CN117051148A - Molecular marker for identifying late-maturing navel orange WS22 and application thereof - Google Patents
Molecular marker for identifying late-maturing navel orange WS22 and application thereof Download PDFInfo
- Publication number
- CN117051148A CN117051148A CN202310918355.8A CN202310918355A CN117051148A CN 117051148 A CN117051148 A CN 117051148A CN 202310918355 A CN202310918355 A CN 202310918355A CN 117051148 A CN117051148 A CN 117051148A
- Authority
- CN
- China
- Prior art keywords
- navel orange
- cschr4
- molecular marker
- maturing
- late
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 240000002319 Citrus sinensis Species 0.000 title claims abstract description 106
- 235000005976 Citrus sinensis Nutrition 0.000 title claims abstract description 106
- 239000003147 molecular marker Substances 0.000 title claims abstract description 44
- 210000000349 chromosome Anatomy 0.000 claims abstract description 28
- 238000012217 deletion Methods 0.000 claims abstract description 5
- 230000037430 deletion Effects 0.000 claims abstract description 5
- 239000002773 nucleotide Substances 0.000 claims abstract description 5
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 5
- 238000000034 method Methods 0.000 claims description 14
- 230000003321 amplification Effects 0.000 claims description 6
- 238000001962 electrophoresis Methods 0.000 claims description 6
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 6
- 238000010586 diagram Methods 0.000 claims description 5
- 238000012408 PCR amplification Methods 0.000 claims description 4
- 238000009395 breeding Methods 0.000 claims description 4
- 230000001488 breeding effect Effects 0.000 claims description 4
- 238000012216 screening Methods 0.000 claims description 2
- 108020004414 DNA Proteins 0.000 description 18
- 239000000463 material Substances 0.000 description 9
- 241000207199 Citrus Species 0.000 description 6
- 235000020971 citrus fruits Nutrition 0.000 description 6
- 230000035772 mutation Effects 0.000 description 5
- 238000004925 denaturation Methods 0.000 description 4
- 230000036425 denaturation Effects 0.000 description 4
- 235000013399 edible fruits Nutrition 0.000 description 4
- 239000012634 fragment Substances 0.000 description 4
- 239000000499 gel Substances 0.000 description 4
- 238000001502 gel electrophoresis Methods 0.000 description 4
- 239000000203 mixture Substances 0.000 description 4
- 238000011144 upstream manufacturing Methods 0.000 description 4
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 3
- 238000004458 analytical method Methods 0.000 description 3
- 229920000936 Agarose Polymers 0.000 description 2
- 238000000137 annealing Methods 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 238000001514 detection method Methods 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 239000012154 double-distilled water Substances 0.000 description 2
- 238000003384 imaging method Methods 0.000 description 2
- 238000003780 insertion Methods 0.000 description 2
- 230000037431 insertion Effects 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000012163 sequencing technique Methods 0.000 description 2
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 238000000246 agarose gel electrophoresis Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000003766 bioinformatics method Methods 0.000 description 1
- 210000001726 chromosome structure Anatomy 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 230000035800 maturation Effects 0.000 description 1
- 230000000877 morphologic effect Effects 0.000 description 1
- 239000002420 orchard Substances 0.000 description 1
- 238000003976 plant breeding Methods 0.000 description 1
- 229940108461 rennet Drugs 0.000 description 1
- 108010058314 rennet Proteins 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a molecular marker for identifying a late-maturing navel orange germplasm WS22 and application thereof, wherein the molecular marker is named CsChr4-WS22, a nucleotide sequence is shown as SEQ ID NO.1 and is positioned on a Chr4 chromosome of the navel orange, wherein a 5095156-6757953 sequence of the Chr4 chromosome is deleted, and a DNA transposon is inserted at a breakpoint position of the deletion; the primer pair for amplifying the molecular marker Cschr4-WS22 is also disclosed as Cschr4-WS22-F and Cschr4-WS22-R, and is convenient for rapid identification of late maturing navel orange seedlings WS22.
Description
Technical Field
The invention relates to a molecular marker for identifying late-maturing navel orange WS22 and application thereof, belonging to the technical field of plant breeding.
Background
Citrus occupies an absolute dominant position in the fruit industry in China and is an important support for economy in the southern hilly and mountain areas in China. Too concentrated citrus maturation is an important problem to be solved by the citrus industry development. According to statistics, the medium-maturing varieties of early, medium and late maturing varieties of oranges are large, and centralized marketing causes saturation of fresh and sold market of oranges in a short period, impacts market price and seriously affects economic benefit.
