and 25-35 mm sodium acetate; the second buffer solution comprises 10-20 mM Tris-HCl and 3-8 mM EDTA.

According to some embodiments, the specific method of step (4) is: firstly, adding the TCR eluent into a system after the reaction in the step (3), carrying out vortex oscillation, incubation and centrifugation, separating magnetic beads from the TCR amplification products in a magnetic frame, and collecting the TCR amplification products; drying the magnetic beads until no liquid remains; and adding the BCR eluent, performing vortex oscillation, incubation and centrifugation, separating magnetic beads from the BCR amplification products in a magnetic rack, and collecting the BCR amplification products.

According to some embodiments, in step (5), the reaction system for adaptor-ligation at the time of pooling comprises 65. Mu.L of the second product, 25. Mu.L of the rapid ligation buffer, 5. Mu.L of the rapid DNA ligase, and 5. Mu.L of the DNA adaptor; and (3) uniformly mixing and centrifuging the reaction system connected by the connector, and then, operating in a PCR instrument at 20 ℃ for 15 minutes and then cooling to 4 ℃. Wherein the second product is obtained by the following method: mixing 20 mu L of each of the TCR amplification product and the BCR amplification product, adding 15 mu L of an end repair reagent and 10ul of nuclease-free water, uniformly mixing and centrifuging to collect a reaction solution to the bottom of a tube, placing a PCR tube in a PCR instrument, running at 20 ℃ for 15 minutes, and cooling to 4 ℃ after running at 65 ℃ for 15 minutes.

Further, after the reaction of the adaptor-ligated reaction system was completed, 20. Mu.L of the reaction product, 5. Mu.L of the PCR mixed primer and 25. Mu.L of the PCR amplification premix were mixed uniformly, and amplified according to the following procedure: 3min at 95 ℃;98 ℃ for 20s,60 ℃ for 15s and 72 ℃ for 30s, and 3-10 cycles are performed; 72 ℃ for 5min; constant temperature at 4 ℃.

Further, the step of mixing and banking further comprises a step of purifying a product after the reaction of the reaction system connected by the connector is completed.

According to some embodiments, the library construction method further comprises a step of purifying the library amplified in step (5) after step (5) and before step (6).

In a second aspect, the invention provides a primer for detecting T cell and B cell immune repertoires, the primer comprising a TCR primer, a BCR primer, a first primer, a second primer, a third primer and a fourth primer, the sequence of the TCR primer from 5 'to 3': ACTCTAAATCCAGTGAC and AAAACGTGTTCCCACCCAAG are provided with a plurality of slots,

the sequences of the BCR primers are CCTGGTCCAGGGCTTCTTCC, CAAAGGATAACAGCCCT, GGCCACGGGCTACTTCCC, CCGGTGACGGTGTCGTGGAACTCA, GTGAGAATTCCCCGTCG, TGTGCCTGCTGAATAAC and CTCATAAGTGACTTCTA,

the sequence of the first primer is TCGTTCATAGTTAATCTAGTTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN, VN represents n T, n is a number between 30 and 50,

the sequence of the second primer is TCGTTCATAGTTAATCTAGT,

the sequence of the third primer is CCGTCTGATATGGCCCTTTATG,

the sequence of the fourth primer is AAGCCCGTCTGATATGGCCCTTTATGTGGG.

The third aspect of the invention provides a kit for detecting T cell and B cell immune repertoires, which comprises a first primer, a second primer, a third primer, a fourth primer and a magnetic bead primer; the magnetic bead primer is a magnetic bead coupled with a TCR primer and a BCR primer; from 5 'end to 3' end, the sequence of the TCR primer: ACTCTAAATCCAGTGAC and AAAACGTGTTCCCACCCAAG are provided with a plurality of slots,

the sequences of the BCR primers are CCTGGTCCAGGGCTTCTTCC, CAAAGGATAACAGCCCT, GGCCACGGGCTACTTCCC, CCGGTGACGGTGTCGTGGAACTCA, GTGAGAATTCCCCGTCG, TGTGCCTGCTGAATAAC and CTCATAAGTGACTTCTA,

the sequence of the first primer is TCGTTCATAGTTAATCTAGTTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN, VN represents n T, n is a number between 30 and 50,

the sequence of the second primer is TCGTTCATAGTTAATCTAGT,

the sequence of the third primer is CCGTCTGATATGGCCCTTTATG,

the sequence of the fourth primer is AAGCCCGTCTGATATGGCCCTTTATGTGGG.

