CN117070659A - SCAR molecular marker MSY01 closely linked with sex of kiwi fruit male strain and application thereof - Google Patents

Abstract

The invention relates to the technical field of molecular genetic breeding, in particular to a SCAR molecular marker MSY01 closely linked with the sex of kiwi fruit male plants and application thereof. The SCAR molecular marker MSY01 closely linked with the sex of the male kiwi fruit plant can be amplified only in the male kiwi fruit plant, the nucleotide sequence of the SCAR molecular marker is shown as SEQ ID NO. 1, and the molecular marker is positioned in a specific region (Male specific region of the Y-chromoname, MSY) of a Y chromosome of the male kiwi fruit plant and can be at least used for sex identification of Chinese kiwi fruits, delicious kiwi fruits, actinidia arguta and large-seed kiwi fruits.

Description

SCAR molecular marker MSY01 closely linked with sex of kiwi fruit male strain and application thereof

Technical Field

The invention relates to the technical field of molecular genetic breeding, in particular to a SCAR molecular marker MSY01 closely linked with the sex of kiwi fruit male plants and application thereof.

Background

Kiwi fruits are popular with consumers due to their unique flavor and nutritional health care value, and are an internationally important fruit category. With the improvement of the living standard of people, the market demand of the kiwi fruits is increased year by year, and higher requirements are put forward on the comprehensive quality and variety diversity of the kiwi fruits, so that the breeding efficiency of the kiwi fruits is urgently improved. The biggest factor restricting the hybridization breeding efficiency of the kiwi fruits is the hermaphroditic characteristic of the kiwi fruits, about half of male plants in the hybridization offspring groups are not fruiting, the male plants can be distinguished only after the childhood period is finished by the traditional method, so that a great amount of manpower, material resources, land resources and the like are wasted in the early stage, and therefore, the development of the early identification molecular marker for the kiwi fruit seedling gender, which is good in universality, high in accuracy, simple and stable to operate, has important application value for kiwi fruit breeding.

With the rapid development of molecular biology, breeding workers have developed some molecular markers for sex identification of kiwi fruits, but the markers have the problem of low identification accuracy or poor universality, so that the development of the molecular markers for sex identification of kiwi fruits with better universality and higher accuracy has important significance for kiwi fruit breeding.

Disclosure of Invention

The invention aims to protect a SCAR molecular marker MSY01 closely linked with the sex of a kiwi fruit male plant, wherein the molecular marker can be amplified only in the male plant, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1.

The molecular marker is a SCAR marker, can directly amplify plant DNA, intuitively analyze the sex of plants according to the existence of amplified bands, is simple and quick to operate, has good stability of experimental results and low cost, and can be at least identified in the offspring of Chinese goosebeery, delicious kiwi fruit, actinidia arguta, large-seed kiwi fruit and Chinese and delicious kiwi fruit groups, so that the universality is good; the marker is positioned in a specific region (Male specific region of the Y-chromosome, MSY) of a conserved male strain Y chromosome of kiwi fruits, and the identification accuracy is high.

The second purpose of the invention is to protect a primer, wherein the primer is used for amplifying the SCAR molecular marker MSY01 closely linked with the sex of the kiwi fruit male strain.

Further preferably, the forward primer sequence of the primer is shown as SEQ ID NO. 2, and the reverse primer sequence is shown as SEQ ID NO. 3.

The invention also aims to protect a kit for identifying male and female kiwi fruit strains, which comprises the primer.

The fourth purpose of the invention is to protect the application of the molecular marker MSY01 in the identification of male and female kiwi fruit strains.

The fifth purpose of the invention is to protect the application of the primer in the identification of the male and female kiwi fruit strains.

The sixth purpose of the invention is to protect the application of the kit in the identification of the male and female kiwi fruit plants.

The invention aims at protecting a method for identifying male and female kiwi fruit plants, which comprises the following steps:

(1) Extracting genome DNA of a sample to be detected;

(2) PCR amplification is carried out by using the primer or the kit;

(3) Gel electrophoresis detection, wherein the amplified bands are male strains, and the non-amplified bands are female strains.

Drawings

FIG. 1 shows the result of polypropylene gel electrophoresis of the first verification experiment in example 2;

FIG. 2 shows the result of polypropylene gel electrophoresis of the second verification experiment in example 2;

FIG. 3 shows the result of polypropylene gel electrophoresis of the verification experiment III in example 2.

Detailed Description

The present invention will be described in further detail with reference to specific examples so as to more clearly understand the present invention by those skilled in the art.

The following examples are given for illustration of the invention only and are not intended to limit the scope of the invention. All other embodiments obtained by those skilled in the art without creative efforts are within the protection scope of the present invention based on the specific embodiments of the present invention.

The reagents used in the examples of the present invention are all commercially available, without specific explanation. The experimental procedure, which does not address the specific conditions in the examples below, is generally followed by conventional conditions, such as molecular cloning, as described in Sambrook et al: conditions described in the laboratory Manual (New York: coldSpring Harbor Laboratory Press, 1989) or as recommended by the manufacturer.