The breeding of early and late maturing citrus is an important way to solve the problem. The navel orange germplasm WS22 is a late-maturing navel orange germplasm bred by bud mutation from a main cultivated navel orange variety 'Lunbue', the late-maturing navel orange WS22 and Lunbue have obvious differences in fruit morphology from 'Lunbue', and the mature fruit color is not changed into orange red, but into orange yellow. The late-maturing navel orange WS22 fruit has obvious late-maturing property, and the time for reaching the same appearance color and internal quality level is more than 110 days later than that of the main cultivated navel orange variety 'Neoher' in the Gannan region, thus having good market application value. However, due to the long childhood period of citrus, the difficulty exists in morphological identification of the variety of late-maturing navel orange WS22 in childhood.
Disclosure of Invention
The invention aims to overcome the defects in the prior art, and provides a molecular marker for identifying the late-maturing navel orange WS22 and application thereof, which are convenient for identifying the seedlings of the late-maturing navel orange WS22.
In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:
in a first aspect, the invention provides a molecular marker for identifying late-maturing navel orange WS22, wherein the molecular marker is named Cschr4-WS22, the nucleotide sequence is shown as SEQ ID NO.1 and is positioned on a Chr4 chromosome of navel orange, the 5095156-6757953 sequence of the Chr4 chromosome is deleted, and a DNA transposon is inserted at the breakpoint position of the deletion.
With reference to the first aspect, further, the primer pair for amplifying the molecular marker CsChr4-WS22 is CsChr4-WS22-F and CsChr4-WS22-R; one primer of the primer pair is positioned on the chromosome of the navel orange Chr4, and the other primer is positioned on the inserted DNA transposon
Further, the sequence of Cschr4-WS22-F is shown in SEQ ID NO.2, and the sequence of Cschr4-WS22-R is shown in SEQ ID NO. 3.
In a second aspect, the invention provides a kit comprising a primer pair for amplification of the molecular marker Cschr4-WS22 as described in any one of the above.
In a third aspect, the invention provides a method for identifying late-maturing navel orange WS22, comprising the step of amplifying navel orange genomic DNA by detecting primer pairs of molecular markers Cschr4-WS22.
With reference to the third aspect, further, the method includes the steps of:
extracting genome DNA from navel orange products;
respectively carrying out PCR amplification on the extracted genome DNA by using a primer pair of a molecular marker Cschr4-WS22 to obtain an amplification product;
respectively carrying out electrophoresis on the amplified products to obtain an electrophoresis gel diagram;
and screening out the target navel orange according to the pattern of the electrophoresis gel.
Further, any one of the molecular markers, the method or the kit is applied to breeding of late-maturing navel orange WS22 germplasm.
Compared with the prior art, the invention has the beneficial effects that:
the invention provides a chromosome fragment site on a Chr4 chromosome of a late-maturing navel orange WS22, and a dominant molecular marker Cschr4-WS22 detected by the late-maturing navel orange WS22 is developed based on the site, so that whether navel orange seedlings or other propagation materials are the late-maturing navel orange WS22 or not can be identified, and the effect is obvious and quick;
the primer pair of the molecular marker Cschr4-WS22 for detecting the late-maturing navel orange WS22 is also provided, and is convenient for rapidly identifying seedlings of the late-maturing navel orange WS22.
Drawings
FIG. 1 is a schematic diagram showing the difference between the chromosome sequence of the Chr4 of the late-maturing navel orange WS22 and the chromosome sequence of the Chr4 of the 'New-HEL' navel orange provided by the embodiment of the invention;
FIG. 2 is a gel electrophoresis chart of detection of late-maturing navel orange WS22 and Lun-late navel orange by using molecular marker Cschr4-WS22 provided by the embodiment of the invention;
fig. 3 is a gel electrophoresis chart of molecular markers Cschr4-WS22 for detecting late-maturing navel orange WS22 and other main cultured navel orange varieties in Gannan region provided by the embodiment of the invention.
Detailed Description
The invention is further described below with reference to the accompanying drawings. The following examples are only for more clearly illustrating the technical aspects of the present invention, and are not intended to limit the scope of the present invention.