Further, the kit further comprises commercial reagents used in the library construction method, and the commercial reagents, the first primer, the second primer, the third primer, the fourth primer and the magnetic bead primer are assembled into the kit, so that the kit can be conveniently used by downstream customers.

Due to the application of the technical scheme, compared with the prior art, the invention has the following advantages:

the invention carries out PCR amplification by designing the TCR primer and the BCR primer and fixing the TCR primer and the BCR primer on the magnetic beads, and then recovers TCR amplification products and BCR amplification products through TCR eluent and BCR eluent, thereby improving the amplification efficiency and simultaneously reducing the generation of non-target fragments. The method for constructing the library can adopt the existing commercialized reagent at home, and has the advantage of low reagent cost. In addition, the method for constructing the warehouse has the advantages of low labor cost and high working efficiency.

Drawings

FIG. 1 is a schematic diagram of a pooling scheme for T-cell and B-cell immune repertoires;

FIG. 2 is a schematic diagram of a magnetic bead primer;

FIG. 3 is a schematic diagram of the synthesis of full-length cDNA;

FIG. 4 is a flow chart of a mixed library construction of TCR and BCR amplification products based on an MGI sequencing platform;

FIG. 5 is a graph showing the results of comparison of the TCR amplification efficiencies of examples and comparative examples, wherein A is a graph showing the results of the TCR amplification of comparative examples and B is a graph showing the results of the amplification of TCR of examples;

FIG. 6 is a graph showing the comparison of the amplification efficiencies of BCR of examples and comparative examples, wherein A is a graph showing the amplification results of BCR of comparative examples, and B is a graph showing the amplification results of BCR of examples;

FIG. 7 is a graph of the results of NGS sequencing of the original sequence.

Detailed Description

Aiming at the problems existing in the prior art, the invention discloses a method for constructing a library for efficiently detecting T cells and B cells of a blood or tissue sample based on magnetic bead primers, which comprises the steps of simultaneously fixing TCR and BCR specific primers on one magnetic bead, putting a certain proportion of magnetic beads with the primers into full-length cDNA for PCR amplification, simultaneously amplifying target fragments of TCR and BCR, and then efficiently enriching TCR amplification products and BCR amplification products under the action of TCR eluent and BCR eluent. Meanwhile, the invention also carries out optimal design on the specific primers of TCR and BCR, so that the non-target fragments after PCR amplification are obviously reduced.

As shown in FIG. 1, the T cell and B cell immune repertoire mixed library is constructed simultaneously for sequencing the same sample, and the technical scheme comprises the following steps: step one: total RNA extraction: the blood extraction adopts fresh whole blood to extract total RNA, the required amount of the whole blood is 2-5 ml, and for tissue RNA extraction, 1-25 mg, preferably 10-25 mg of fresh tissue small pieces are required; step two: reverse transcription of RNA into full-length cDNA: first, using total RNA as a template to carry out first-strand cDNA synthesis, and carrying out full-length cDNA amplification on a first-strand cDNA synthesis product by PCR; step three: and (3) PCR amplification: putting the magnetic bead primers into full-length cDNA for PCR amplification, and eluting TCR and BCR amplification products by using TCR and BCR eluents respectively; step four: mixing TCR and BCR amplification products to build a library: the TCR and BCR amplification products of the same blood sample or tissue sample are respectively mixed by 20ul, the 5 'end of the TCR and BCR amplification products are phosphorylated, dA tail is added at the 3' end of the TCR and BCR amplification products, then corresponding DNA joints are added, after magnetic bead purification, library amplification and quality control are qualified, high-throughput sequencing is carried out, the data information such as clone diversity and CDR3 nucleic acid length distribution of the TCR and BCR amplification products can be accurately analyzed, and a reference basis is provided for subsequent clinical diagnosis and health screening.