Example 1 molecular markers obtained and use

Recently, researchers have further revealed the sex chromosome evolution process of kiwi fruits, and after the genome of four kiwi fruit staminates (Chinese kiwi fruit ) is assembled, each species is found to contain a 1.1-2.7 Mb staminate specific MSY region located at different positions of the genome, and the positions of MSY in different populations are different. Based on the above, the invention performs sequence alignment analysis on the MSY region so as to develop sex early identification molecular markers with higher accuracy and more stability and universality.

Analyzing the sequence of the MSY region sharing gene YFT in four kiwi fruit male plants, comparing the sequence with the genome sequence of a female plant, separating the special sequence of the male plant, designing amplification primers, and performing amplification verification in the female and male plants of different species of kiwi fruits to obtain a SCAR molecular marker MSY01 closely linked with the sex of the kiwi fruit male plants, wherein the nucleotide sequence of the marker is shown as SEQ ID NO. 1, and the primer sequence is shown as SEQ ID NO. 2-3.

SCAR molecular marker MSY01 (SEQ ID NO: 1): GTTATTCGATGTTTGTACT AGTAAGGCACACTAAAATTCTAATTATAATGTGCTATTTAGATAAAAATAAATAAATAATAGGTACACATGGAGAAGGTGCAGAAAAACAATTGTGTCATTGCTATGTTTGCTTTTCTATGTTTGGTTTCTGTGTATAGAAATGCGGATCTTATGTAGGGTAGATGAAGTGTGACCATGTAATGTGGGGTCTAATTTAT AATTATTACAATAAAATAAATGAAAATTTAGTAGTTTATATCCTAATTGTCATGCATAATCTTTACTTGGGTCTTCAAAACAAACTCTTGGCAGATCATCCAAATGCATGCTCTGCAATCAAACTCTTGTTCTCTTTCAGGGATACC.

MSY01-F(SEQ ID NO:2):GTTATTCGATGTTTGTACTA。

MSY01-R(SEQ ID NO:3):GGTATCCCTGAAAGAGAACAAGA。

The molecular marker MSY01 is used for identifying male and female kiwi fruit strains, and the method comprises the following steps:

(1) Extracting leaf DNA of a seedling to be detected;

(2) Performing PCR amplification on the obtained DNA by using the primer pair;

(3) Gel electrophoresis is carried out by adding 1% agarose into TAE buffer solution, the sample injection amount of the amplified product is 5 mu L, gel staining is carried out by GelRed, and the appearance of the specific amplified product is observed;

(4) Can amplify out the target strip, then wait to detect the sample and come from male strain kiwi fruit seedling, if there is not the target strip, then wait to detect the sample and come from female strain kiwi fruit seedling.

Wherein, in the step (1), a polysaccharide polyphenol plant DNA extraction kit (Aidelai, china) can be adopted to extract genome DNA, agarose gel electrophoresis and a Nanodrop spectrophotometer are used for detecting the quality and the concentration of the DNA, and the concentration of the DNA is diluted to 50 ng/mu L for standby;

the PCR amplification system in the step (2) is specifically as follows: the total volume of the reaction components was 20. Mu.L, containing 10. Mu.L of Taq enzyme Mix, L. Mu.L of template DNA, labeled primers each 0.50. Mu.M, and ddH added ₂ O to final volume, the gradient thermal cycle gene amplification instrument carries out amplification, and the reaction conditions are as follows: initial denaturation at 95℃for 3 min; denaturation at 95℃for 15 sec; annealing at 52 ℃ for 15 seconds; extension at 72℃for 25 seconds, 35 cycles, and finally extension at 72℃for 5 minutes.

Example 2 verification of molecular markers

(1) Verification experiment I (verification of Kiwi berry different species)

10 Chinese goosebeery, delicious Chinese goosebeery, actinidia arguta and large-seed actinidia chinensis stamen in a national actinidia chinensis germplasm resource nursery (Wuhan) are selected, 10 Chinese goosebeery stamen are selected in total, 10 Chinese actinidia chinensis stamen are selected in total (the following table 1), wherein the sample numbers of the stamen are respectively M1-M10, the sample numbers of the female stamen are respectively F1-F10, young leaves of spring tips are collected and immediately placed in liquid nitrogen for standby, then detection is carried out according to the method described in the embodiment 1, the statistical result is shown in the table 1, and the electrophoresis result is shown in fig. 1:

table 1 verifies the Male and female actinidia materials and amplification results involved in experiment one

Sample numbering	Sample name	Seed name	Sex (sex)	Whether or not the strip is provided with
					M1	202091M	Chinese goosebeery A. Chinese goosebeery	Male male	+
M2	Mount grinding male	Chinese goosebeery A. Chinese goosebeery	Male male	+
					M3	1-1-9-1	Chinese goosebeery A. Chinese goosebeery	Male male	+
M4	3-4-13-2	Deliciosa of kiwi fruit	Male male	+
					M5	A19	Deliciosa of kiwi fruit	Male male	+
M6	N210	Deliciosa of kiwi fruit	Male male	+
					M7	Hua Texiong	Actinidia arguta A. Eriantha	Male male	+
M8	MH115	Actinidia arguta A. Eriantha	Male male	+
					M9	MH017	Actinidia arguta A. Eriantha	Male male	+
M10	Big seed male	Macroseed kiwi A. Macrosperma	Male male	+
					F1	Hort 16A	Chinese goosebeery A. Chinese goosebeery	Female	-
F2	Jin Tao	Chinese goosebeery A. Chinese goosebeery	Female	-
					F3	Red sun	Chinese goosebeery A. Chinese goosebeery	Female	-
F4	Miliang No. 1	Deliciosa of kiwi fruit	Female	-
					F5	R27	Deliciosa of kiwi fruit	Female	-
F6	Jin Kui	Deliciosa of kiwi fruit	Female	-
					F7	Huate female	Actinidia arguta A. Eriantha	Female	-
F8	MH106	Actinidia arguta A. Eriantha	Female	-
					F9	MH398	Actinidia arguta A. Eriantha	Female	-
F10	Big seed female	Macroseed kiwi A. Macrosperma	Female	-

Wherein "+" indicates the presence and "-" indicates the absence.

As can be seen from Table 1 and FIG. 1, 10 male samples gave a brighter amplified band, the specific band fragment size was 365bp, and none of 10 female samples gave amplified bands.

(2) Verification experiment II (verification of Chinese real population single plant sample)

12 male and female strains in the 'Jinyi' real population of Chinese goosebeery of Shenshanxing agriculture technology limited company in Chiku wall city are selected, young leaves of spring tips are collected and immediately placed in liquid nitrogen for standby, detection is carried out according to the method described in example 1, the statistical result is shown in table 2, and the electrophoresis result is shown in fig. 2:

table 2 verifies the male and female kiwi fruit materials and amplification results involved in experiment two

Wherein "+" indicates the presence and "-" indicates the absence.

As can be seen from Table 2 and FIG. 2, a brighter amplified band was obtained for each of the 12 male samples, the specific band fragment size was 365bp, and none of the 12 female samples was amplified.

(3) Verification experiment III (verification of delicious hybrid group individual sample)

12 male and female strains of delicious kiwi fruits 'Jinkui' and 'Tomuri' in hybrid groups of Shenshanxing farmer science and technology limited company in Chikui city are selected, young leaves of spring tips are collected and immediately placed in liquid nitrogen for standby, detection is carried out according to the method described in example 1, statistical results are shown in table 3, and electrophoresis results are shown in fig. 3:

table 3 verifies the male and female kiwi fruit materials and amplification results involved in experiment three

Wherein "+" indicates the presence and "-" indicates the absence.

As can be seen from Table 3 and FIG. 3, a brighter amplified band was obtained for each of the 12 male samples, the specific band fragment size was 365bp, and none of the 12 female samples was amplified.

In conclusion, the SCAR molecular marker MSY01 provided by the invention can directly amplify plant DNA, intuitively analyze the sex of plants according to the existence of amplified bands, is simple and convenient to operate, is quick, has good experimental result stability, can be at least used for identifying the sex in Chinese goosebeery, delicious kiwi fruit, actinidia arguta and large-seed kiwi fruit, can also accurately identify the sex in the middle Hua Mihou kiwi fruit and the offspring of the delicious kiwi fruit, and is derived from a MSY region conserved by the male strain of the kiwi fruit, and has extremely high identification accuracy, and 100% of the sex in the research.

It should be noted that the above examples are only for further illustrating and describing the technical solution of the present invention, and are not intended to limit the technical solution of the present invention, and the method of the present invention is only a preferred embodiment and is not intended to limit the scope of the present invention. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims (8)

1. The SCAR molecular marker MSY01 closely linked with the sex of the male strain of the kiwi fruit is characterized in that the molecular marker can be amplified only in the male strain, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1.

2. A primer, which is used for amplifying the SCAR molecular marker MSY01 closely linked with the sex of the male kiwi fruit strain according to claim 1.

3. The primer of claim 1, wherein the forward primer sequence of the primer is shown in SEQ ID NO. 2 and the reverse primer sequence is shown in SEQ ID NO. 3.

4. A kit for identifying male and female kiwi fruit plants, comprising the primer of claim 2 or 3.

5. The use of the molecular marker MSY01 in the identification of male and female kiwi fruit strains according to claim 1.

6. Use of the primer according to any one of claims 2 to 3 for the identification of male and female kiwi fruit plants.

7. The use of the kit of claim 4 in the identification of male and female kiwi fruit strains.

8. A method for identifying male and female kiwi fruit plants, which is characterized by comprising the following steps:

(1) Extracting genome DNA of a sample to be detected;

(2) Performing PCR amplification using the primer of claim 2 or 3 or the kit of claim 4;

(3) Gel electrophoresis detection, wherein the amplified bands are male strains, and the non-amplified bands are female strains.