The invention provides a difference site of a Chur 4 chromosome of late-maturing navel orange WS22 and a bud variation source 'Newhol' navel orange thereof, and provides a molecular marker CsChur 4-WS22 for detecting the late-maturing navel orange WS22 and a primer pair thereof.
The invention adopts the technical scheme that: the difference site of the late-maturing navel orange WS22 and the 'Lun-late' navel orange from which the bud mutation is derived is located on the chromosome of the Chr4, and the reference genome sequence (the chromosome sequence of the sweet orange Chr 4) is found in NCBI database (GenBank: CM 030743.1). One of the Chr4 chromosome sequences 5095156-6757953 of the late-maturing navel orange WS22 is deleted, and one of the DNA transposons is inserted at the breakpoint of the deletion. Based on the chromosome structural variation, a molecular marker Cschr4-WS22 closely linked with the difference site is developed, and the molecular marker Cschr4-WS22 is positioned on a Chr4 chromosome, and the sequence is shown as SEQ ID NO. 1.
The invention designs a primer pair corresponding to a late-maturing navel orange WS22 identification molecular marker CsChr4-WS22, wherein the upstream primer sequence of CsChr4-WS22 is CsChr4-WS22-F, and the nucleotide sequence of the primer pair is shown as SEQ ID NO. 2; the downstream primer sequence is Cschr4-WS22-R, and the nucleotide sequence is shown in SEQ ID NO. 3.
The method for detecting the late-maturing navel orange WS22 by using the molecular marker or the primer comprises the following steps: the primer pair of the molecular marker Cschr4-WS22 is used for amplifying the genome DNA of the navel orange, and after 1% agarose gel electrophoresis of the amplified product, if the amplified fragment corresponding to the variation in the late-maturing navel orange WS22 is obtained, the amplified fragment is indicated to be late-maturing navel orange WS22 germplasm. If the amplified fragment corresponding to the variation in the late-maturing navel orange WS22 is not obtained, the specific variation position contained in the late-maturing navel orange WS22 is not present, and the nursery stock is not predicted to be the late-maturing navel orange WS22.
Specifically, the molecular marker Cschr4-WS22 detected by the late-maturing navel orange WS22 disclosed by the invention is selected by the following steps:
(1) In the process of continuously bud mutation seed selection of navel oranges for many years, a late-maturing bud mutation is found in an orchard, and the late-maturing navel orange germplasm WS22 is obtained through breeding for many years.
(2) By utilizing a resequencing technology to analyze, the sequence difference of 'Newhol', 'Lunbue' and bud variant late maturing navel orange WS22 is identified, a Chr4 chromosome 5095156-6757953 sequence of the late maturing navel orange WS22 is deleted, and a DNA transposon is inserted at the position of the deleted breakpoint.
(3) Based on the sequence difference found above, a molecular marker Cschr4-WS22 for detecting late-maturing navel orange WS22 is developed, one amplification primer of the molecular marker Cschr4-WS22 is positioned on a chromosome of Chr4, and the other primer is positioned on an inserted transposon sequence, so that the specificity of the sequence is ensured.
Embodiment one:
in this example, the identification of the differential sites and the development of the molecular markers were performed as follows.
(1) Identification of the differential sites
Samples of the 'newhol', 'rennet' and germ plasm late maturing navel orange WS22 materials used were identified from national navel orange engineering research center nursery, and three biological replicates were selected for different sample materials. The DNA of navel orange leaves was extracted by CTAB method, and then the DNA was pooled and subjected to second generation sequencing at a depth of 30X.
The invention takes the sweet orange genome as a reference (http:// citrus. Hzau. Edu. Cn), and analyzes sequencing data on a Linux server. By alignment, the 5095156-6757953 sequence of one of the Chr4 chromosomes of WS22 navel orange was found to be deleted.
(2) Differential site sequence clone analysis
In order to further define the sequence variation characteristics, primers are designed according to sequences in front of 5095156 locus and behind 6757953 locus of a reference genome Chr4 chromosome, late-maturing navel orange WS22 and 'Lunlate' navel orange DNA are taken as templates, sequences at variation positions are cloned, and as a result, it is found that the 'Lunlate' navel orange can not clone corresponding sequences, the late-maturing navel orange WS22 can clone corresponding sequences, and bioinformatics analysis shows that the deletion locus has an insertion sequence and is a 6927bp DNA transposon. As shown in FIG. 1, the difference between the chromosome sequence of the Chr4 of the late-maturing navel orange WS22 and the chromosome sequence of the Chr4 of the 'Lun-late' navel orange is schematically shown.