The method for constructing the warehouse can adopt the existing commercialized reagent at home, thereby greatly reducing the cost of the reagent. In addition, the library construction method has high amplification efficiency and less non-target fragments, thereby greatly reducing labor cost and improving working efficiency.

The invention is further described below with reference to examples. The present invention is not limited to the following examples. The implementation conditions adopted in the embodiments can be further adjusted according to different requirements of specific use, and the implementation conditions which are not noted are conventional conditions in the industry. The technical features of the various embodiments of the present invention may be combined with each other as long as they do not collide with each other.

Examples

The reagents used were:

erythrocyte lysate, purchased from Jiangsu kang as century biotechnology Co., ltd, cat No. CW0613S;

the three components of lysate (Lysis Buffer), eluent (Elution Buffer) and cleaning solution (Wash Buffer) are all purchased from RNA rapid extraction kit of Shanghai Yi-shii biological Co., ltd, with the product number RN001;

the sequence of the first primer is TCGTTCATAGTTAATCTAGTTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN (SEQ ID NO. 1), the VN represents n T's, the n being 35;

the present invention uses the 5' RACE technique to reverse transcribe mRNA. After the completion of the reverse transcription, the subsequent magnetic bead labeling and purification work was performed. The invention can use any commercial 5' RACE technical kit to carry out reverse transcription operation. Taking the reverse transcription kit (cat No. 634858) from the company of baotechnology (da) as an example, the following components were used:

1) The reverse transcriptase, AMV Reverse Transcriptase,

2) Sample Buffer, 5 XFirst-Strand Buffer;

RNase inhibitor, shanghai Biyun biotechnology Co., ltd., product number R0102-10kU;

dNTP premix, tiangen Biochemical technology (Beijing) Co., ltd., product number 4992932;

reverse transcription reaction buffer, product number 15662-A, available from Shanghai, inc., next san Jose Biotech;

2 XPCR premix, hai Biyun Tian biotechnology Co., ltd., product number D7228;

the sequence of the second primer is TCGTTCATAGTTAATCTAGT (SEQ ID NO. 2);

the third primer has the sequence CCGTCTGATATGGCCCTTTATG (SEQ ID NO. 3);

the fourth primer has the sequence AAGCCCGTCTGATATGGCCCTTTATGTGGG (SEQ ID NO. 4);

DNA purified magnetic beads were purchased from Northenan Biotech Co., ltd. Brand N411-02;

high fidelity enzyme premix, 2 x Hieff PCR Master Mix available from the company "Shanghai" Inc. under the accession number H0225971;

magnetic bead primer: the TCR primer and the BCR primer are coupled to magnetic beads by the Simer Feishier technology company, the magnetic beads adopt a directional fixation technology to covalently couple the recombinant neutral streptavidin to magnetic microspheres with regular morphology and uniform particle size, a single-molecule fixation layer is formed, and the biotinylated TCR primer and BCR primer are coupled to the streptavidin. Hydrophilic groups used on the surfaces of the magnetic beads do not affect the enzymatic reaction, and the mixing of the streptavidin magnetic beads in a PCR reaction system does not have obvious influence on nucleic acid amplification. Sequence of TCR primer: ACTCTAAATCCAGTGAC (SEQ ID NO. 5) and AAAACGTGTTCCCACCCAAG (SEQ ID NO. 6), the sequences of the BCR primers being CCTGGTCCAGGGCTTCTTCC (SEQ ID NO. 7), CAAAGGATAACAGCCCT (SEQ ID NO. 8), GGCCACGGGCTACTTCCC (SEQ ID NO. 9), CCGGTGACGGTGTCGTGGAACTCA (SEQ ID NO. 10), GTGAGAATTCCCCGTCG (SEQ ID NO. 11), TGTGCCTGCTGAATAAC (SEQ ID NO. 12) and CTCATAAGTGACTTCTA (SEQ ID NO. 13);

the following 6 reagent components were all from the stock kit from Northenan Biotech Co., ltd., product number NDM607-02:

1) The End repair reagent End Prep Mix4,

2) The rapid connection buffer Rapid Ligation buffer 2 is provided,

3) A Rapid DNA ligase Rapid DNA library,

4) DNA adaptor X was used as a DNA adaptor,

5) The primer PCR Primer Mix for MGl was mixed by PCR,

6) PCR amplification premix HiFi Amplification Mix;

the reagents may be assembled into a kit.

This example provides a method for T-cell and B-cell immune repertoire construction comprising the steps of:

step one: the extraction method of total RNA in blood comprises the following steps:

taking 3mL of fresh whole blood, adding 9mL of erythrocyte lysate into the fresh whole blood, mixing the mixture upside down, incubating the mixture on ice for 15 minutes, slightly vortex the mixture for two times, centrifuging the mixture at the temperature of 4 ℃ for 10 minutes at the speed of 450 Xg, collecting white blood cells, and carefully absorbing and discarding supernatant;

adding 6mL of erythrocyte lysate to the above precipitate, gently swirling to fully resuspend the leucocytes, centrifuging at 4 ℃ for 10 minutes at 450 Xg to collect the leucocytes, carefully and thoroughly sucking the supernatant, adding 1mL of 1 XPBS to resuspend the cells, centrifuging at 4 ℃ for 10 minutes at 450 Xg, carefully and thoroughly sucking the supernatant, adding 500 mu L of lysate, shaking and uniformly mixing, and fully lysing the cells;

adding 500 mu L of absolute ethyl alcohol into the lysed cells, fully mixing, adding the liquid into an RNA centrifugal column, centrifuging for 1min at 12000 Xg, discarding the filtrate, adding 500 mu L of cleaning liquid into the RNA centrifugal column at 12000 Xg, centrifuging for 1min, and discarding the filtrate;

placing the RNA centrifugal column on a clean 1.5mL centrifuge tube without RNase, uncovering and airing for 2 minutes, dripping 50 mu L of eluent in the center of a membrane of the RNA centrifugal column, standing for 2 minutes at room temperature, carrying out 12000 Xg, centrifuging for 2 minutes, obtaining total RNA of whole blood, and storing the total RNA at the temperature of-80 ℃ for standby, wherein the final extraction concentration is more than 8 ng/mu L, and the OD260/280 ratio is 1.80-2.2, and judging that the total RNA is qualified for extraction.

Step two: reverse transcription of RNA into full-length cDNA:

first strand cDNA synthesis is carried out by taking total RNA as a template, taking 5 mu L of total RNA sample to 0.2 mL of RNase-free PCR tube, adding 1 mu L of sample buffer solution, uniformly mixing the light elastic tube wall, centrifugally collecting for a short time and incubating at room temperature for 5min;

the following reaction system was prepared by taking 6. Mu.L of the RNA sample, 2. Mu.L of the first primer and 1. Mu.L of dNTP premix, gently mixing the mixture with a pipette, and immediately placing the mixture on ice for at least 2 minutes after running the mixture on a PCR instrument at 105℃for 3 minutes and 72℃for preparing the reaction system according to the following ratio of Table 1:

the reaction system was gently mixed using a pipette, and placed in a PCR instrument to run the procedure of table 2 below:

after completion of the above reaction, the first strand cDNA synthesis product was subjected to full-length cDNA amplification by PCR, and a reaction system was prepared by the following reagents of Table 3:

the reaction system was gently mixed using a pipette, and placed in a PCR instrument to run the procedure of table 4 below:

after the reaction is finished, 26 mu L of nuclease-free water is added into a reaction system, the reaction system is supplemented to 50 mu L of total system, 50 mu L of DNA purification magnetic beads are added into the cDNA amplification reaction system, after the mixture is uniformly mixed by an oscillator, the mixture is incubated at room temperature for 8 min, cDNA is combined on the magnetic beads, a reaction tube is briefly centrifuged and placed on a magnetic frame to separate the magnetic beads and liquid, the PCR tube is kept on the magnetic frame all the time, after the solution is clarified, the PCR tube is kept on the magnetic frame all the time, 200 mu L of freshly prepared 80% ethanol is added, the mixture is incubated at room temperature for 30 seconds, the supernatant is carefully removed, 200 mu L of freshly prepared 80% ethanol is added, the mixture is incubated at room temperature for 30 seconds, and after the supernatant is carefully removed, the mixture is uncapped and dried at room temperature for 3 to 5min;

after the magnetic beads are dried in the air, the PCR tube is taken down from the magnetic frame, 17 mu L of nuclease-free water is added to cover the magnetic beads, a pipettor is used for blowing and evenly mixing the magnetic beads, after the magnetic beads are incubated for 2min at room temperature, the PCR tube is placed in the magnetic frame after being briefly centrifuged, the magnetic beads and the liquid are separated until the solution is clarified, 15 mu L of supernatant is sucked and transferred into a new low-adsorption EP tube, and cDNA amplification products are qualified in quality inspection and stored at the temperature of minus 20 ℃ for standby as shown in figure 4. The quality inspection method of the cDNA amplification product comprises the following steps: and (3) carrying out Qubit quantification on 1 mu L of purified full-length cDNA amplified product, wherein the concentration is more than 5 ng/. Mu.L, and taking 15ng of PCR amplified product, detecting cDNA fragments by using Qsep1, wherein the range of the cDNA fragments is 100-5000 bp, and the cDNA fragments have obvious peak values about 2000 bp.

Step three: magnetic bead primer preparation and PCR amplification:

before use, the magnetic bead primers are mixed by shaking and placed at room temperature for at least 30min, and a reaction system is prepared according to the following reagents in Table 5:

the reaction system was gently mixed using a pipette, and placed in a PCR instrument to run the procedure of table 6 below:

after the reaction is completed, 25 mu L of TCR eluent is added, vortex oscillation is carried out, room temperature is carried out for 5 minutes, a PCR tube is briefly centrifuged and placed in a magnetic rack to separate magnetic beads and TCR products, 25 mu L of TCR products are collected, and the TCR quality is qualified, as shown in a B in fig. 5; the PCR tube was kept always placed in the magnetic rack, the beads were air-dried for 2min with the cover open until no liquid remained, 25. Mu.L of BCR eluent was added, vortexed and oscillated, incubated for 5min at room temperature, the PCR tube was briefly centrifuged and placed in the magnetic rack to separate the beads and the BCR product, and 25. Mu.L of BCR product was collected, and the BCR quality was checked to be acceptable, as shown in FIG. 6B. And 1ul of the PCR amplified and purified product is taken for Qubit quantification, the concentration is more than 10 ng/. Mu.L, 15ng of the PCR amplified product is taken for detecting main peaks of BCR and TCR amplified fragments within 500-650 bp by using Qsep 1.

Step four: mixing TCR and BCR amplification products to build a library:

firstly, filling up the tail end of DNA, carrying out phosphorylation on the 5 'end and adding dA tail on the 3' end, taking 20 mu L of each of TCR and BCR amplification products, adding 15 mu L of a tail end repair reagent, adding 10 mu L of nuclease-free water, gently blowing and mixing by using a pipette, collecting reaction liquid to the bottom of a tube by short centrifugation, placing a PCR tube in a PCR instrument, running at 20 ℃ for 15 minutes, and cooling to 4 ℃ after running at 65 ℃ for 15 minutes to prepare a second product, and preparing a joint connection reaction system according to the proportion of the following table 7:

gently stirring and mixing by using a pipettor, briefly centrifuging to collect a reaction solution to the bottom of a tube, placing a PCR tube in a PCR instrument, operating at 20 ℃ for 15 minutes, then cooling to 4 ℃, sucking 60 mu L of DNA purified magnetic beads into 100 mu L of the product after the reaction is finished, performing vortex oscillation, incubating at room temperature for 5 minutes, briefly centrifuging the PCR tube, placing the PCR tube in a magnetic rack to separate the magnetic beads and the liquid, removing a supernatant after the solution is clarified, adding 200 mu L of freshly prepared 80% ethanol to rinse the magnetic beads, removing the supernatant, and repeatedly rinsing for one time;

keeping the PCR tube in a magnetic frame all the time, uncovering air, drying the magnetic beads for 3min until no ethanol remains, taking the PCR tube out of the magnetic frame, adding 22 mu L of non-nucleotidic enzyme water to cover the magnetic beads, blowing and mixing the magnetic beads by using a liquid-transferer, standing in the magnetic frame after incubating for 2min at room temperature, centrifuging and collecting the PCR tube briefly, separating the magnetic beads and the liquid until the solution is clear, sucking 20 mu L of purified products, adding 5 mu L of PCR mixed primers, adding 25 mu L of PCR amplification premix, lightly blowing and mixing by using the liquid-transferer, and then placing the PCR tube in a PCR instrument to operate the following procedure of table 8:

sucking 45 mu L of DNA purified magnetic beads to 50 mu L of the product after the reaction is finished, carrying out vortex oscillation, incubating for 5min at room temperature, briefly centrifuging a PCR tube, placing the PCR tube in a magnetic rack to separate the magnetic beads and liquid, removing supernatant after the solution is clarified, adding 200 mu L of freshly prepared 80% ethanol to rinse the magnetic beads, removing supernatant, and repeatedly rinsing once;

keeping the PCR tube in a magnetic frame all the time, uncovering air to dry the magnetic beads for 2min until no ethanol remains, taking the PCR tube out of the magnetic frame, adding 22 mu L of water without nuclease to cover the magnetic beads, blowing and mixing the magnetic beads by using a pipette, incubating for 2min at room temperature, centrifuging the PCR tube for a short time, collecting the PCR tube, placing the PCR tube in the magnetic frame, separating the magnetic beads and the liquid until the solution is clear, absorbing 20 mu L of purified products, controlling the library quality to be qualified, and sequencing by NGS.

The sequencing platform adopts a Huada T7 sequencing platform, a PE150 sequencing scheme is adopted, the original sequence result of NGS sequencing is shown in FIG. 7, the accuracy Q30 of a single sequencing segment is more than 85%, the direct reading of TCR sequences and BCR sequences can be realized without splicing, the data information such as clone diversity, CDR3 nucleic acid length distribution and the like of the TCR sequences and the BCR sequences can be accurately analyzed, and a reference basis is provided for subsequent clinical diagnosis and health screening.

Comparative example

The comparative example is substantially the same as the example, except that the third primer and the TCR primer and the BCR primer in the magnetic bead primer are different.

The sequence of the third primer in the comparative example is AGTGGTATCAACGCAGAGTACG (SEQ ID NO. 14);

the TCR primers were CGGCAGGGTCAGGGTTCTGG (SEQ ID NO. 15) and TGGACGTGTTCCCACAGCCT (SEQ ID NO. 16);

the sequences of the BCR primers were AGGATGTGACTGTGCCCTG (SEQ ID NO. 17), TACAAATGCGTGGTCCAGCA (SEQ ID NO. 18), AGACTGGGTCGACAACAAAACC (SEQ ID NO. 19), CCGGTGACGGTGTCGTGGAACTCA (SEQ ID NO. 20), GTGAGAATTCCCCGTCG (SEQ ID NO. 21), GACCTTGGGGCTGGTCGGGGAT (SEQ ID NO. 22), ACACATCCGGAGCCTTGGTGGGT (SEQ ID NO. 23), AGACGGATGGGCTCTGTGTGGA (SEQ ID NO. 24) and AGGGTTGGGGCGGATGCACTCC (SEQ ID NO. 25).

Comparative example the detection results of the TCR amplification products collected through step three are shown in figure 5 a, and the detection results of the BCR amplification products are shown in figure 6 a. As can be seen by comparing FIG. 5A with FIG. 5B, the non-target fragments of the examples are significantly lower than the comparative examples. As can be seen by comparing FIG. 6A with FIG. 6B, the non-target fragments of the examples are also significantly lower than the comparative examples.

Therefore, the PCR amplification is carried out by adopting the specific primer and the method adopting the magnetic bead primer, so that the amplification efficiency can be improved, the working efficiency can be improved, the labor cost can be saved, and the content of non-target fragments can be reduced. In addition, the method for constructing the library can adopt the existing commercialized reagent at home, thereby reducing the cost of the reagent.

The present invention has been described in detail with the purpose of enabling those skilled in the art to understand the contents of the present invention and to implement the same, but not to limit the scope of the present invention, and all equivalent changes or modifications made according to the spirit of the present invention should be included in the scope of the present invention.

Claims (7)

1. A method for constructing a repertoire for detecting T-cell and B-cell immunity, characterized by comprising the steps of: the method comprises the following steps:

(1) Extracting total RNA in a sample;

(2) Synthesizing full-length cDNA by taking the total RNA as a template;

(3) Performing PCR amplification on the full-length cDNA by using a magnetic bead primer, wherein the magnetic bead primer is a magnetic bead coupled with a TCR primer for amplifying TCR and a BCR primer for amplifying BCR, and the sequence of the TCR primer is from 5 'end to 3' end: ACTCTAAATCCAGTGAC and AAAACGTGTTCCCACCCAAG, the sequences of the BCR primers are CCTGGTCCAGGGCTTCTTCC, CAAAGGATAACAGCCCT, GGCCACGGGCTACTTCCC, CCGGTGACGGTGTCGTGGAACTCA, GTGAGAATTCCCCGTCG, TGTGCCTGCTGAATAAC and CTCATAAGTGACTTCTA; the PCR amplification in step (3) is also performed in the presence of a third primer, from 5 'end to 3' end, the third primer having a sequence of CCGTCTGATATGGCCCTTTATG;

(4) Eluting the system after the reaction in the step (3) by using a TCR eluent and a BCR eluent respectively to obtain a TCR amplification product and a BCR amplification product;

(5) Mixing the TCR amplification product and the BCR amplification product to build a library;

(6) Performing high-throughput sequencing on the library established in the step (5);

the TCR primer and the BCR primer in the magnetic bead primer are respectively coupled to the magnetic bead through biotin and streptavidin in a covalent way;

in the step (2), first, the total RNA is used as a template, and a first primer is used for synthesizing a first strand cDNA; then amplifying the first strand cDNA by using a second primer, a third primer and a fourth primer to obtain the full-length cDNA; wherein, from the 5 'end to the 3' end, the sequence of the first primer is TCGTTCATAGTTAATCTAGTTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN, and the VN represents 35T;

the sequence of the second primer is TCGTTCATAGTTAATCTAGT;

the sequence of the third primer is CCGTCTGATATGGCCCTTTATG;

the sequence of the fourth primer is AAGCCCGTCTGATATGGCCCTTTATGTGGG.

2. The pooling method for detecting T-cell and B-cell immune repertoires of claim 1, wherein: in the step (3), the reaction system for PCR amplification comprises X mu L of liquid containing the full-length cDNA, 25 mu L of high-fidelity enzyme premix, 2 mu L of third primer and (23-X) mu L of magnetic bead primer, wherein X is determined by the concentration of the full-length cDNA in the liquid containing the full-length cDNA, the mass of the full-length cDNA in the reaction system is controlled to be 10-45 ng, and the concentration of the liquid containing the full-length cDNA is more than or equal to 5 ng/. Mu.L.

3. The pooling method for detecting T-cell and B-cell immune repertoires of claim 2, wherein: in the step (3), the PCR amplification process is carried out at 94 ℃ for 1min;94 ℃ for 30s,63 ℃ for 30s and 72 ℃ for 1min, and 15-25 cycles are performed; 72 ℃ for 5min; constant temperature at 4 ℃.

4. The pooling method for detecting T-cell and B-cell immune repertoires of claim 1, wherein: the BCR eluent comprises a first buffer solution with pH of 7.5-8.5 and formamide accounting for 90-100% of the total mass of the first buffer solution; the first buffer solution comprises 5-15 mM Tris-HCl and 3-8 mM EDTA;

the pH of the TCR eluent is 8.5-9.5, and the TCR eluent comprises a second buffer solution with the pH of 8-9 and 25-35 mM sodium acetate; the second buffer solution comprises 10-20 mM Tris-HCl and 3-8 mM EDTA.

5. The method for pooling of T-cell and B-cell immune repertoires according to claim 1 or 4, wherein: the specific method of the step (4) is as follows: firstly, adding the TCR eluent into a system after the reaction in the step (3), carrying out vortex oscillation, incubation and centrifugation, separating magnetic beads from the TCR amplification products in a magnetic frame, and collecting the TCR amplification products; drying the magnetic beads until no liquid remains; and adding the BCR eluent, performing vortex oscillation, incubation and centrifugation, separating magnetic beads from the BCR amplification products in a magnetic rack, and collecting the BCR amplification products.

6. A primer for detecting T-cell and B-cell immune repertoires, characterized in that: the primers comprise a TCR primer, a BCR primer, a first primer, a second primer, a third primer and a fourth primer, wherein the sequence of the TCR primer is from 5 'end to 3' end: ACTCTAAATCCAGTGAC and AAAACGTGTTCCCACCCAAG are provided with a plurality of slots,

the sequences of the BCR primers are CCTGGTCCAGGGCTTCTTCC, CAAAGGATAACAGCCCT, GGCCACGGGCTACTTCCC, CCGGTGACGGTGTCGTGGAACTCA, GTGAGAATTCCCCGTCG, TGTGCCTGCTGAATAAC and CTCATAAGTGACTTCTA,

the sequence of the first primer is TCGTTCATAGTTAATCTAGTTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN, the VN represents 35T,

the sequence of the second primer is TCGTTCATAGTTAATCTAGT,

the sequence of the third primer is CCGTCTGATATGGCCCTTTATG;

the sequence of the fourth primer is AAGCCCGTCTGATATGGCCCTTTATGTGGG.

7. A kit for detecting T-cell and B-cell immune repertoires, characterized in that: the kit comprises a first primer, a second primer, a third primer, a fourth primer and a magnetic bead primer; the magnetic bead primer is a magnetic bead coupled with a TCR primer and a BCR primer; from 5 'end to 3' end, the sequence of the TCR primer: ACTCTAAATCCAGTGAC and AAAACGTGTTCCCACCCAAG are provided with a plurality of slots,

the sequences of the BCR primers are CCTGGTCCAGGGCTTCTTCC, CAAAGGATAACAGCCCT, GGCCACGGGCTACTTCCC, CCGGTGACGGTGTCGTGGAACTCA, GTGAGAATTCCCCGTCG, TGTGCCTGCTGAATAAC and CTCATAAGTGACTTCTA,

the sequence of the first primer is TCGTTCATAGTTAATCTAGTTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN, the VN represents 35T,

the sequence of the second primer is TCGTTCATAGTTAATCTAGT,

the sequence of the third primer is CCGTCTGATATGGCCCTTTATG,

the sequence of the fourth primer is AAGCCCGTCTGATATGGCCCTTTATGTGGG.