(3) Molecular marker design
Based on the variation of chromosome structure, a molecular marker Cschr4-WS22 was designed. According to the characteristics of the insertion sequence, as shown in fig. 1, the upper half of fig. 1 shows a schematic diagram of the chromosome sequence of the Chr4 of the 'new york' navel orange, and the lower half of fig. 1 shows a schematic diagram of the chromosome sequence of the Chr4 of the late-maturing navel orange WS22. The molecular marker primer pair designed by the invention is Cschr4-WS22-F and Cschr4-WS22-R, one amplification primer is positioned on the chromosome of navel orange Chr4, and the other primer is positioned on the inserted transposon sequence. Specifically, the upstream primer CsChr4-WS22-F is located on the inserted transposon and the downstream primer CsChr4-WS22-R is located on the Chr4 chromosome. Wherein the sequence of Cschr4-WS22-F is shown in SEQ ID NO.2, and the sequence of Cschr4-WS22-R is shown in SEQ ID NO. 3.
(4) Molecular marker identification of late-maturing navel orange WS22 and 'Lunbu' navel orange material
The CTAB method is adopted to extract the leaf DNA of WS22 late maturing navel orange and 'Lunbu' navel orange materials, and other propagation materials can be selected for molecular marker identification of WS22 and 'Lunbu' navel orange materials.
The extracted leaf DNA was amplified, and the PCR reaction system (10. Mu.l) contained 0.5. Mu.l of the DNA template, 0.25. Mu.l of each of the upstream and downstream primers (1 mmol/L), 5. Mu.l of Mix, and 4. Mu.l of ddH2O.
PCR reaction procedure: denaturation at 95℃for 5min; followed by 32 cycles of denaturation at 95℃for 30s, annealing at Tm (57.5 ℃) for 30s and elongation at 72℃for 30s; then extending for 5min at 72 ℃; finally, the mixture is preserved at 10 ℃.
The PCR amplification products of the invention were run on 1% agarose, and the films were scanned and analyzed in a ChemiScope imaging system.
(5) Results and analysis
The molecular marker Cschr4-WS22 can distinguish the late-maturing navel orange WS22 from the 'Lun-late' navel orange of which the bud mutation source is. In the identified gel, cschr4-WS22 was linearly labeled with two bands, 285bp in size and no band, respectively. WS22 late-maturing navel orange possessing 285bp band, and 'Lunqian' navel orange without band.
As shown in FIG. 2, the molecular marker Cschr4-WS22 provided by the invention is used for detecting a gel electrophoresis chart of WS22 navel orange and 'Lun-evening' navel orange; wherein M is DL-2000marker,1-3 channels are Cschr4-WS22 for detecting WS22 navel orange banding pattern, and 4-6 channels are Cschr4-WS22 for detecting 'Lun late' navel orange banding pattern;
embodiment two:
in this example, molecular markers Cschr4-WS22 were used to identify late-maturing navel orange WS22 and other navel orange germplasm.
(1) Molecular markers detected WS22 and other navel orange germplasm.
The CTAB method is adopted to extract the leaf DNA of WS22 and other domestic main navel orange materials, and is used for molecular marker identification of late-maturing navel orange WS22 and other domestic navel orange materials.
The extracted DNA was subjected to PCR amplification by a specific PCR reaction system (10. Mu.l) containing 0.5. Mu.l of the DNA template, 0.25. Mu.l of each of the upstream and downstream primers (1 mmol/L), 5. Mu.l of Mix, and 4. Mu.l of ddH2O.
PCR reaction procedure: denaturation at 95℃for 5min; followed by 32 cycles of denaturation at 95℃for 30s, annealing at Tm (57.5 ℃) for 30s and elongation at 72℃for 30s; then extending for 5min at 72 ℃; finally, the mixture is preserved at 10 ℃.
The PCR amplified products were electrophoresed on 1% agarose. Film was scanned and analyzed in a ChemiScope imaging system.
(2) Results and analysis.
The molecular marker Cschr4-WS22 can distinguish late-maturing navel orange WS22 from other domestic navel orange germplasm. In the identified gel, cschr4-WS22 was linearly labeled with two bands, 285bp in size and no band, respectively. WS22 navel orange possessing 285bp band, other navel orange germplasm are all without band.
As shown in FIG. 3, the molecular marker Cschr4-WS22 provided by the invention detects 'WS22' and gel electrophoresis patterns of other navel orange varieties in Gannan region; wherein M is DL-2000marker,1-2 channels are Cschr4-WS22 to detect WS22 late maturing navel orange banding patterns, and 3-24 channels are Cschr4-WS22 to detect other navel orange banding patterns.
The foregoing is merely a preferred embodiment of the present invention, and it should be noted that modifications and variations could be made by those skilled in the art without departing from the technical principles of the present invention, and such modifications and variations should also be regarded as being within the scope of the invention.
The molecular marker Cschr4-WS22 or the primer pair, the kit and the method steps for detecting the late-maturing navel orange WS22 can be applied to detection of the late-maturing navel orange WS22.
The DNA sequence related to the invention is as follows:
SEQ ID NO.1
CGTTGCTTGGTGTGAAATGCATGAGTGAGAGTGATGCATGCGTGAGATGAGATGCGCGTGCAGT
GTGTTTGCTTGTTCAAACAGTGCCCTTTTATATTACAAATAAAACGCACCGTTCGGGACTTACTG
TGGTGCTTATTGTGGGCTGAATATCGGTGTTGTTCTTATAAACACAAACCAATAGAACAGAAAG
AGGAGACCACTATATATTAATTTTTATTGGTCCCTACGCGTCTCCACTAATAAAAATGACAAGTT
CAAAGATCAATGAAAAGGACTGGCAAA
SEQ ID NO.2
CGTTGCTTGGTGTGAAATG
SEQ ID NO.3
TTTGCCAGTCCTTTTCATTG。
Claims (7)
1. the molecular marker for identifying the late-maturing navel orange WS22 is characterized in that the molecular marker is named Cschr4-WS22, the nucleotide sequence is shown as SEQ ID NO.1 and is positioned on a navel orange Chr4 chromosome, the 5095156-6757953 sequence of the Chr4 chromosome is deleted, and a DNA transposon is inserted at the breakpoint position of the deletion.
2. The molecular marker of claim 1, wherein the primer pair for amplifying the molecular marker Cschr4-WS22 is Cschr4-WS22-F and Cschr4-WS22-R; one primer of the primer pair is positioned on the chromosome of the navel orange Chr4, and the other primer is positioned on the inserted DNA transposon.
3. The molecular marker according to claim 2, wherein the sequence of Cschr4-WS22-F is shown in SEQ ID NO.2, and the sequence of Cschr4-WS22-R is shown in SEQ ID NO. 3.
4. A kit comprising a primer pair for amplification of the molecular marker CsChr4-WS22 of any one of claims 2-3.
5. A method for identifying late-maturing navel orange WS22, comprising the step of amplifying genomic DNA of navel orange by detecting primer pair of molecular marker CsChr4-WS22 according to claim 2.
6. The method according to claim 5, comprising the steps of:
extracting genome DNA from navel orange products;
respectively carrying out PCR amplification on the extracted genome DNA by using a primer pair of a molecular marker Cschr4-WS22 to obtain an amplification product;
respectively carrying out electrophoresis on the amplified products to obtain an electrophoresis gel diagram;
and screening out the target navel orange according to the pattern of the electrophoresis gel.
7. Use of a molecular marker according to any one of claims 1-3, or a method according to any one of claims 5-6, or a kit according to claim 4, for breeding late-maturing navel orange WS22 germplasm.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310918355.8A CN117051148B (en) | 2023-07-25 | 2023-07-25 | Molecular marker for identifying late-maturing navel orange WS22 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310918355.8A CN117051148B (en) | 2023-07-25 | 2023-07-25 | Molecular marker for identifying late-maturing navel orange WS22 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN117051148A true CN117051148A (en) | 2023-11-14 |
| CN117051148B CN117051148B (en) | 2024-10-18 |
Family
ID=88661624
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310918355.8A Active CN117051148B (en) | 2023-07-25 | 2023-07-25 | Molecular marker for identifying late-maturing navel orange WS22 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117051148B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108754014A (en) * | 2018-06-25 | 2018-11-06 | 华中农业大学 | Differentiate the molecular labeling of navel orange and its differentiates method, application and the kit of navel orange |
| CN115976257A (en) * | 2022-10-20 | 2023-04-18 | 华中农业大学 | KASP molecular marker for identifying zongzi and application thereof |
| CN116042905A (en) * | 2023-03-10 | 2023-05-02 | 湖北省农业科学院果树茶叶研究所 | SV (space velocity) marker for identifying citrus varieties and application thereof |
-
2023
- 2023-07-25 CN CN202310918355.8A patent/CN117051148B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108754014A (en) * | 2018-06-25 | 2018-11-06 | 华中农业大学 | Differentiate the molecular labeling of navel orange and its differentiates method, application and the kit of navel orange |
| CN115976257A (en) * | 2022-10-20 | 2023-04-18 | 华中农业大学 | KASP molecular marker for identifying zongzi and application thereof |
| CN116042905A (en) * | 2023-03-10 | 2023-05-02 | 湖北省农业科学院果树茶叶研究所 | SV (space velocity) marker for identifying citrus varieties and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| X SUN 等: "A new strategy employed for identification of sweet orange cultivars with RAPD markers", GENET MOL RES ., vol. 11, no. 3, 6 August 2012 (2012-08-06), pages 2071 - 2080 * |
| 韦杰: "柑橘反转录转座子基因的特征分析及其相关分子标记的开发", 中国博士学位论文全文数据库农业科技辑, no. 06, 15 September 2008 (2008-09-15), pages 048 - 17 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN117051148B (en) | 2024-10-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106755481B (en) | SSR molecular marker VI for identifying progeny plants of Gala apples and application thereof | |
| CN108660246B (en) | InDel molecular markers of Ma (Citrus paradisi) pomelos and application of InDel molecular markers in early-stage differentiation of rough-peel Ma pomelos of citrus varieties | |
| CN108004330B (en) | Molecular marker for identifying maple leaf ducks and application thereof | |
| CN112961931B (en) | Rapid identification method for purity of Yongtian No.5 melon seeds | |
| CN113046467B (en) | SNP locus obviously associated with wheat stripe rust resistance and application thereof in genetic breeding | |
| CN117051148B (en) | Molecular marker for identifying late-maturing navel orange WS22 and application thereof | |
| CN112094921A (en) | Molecular marker for identifying silky fowl and bamboo silky fowl and application thereof | |
| CN116240207A (en) | Primer group for identifying Sanhua plums and early plums and application thereof | |
| CN114752702B (en) | Molecular marker BnCa-2C2 closely linked with rape calcium content trait QTL and application thereof | |
| CN115058522A (en) | Molecular marker for identifying broiler varieties containing white rocco blood sources and application | |
| CN112159861B (en) | SNP marker linked with cucumber watermelon mosaic virus resistant gene wmv, kit and method thereof | |
| CN111235305B (en) | SNP molecular markers related to lead transport coefficient of corn plants and application thereof | |
| CN116769953B (en) | Molecular marker for identifying Gannan early navel orange and application thereof | |
| CN116904644B (en) | Molecular marker for identifying M25 navel orange and application thereof | |
| CN114703316A (en) | Development and application of KASP marker of tomato ps-2 gene | |
| CN117051149A (en) | Molecular marker for identifying navel orange M28 easy to peel and application thereof | |
| CN113943821B (en) | Insertion deletion marker related to FGF7 gene and goat growth traits and application thereof | |
| CN116656840B (en) | Method for identifying siniperca chuatsi from Heilongjiang and Zhujiang | |
| CN109652582A (en) | For identifying the SNP marker and its application of beautiful glutinous No. 3 waxy corns in Shanghai | |
| CN114990251B (en) | Molecular marker closely linked with rape methylselenocysteine content trait QTL and application thereof | |
| CN112322755B (en) | SNP locus related to growth traits of fugu rubripes and application of SNP locus in genetic breeding | |
| CN112831593B (en) | SNP molecular marker primer for variety identification of red peach trees in early summer and identification and application method thereof | |
| CN114854896B (en) | Molecular marker BnMes-2C1 closely linked with rape methyl selenocysteine content trait QTL and application | |
| CN117683938B (en) | KASP molecular marker closely linked with tomato fruit width and application thereof | |
| CN116121438B (en) | Molecular marker primer group and kit for identifying mulberry new variety 'Yuesang 162' for silkworm raising leaves and application of molecular marker primer group and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |