CN117051130A - SNP molecular marker associated with streptococcus agalactiae resistance of trachinotus ovatus and application thereof - Google Patents
SNP molecular marker associated with streptococcus agalactiae resistance of trachinotus ovatus and application thereof Download PDFInfo
- Publication number
- CN117051130A CN117051130A CN202311310995.7A CN202311310995A CN117051130A CN 117051130 A CN117051130 A CN 117051130A CN 202311310995 A CN202311310995 A CN 202311310995A CN 117051130 A CN117051130 A CN 117051130A
- Authority
- CN
- China
- Prior art keywords
- trachinotus ovatus
- streptococcus agalactiae
- primer
- molecular marker
- resistance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 241000719209 Trachinotus ovatus Species 0.000 title claims abstract description 98
- 241000193985 Streptococcus agalactiae Species 0.000 title claims abstract description 61
- 239000003147 molecular marker Substances 0.000 title claims abstract description 31
- 238000000034 method Methods 0.000 claims abstract description 15
- 238000001514 detection method Methods 0.000 claims abstract description 9
- 238000009394 selective breeding Methods 0.000 claims abstract description 9
- 239000002773 nucleotide Substances 0.000 claims abstract description 7
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 7
- 238000012408 PCR amplification Methods 0.000 claims description 11
- 238000009395 breeding Methods 0.000 abstract description 21
- 230000001488 breeding effect Effects 0.000 abstract description 21
- 230000002068 genetic effect Effects 0.000 abstract description 6
- 239000000463 material Substances 0.000 abstract description 4
- 108020004414 DNA Proteins 0.000 description 14
- 238000012163 sequencing technique Methods 0.000 description 10
- 238000012216 screening Methods 0.000 description 7
- 238000012098 association analyses Methods 0.000 description 6
- 230000000694 effects Effects 0.000 description 6
- 208000015181 infectious disease Diseases 0.000 description 6
- 230000004083 survival effect Effects 0.000 description 6
- 238000004458 analytical method Methods 0.000 description 5
- 238000007400 DNA extraction Methods 0.000 description 4
- 230000000875 corresponding effect Effects 0.000 description 4
- 238000013461 design Methods 0.000 description 4
- 239000007924 injection Substances 0.000 description 4
- 238000002347 injection Methods 0.000 description 4
- 239000007928 intraperitoneal injection Substances 0.000 description 4
- 239000003550 marker Substances 0.000 description 4
- 238000003752 polymerase chain reaction Methods 0.000 description 4
- 241000251468 Actinopterygii Species 0.000 description 3
- 208000035240 Disease Resistance Diseases 0.000 description 3
- 102000004190 Enzymes Human genes 0.000 description 3
- 108090000790 Enzymes Proteins 0.000 description 3
- 241000630524 Taractes rubescens Species 0.000 description 3
- 230000008901 benefit Effects 0.000 description 3
- 210000000349 chromosome Anatomy 0.000 description 3
- 201000010099 disease Diseases 0.000 description 3
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 3
- 238000005516 engineering process Methods 0.000 description 3
- 238000003205 genotyping method Methods 0.000 description 3
- 238000002360 preparation method Methods 0.000 description 3
- 239000000725 suspension Substances 0.000 description 3
- 241001465754 Metazoa Species 0.000 description 2
- 238000007792 addition Methods 0.000 description 2
- 230000003321 amplification Effects 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 230000002596 correlated effect Effects 0.000 description 2
- 238000010219 correlation analysis Methods 0.000 description 2
- 238000011156 evaluation Methods 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000003199 nucleic acid amplification method Methods 0.000 description 2
- 238000005457 optimization Methods 0.000 description 2
- 230000008569 process Effects 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 238000007619 statistical method Methods 0.000 description 2
- 230000009182 swimming Effects 0.000 description 2
- 238000011144 upstream manufacturing Methods 0.000 description 2
- 206010059866 Drug resistance Diseases 0.000 description 1
- 206010061217 Infestation Diseases 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 238000001190 Q-PCR Methods 0.000 description 1
- 238000000246 agarose gel electrophoresis Methods 0.000 description 1
- 239000011324 bead Substances 0.000 description 1
- 239000003086 colorant Substances 0.000 description 1
- 238000010276 construction Methods 0.000 description 1
- 238000012350 deep sequencing Methods 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 238000010790 dilution Methods 0.000 description 1
- 239000012895 dilution Substances 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 229940079593 drug Drugs 0.000 description 1
- 239000003640 drug residue Substances 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 238000003912 environmental pollution Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 238000009313 farming Methods 0.000 description 1
- 230000007614 genetic variation Effects 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 230000003993 interaction Effects 0.000 description 1
- 238000013178 mathematical model Methods 0.000 description 1
- 239000011159 matrix material Substances 0.000 description 1
- 238000011176 pooling Methods 0.000 description 1
- 238000004321 preservation Methods 0.000 description 1
- 238000000746 purification Methods 0.000 description 1
- 238000003908 quality control method Methods 0.000 description 1
- 238000011002 quantification Methods 0.000 description 1
- 230000008439 repair process Effects 0.000 description 1
- 238000012106 screening analysis Methods 0.000 description 1
- 239000000243 solution Substances 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 238000011895 specific detection Methods 0.000 description 1
- 238000002255 vaccination Methods 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
- 230000035899 viability Effects 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an SNP molecular marker associated with the streptococcus agalactiae resistance of trachinotus ovatus, the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1, wherein the 121 st position is A/C, and when the genotype is CC, the streptococcus agalactiae resistance of the trachinotus ovatus is obviously better than that of the trachinotus ovatus with the genotypes of AC and AA. Also discloses a primer and a kit for amplifying the SNP molecular marker and a detection method for resisting streptococcus agalactiae trachinotus ovatus; the SNP molecular marker, the primer, the kit or the method are applied to selective breeding of the anti-streptococcus agalactiae character of the trachinotus ovatus. By applying the technical scheme of the invention, the breeding material of the trachinotus ovatus can be screened early, the breeding period is shortened, the breeding accuracy is improved, the genetic quality of the trachinotus ovatus is improved, the molecular marker resources of the trachinotus ovatus are enriched, and finally, the efficient breeding of a new variety of high-quality trachinotus ovatus is realized.
Description
Technical Field
The invention belongs to the technical field of screening and auxiliary breeding of aquatic animal molecular markers, and particularly relates to an SNP molecular marker related to streptococcus agalactiae resistance of trachinotus ovatus and application thereof.
Background
Trachinotus ovatus is a cultured fish with high economic value, however, trachinotus ovatus breeding industry faces a number of disease threats, wherein streptococcus agalactiae infection is one of the main diseases. Streptococcus agalactiae disease severely affects the growth and survival of trachinotus ovatus, resulting in a huge economic loss in the farming industry. Therefore, the improvement of the streptococcus agalactiae resistance of the trachinotus ovatus has extremely important economic and social significance.
In the prior art, streptococcus agalactiae infection is mainly prevented and treated by means of drug treatment, vaccination and the like. However, these methods are not ideal in effect, and have problems such as drug residues, drug resistance, and environmental pollution. In addition, it takes a long time to improve disease resistance of trachinotus ovatus by conventional selective breeding methods, and the effect is often limited by complex interactions of genetic and environmental factors.
Total genetic association analysis (GWAS) is a technique widely used in molecular biology and genetic research in recent years, and by analyzing genotype and phenotype data of a large number of individuals, it is possible to find the association between genetic variation and traits. However, although GWAS has successfully found a number of relevant sites of important traits in many species, there is relatively little research on the behavior of trachinotus ovatus against streptococcus agalactiae.
Therefore, carrying out whole-gene association analysis to find SNP molecular markers related to resistance of trachinotus ovatus to Streptococcus agalactiae and selectively breeding by using the markers is a promising solution to the above problems.
Disclosure of Invention
The first object of the present invention is to provide a SNP molecular marker related to the behavior of trachinotus ovatus against streptococcus agalactiae.
The invention also aims at providing a primer and a kit for amplifying the SNP molecular marker related to the streptococcus agalactiae resistance of the trachinotus ovatus, and a detection method of the streptococcus agalactiae resistance of the trachinotus ovatus.
The final object of the invention is to provide the application of the SNP molecular marker, the primer, the kit or the method in selective breeding of the trachinotus ovatus with the streptococcus agalactiae resistance.
The first object of the present invention can be achieved by the following technical means: a SNP molecular marker related to the anti-streptococcus agalactiae character of trachinotus ovatus is provided, the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1, wherein the 121 st position is A/C.
The sequence shown in SEQ ID NO.1 is as follows:
TTTAACCTGCTTCTCTTGATACTGAATGGAAATTATAGATGCAATCGTTTTACAGTAGATAGAATATAGAATCTCTTCTTTGTGTTTCAAGGACACACTCACTTT
TAGTCACAAAAATCTN(A/C)AAATTTTCCAAATTTATCAAAGTTTTGTCAGATTTAGGTTTGTATTAGGATTCAGTCTTTCACATGATTGTTCAACCATAAAAAAA
AAATTCCCTTTTCAGTTAAACATGCAAGCC。
the invention discovers a SNP molecular marker which is positioned on the No. 9 chromosome of the trachinotus ovatus and is obviously associated with the streptococcus agalactiae resistance property through a whole genome association analysis (GWAS) strategy.
Specifically, the tag is the 121 th base of the nucleotide sequence shown in SEQ ID NO. 1.
With respect to the nucleotide sequence of SEQ ID NO.1, N at base 121 thereof represents A or C, which indicates that a polymorphism exists at this position.
Statistical analysis shows that compared with the CC genotype, the trachinotus ovatus corresponding to the AC and AA genotypes has a significant difference in the behavior against streptococcus agalactiae.
Alternatively, when the genotype is CC, the ability of the trachinotus ovatus to resist streptococcus agalactiae is significantly superior to that of the trachinotus ovatus with genotypes AC and AA.
Specifically, when the genotype is CC, the resistance of the trachinotus ovatus at a semi-lethal concentration of streptococcus agalactiae at 120h after infection is significantly better than that of the trachinotus ovatus with genotypes AC and AA.
The character of the trachinotus ovatus against streptococcus agalactiae described in the invention refers to the survival condition of the trachinotus ovatus after the trachinotus ovatus is infected by intraperitoneal injection for 120 hours and the concentration of streptococcus agalactiae is half-dead.
Resistance assessment: the streptococcus agalactiae is susceptible after 120h of injection, the streptococcus agalactiae is obviously infected, and the streptococcus agalactiae is still not obviously infected after 120h of injection, and the streptococcus agalactiae is well identified as being resistant to swimming.
The core part of the invention relates to the use of specific SNP molecular markers for accurate genotype detection of selected candidate populations in the breeding of trachinotus ovatus. In combination with analysis of other genetic loci related to growth traits, disease resistance and stress resistance, the invention particularly recommends selecting individuals with SNP genotype of CC as a preferential parent for breeding the streptococcus agalactiae-resistant oval pomfret.
The invention screens SNP molecular markers obviously related to the streptococcus agalactiae resistance of trachinotus ovatus, comprising the following important steps:
(1) Selecting a fin sample of the trachinotus ovatus infected by the 120h semi-lethal concentration streptococcus agalactiae PBS suspension through intraperitoneal injection, and extracting DNA from the fin sample efficiently for deep sequencing of the whole genome;
(2) Strictly comparing the sequencing data obtained in the step (1) with a standard reference genome of the trachinotus ovatus, thereby obtaining SNP molecular markers within the whole genome range;
(3) And (3) deeply researching the correlation between the anti-streptococcus agalactiae character of the trachinotus ovatus and the genotype by using a whole genome correlation analysis technology, and determining SNP markers which are obviously correlated with the anti-streptococcus agalactiae character of the trachinotus ovatus.
Further, the invention details a precise method for screening SNP molecular markers related to the streptococcus agalactiae resistance trait of trachinotus ovatus, which comprises the following key steps:
(1) Firstly, about 2000 tail trachinotus ovatus are selected, all the trachinotus ovatus is subjected to intraperitoneal injection of a streptococcus agalactiae PBS suspension with a semi-lethal concentration for 120 hours, then fin samples are cut from the 100 tail trachinotus ovatus which die first and the 100 tail trachinotus ovatus with good activity after 120 hours, and then DNA extraction and whole genome re-sequencing are carried out;
(2) Comparing the sequencing data obtained in the step (1) with a standard reference genome of the trachinotus ovatus in detail, and accurately obtaining SNP information in a whole genome range;
(3) The correlation between the anti-streptococcus agalactiae character of the trachinotus ovatus and each genotype is deeply studied by using a whole genome correlation analysis (GWAS) technology, and SNP markers which are obviously correlated with the anti-streptococcus agalactiae character of the trachinotus ovatus are screened out.
By the method, precious molecular marker resources are contributed to the field of selective breeding of the trachinotus ovatus, accurate SNP typing is realized, and SNP obviously related to the streptococcus agalactiae resistance of the trachinotus ovatus is screened out by the GWAS. The SNP markers are expected to be widely applied to selective breeding of the anti-streptococcus agalactiae character of the trachinotus ovatus.
The second object of the present invention can be achieved by the following technical means: a primer for amplifying SNP molecular markers associated with the anti-streptococcus agalactiae trait of trachinotus ovatus, wherein the primer comprises a primer SNPLG918597184FA, a primer SNPLG918597184FC and a primer SNPLG918597184R, the sequence of the primer SNPLG918597184FA is shown as seq id No.2, the sequence of the primer SNPLG918597184FC is shown as seq id No.3, and the sequence of the primer SNPLG918597184R is shown as seq id No. 4.
Based on the nucleotide sequence of SEQ ID NO.1, the invention designs specific primers aiming at SNP molecular markers, which are named SNPLG918597184FA, SNPLG918597184FC and SNPLG918597184R. After PCR specific amplification is carried out by using the primers, a fluorescent signal is read by an enzyme-labeled instrument, and then the signal is analyzed to obtain the genotype of the SNP molecular marker locus of the trachinotus ovatus to be detected.
The invention describes in detail a series of primers related to the anti-streptococcus agalactiae trait of trachinotus ovatus, the design of which is based on the 120BP genomic sequence upstream and downstream of the marker, and the precise primer design using a professional SNP primer software tool.
For the sake of detailed description, the nucleotide sequences of these specific primers are listed below:
Snplg918597184FA(seq id no.2)：
GAAGGTGACCAAGTTCATGCTACACTCACTTTTAGTCACAAAATCTCA；
Snplg918597184FC(seq id no.3)：
GAAGGTCGGAGTCAACGGATTACACTCACTTTTAGTCACAAAATCTCC；
Snplg918597184r(seq id no.4)：
TGAAAGACTGAATCCTAAATACAAACC。
in order to match the application of the primer, the invention also carefully prepares a special kit which mainly comprises the primer.
The invention also provides a detection method for the streptococcus agalactiae oval pomfret, which comprises the following steps:
(1) Extracting genome DNA from the trachinotus ovatus to be detected;
(2) Carrying out PCR amplification on the genomic DNA of the trachinotus ovatus to be detected by using the specific primer or the kit, thereby obtaining a PCR amplification product;
(3) And (3) determining the genotype of the trachinotus ovatus to be detected by analyzing the fluorescence signal of the PCR amplification product, and judging the streptococcus agalactiae resistance according to the genotype.
In order to ensure the accuracy of the detection method, the invention preferably recommends that in the step (1), part of fin bars are cut from the trachinotus ovatus to extract total DNA, and simultaneously the quality and purity of the obtained DNA sample are ensured, namely the ratio of A260/A280 is in the range of 1.8-2.0, and the concentration of the DNA is not lower than 100 mug/mug.
In step (2), the optimized PCR system for PCR amplification is shown in Table 1 below:
TABLE 1 PCR System
The Pcr amplification procedure is shown in table 2 below:
TABLE 2 PCR amplification procedure
And (3) in the genotyping process of the step (3), after the PCR is completed, reading the obtained fluorescent signal by using an enzyme-labeled instrument. The fluorescent signal is then resolved and converted using professional online software snpdecoder. Based on the color difference of the fluorescent signals, the software can output corresponding genotypes.
In this step, the analysis of the fluorescent signal of the PCR product to obtain the genotype is an economical and efficient strategy, which has a cost advantage compared to the conventional sequencing method.
Based on the data, the survival rate of trachinotus ovatus when genotype CC was found to significantly exceed that of individuals with genotype AC or AA after infection with Streptococcus agalactiae. Therefore, in breeding selection, it is advisable to select trachinotus ovatus with SNP locus of CC genotype as parent, and to avoid the use of trachinotus ovatus with SNP locus of AC or AA genotype as parent.
The last object of the invention can be achieved by the following technical scheme: the SNP molecular marker, the primer, the kit or the method are applied to selective breeding of the anti-streptococcus agalactiae character of the trachinotus ovatus.
The invention not only provides the preparation and application of the SNP molecular marker, the primer pair and the kit, but also clarifies the importance and application potential of the SNP molecular marker and the primer pair in selective breeding of the anti-streptococcus agalactiae character of the trachinotus ovatus.
In summary, the present invention provides SNP analysis markers related to resistance of trachinotus ovatus to Streptococcus agalactiae. Relates to the technical field of molecular marker screening and auxiliary breeding of aquatic animals. In addition to the screening methods for markers, the identification of subsequent genotypes is described in detail. The technical scheme allows the primary screening of the trachinotus ovatus breeding material, so that a brand new SNP molecular marker is provided for the trachinotus ovatus while improving the efficiency and accuracy of breeding the streptococcus agalactiae resistance.
The invention has the following advantages:
(1) According to the statistical analysis of the embodiment of the invention, when the genotype of the SNP marker is CC, the resistance of the trachinotus ovatus to streptococcus agalactiae is obviously better than that of the trachinotus ovatus with the genotype of AA or AC;
(2) Therefore, the SNP molecular marker can accurately predict the resistance of the trachinotus ovatus to streptococcus agalactiae, and provides a powerful tool for selective breeding of the trachinotus ovatus;
(3) By applying the technical scheme of the invention, the breeding material of the trachinotus ovatus can be screened early, the breeding period is shortened, the breeding accuracy is improved, the genetic quality of the trachinotus ovatus is improved, the molecular marker resources of the trachinotus ovatus are enriched, and finally, the efficient breeding of a new variety of high-quality trachinotus ovatus is realized.
Drawings
The invention will be further described with reference to the accompanying drawings, in conjunction with examples.
FIG. 1 is a Manhattan diagram of example 1, wherein the position of a molecular marker selected in the present invention is shown by an arrow mark on the No. 9 chromosome of an oval pomfret.
Detailed Description
The following detailed description of the present invention is provided in connection with specific embodiments so that those skilled in the art may better understand and practice the present invention. The following examples and figures are for illustrative purposes only and are not to be construed as limiting the invention. The reagents or materials used in the examples, unless otherwise specified, were all commercially available. Unless otherwise indicated, all laboratory instruments used are laboratory conventional.
In order to explain the present invention in more detail, the following examples are presented. It is emphasized that the following examples are merely illustrative of the present invention and are not intended to limit the true scope or content of the invention.
Example 1: screening of SNP markers
(1) Streptococcus agalactiae infection experiments:
2000 trachinotus ovatus were randomly selected from the population.
The selected trachinotus ovatus was subjected to intraperitoneal injection of a semi-lethal concentration of streptococcus agalactiae PBS suspension for 120 h. The 120h half-lethal concentration required for the experiment was 2.0 x 10 6 CFU/mL。
After the treatment, the survival status of each trachinotus ovatus was recorded in detail, and this data was used as a basis for evaluation of its resistance to streptococcus agalactiae.
Resistance assessment: the streptococcus agalactiae is susceptible after 120h of injection, the streptococcus agalactiae is obviously infected, and the streptococcus agalactiae is still not obviously infected after 120h of injection, and the streptococcus agalactiae is well identified as being resistant to swimming.
(2) DNA extraction:
the first 100 dead fish and 100 fish that survived after 120 hours and exhibited good activity were selected.
Fin rays are cut from each trachinotus ovatus, and the total weight of the fin rays is 20mg.
And (3) adopting a magnetic bead method DNA extraction kit, and sequentially adding reagents to extract DNA from the fin according to the steps of the specification.
The extracted DNA was stored in 150. Mu.L Buffer AE.
The DNA samples were examined by 1% agarose gel electrophoresis and the concentration and purity of the DNA were determined using Nanodrop 2000. Here, the ratio of A260/A280 should be in the range of 1.8 to 2.0, while the DNA concentration should be not lower than 100. Mu.g/. Mu.L.
(3) Library preparation and sequencing:
firstly, randomly fragmenting the DNA samples with qualified quality by using a covarias ultrasonic fragmenter.
After the operations of end repair, A tail addition, sequencing linker addition, purification and PCR amplification, library preparation was completed.
The prepared library was high throughput sequenced using an Illumina sequencer.
(4) Quality control prior to library sequencing:
after completion of library construction, preliminary quantification was performed using qubit2.0, followed by dilution of the library to 1 ng/. Mu.L.
The insert size of the library was verified using Agilent 2100. After confirming the insert size, the effective concentration of the library was accurately determined using the Q-PCR method (effective concentration >2nM is required) to ensure the quality of the library.
Qualified libraries will be pooling based on effective concentration and target sequencing data volume requirements and Illumina PE150 sequencing.
The whole genome resequencing technology adopted by the invention can efficiently excavate rare variation, has high SNP density, and is suitable for whole genome association analysis.
High quality sequencing data was aligned to the target reference genome using BWA software (using parameters: mem-t 10-k 32-M). The alignment output was then ordered by samtoils software, using the parameter "sort".
Screening and association analysis of SNPs:
efficient detection of group SNPs was performed using samtoils and BCFTOOLS software. Specific detection parameters are as follows: samtools-1.3.1 mp il eup-q 1-C50-t SP-t DP-m 2-F0.002 and bcftools-1.4 call-mv-fGQ.
The total number of original SNP sites was 1,744,190 in 200 samples, and the number of high-quality SNP sites after screening was 803,713.
GEMMA software was used, and a Mixed Linear Model (MLM) was used to screen SNP sites associated with the anti-Streptococcus agalactiae trait.
The specific mathematical model is described as: y=xα+zβ+wμ+e
Wherein y represents a phenotypic trait, X, Z and W are respectively an indication matrix of the respective effects, α, β and μ are the corresponding effect parameters, and e is a random residual, which is distributed as e to (0, δe≡2).
Based on the whole genome association analysis (GWAS), a SNP marker (indicated by the arrow in fig. 1) associated with resistance to streptococcus agalactiae was found on the trachinotus ovatus chromosome 9. The SNP is located at 121 th base of the nucleotide sequence shown in SEQ ID NO. 1.
The sequence shown in SEQ ID NO.1 is as follows:
TTTAACCTGCTTCTCTTGATACTGAATGGAAATTATAGATGCAATCGTTTTACAGTAGATAGAATATAGAATCTCTTCTTTGTGTTTCAAGGACACACTCACTTT
TAGTCACAAAAATCTN(A/C)AAATTTTCCAAATTTATCAAAGTTTTGTCAGATTTAGGTTTGTATTAGGATTCAGTCTTTCACATGATTGTTCAACCATAAAAAAA
AAATTCCCTTTTCAGTTAAACATGCAAGCC。
example 2: SNP genotyping verification
Experimental population: the above SNP molecular markers were validated using another germplasm population containing 380 tail trachinotus ovatus.
Resistance assessment: the same as in example 1;
DNA extraction: total DNA is extracted from the pectoral fins of Trachinotus ovatus. The quality requirements for extraction, preservation and DNA were the same as in example 1.
Specific primer design: specific amplification primers were designed based on the base sequence of about 120bp upstream and downstream of the SNP marker using SNP primer software.
And (3) PCR amplification: PCR amplification was performed using the following primers:
Snplg918597184FA(seq id no.2):
GAAGGTGACCAAGTTCATGCTACACTCACTTTTAGTCACAAAATCTCA
Snplg918597184FC(seq id no.3):
GAAGGTCGGAGTCAACGGATTACACTCACTTTTAGTCACAAAATCTCC
Snplg918597184r(seq id no.4):
TGAAAGACTGAATCCTAAATACAAACC
the PCR system is shown in Table 1 below:
TABLE 1 PCR System
The Pcr amplification procedure is shown in table 2 below:
TABLE 2 PCR amplification procedure
Genotyping:
fluorescent signal reading: after the PCR amplification is completed, a fluorescence signal of the PCR product is read by adopting an enzyme-labeled instrument.
Fluorescent signal analysis: the fluorescence signal was resolved and converted using on-line software snpdecoder.
Genotype determination: based on the different colors of the fluorescent signals, the corresponding genotypes are analyzed and output. Thus, the genotypes of the SNP loci described in the present invention in the respective samples are clarified.
The typing results are shown in Table 3 below.
TABLE 3 Effect of SNPLG91597184 polymorphism on resistance to Streptococcus agalactiae of Trachinotus ovatus
From the data in table 3, it can be observed that trachinotus ovatus with the CC genotype exhibited higher survival rates in the face of streptococcus agalactiae infestation in resequencing samples and in the re-validated expanded population. The survival rate is a significant advantage over samples of AC and AA genotypes. This finding provides strong evidence for a significant link between the polymorphism of the SNPLG918597184 molecular marker disclosed in SEQ ID No.1 and resistance of trachinotus ovatus to streptococcus agalactiae. Further, it was found by analysis of the genotype frequency that when the genotype of the trachinotus ovatus was CC, it exhibited significantly better viability against infection with streptococcus agalactiae than the samples of AC and AA genotypes.
The method proposed by the present invention is also likely to extend to the development of a kit dedicated to the detection of the above mentioned SNP molecular markers, which kit will comprise the specific primers mentioned above. Furthermore, when this SNP molecular marker is utilized in the breeding process of trachinotus ovatus, it will mainly play a role in genotype detection of breeding candidate populations. Trachinotus ovatus with genotype CC is preferentially considered as a superior parent for breeding against streptococcus agalactiae by combining other genotypes associated with growth, disease resistance, and stress resistance.
Therefore, the SNP molecular markers, specific primers and possible kits described in the present invention can play an important role in selectively breeding trachinotus ovatus to enhance its resistance to Streptococcus agalactiae.
Therefore, the application of the SNP molecular markers, the primers and the kit to the evaluation of the resistance of the trachinotus ovatus to streptococcus agalactiae is considered to be within the protection scope of the invention.
It should be emphasized that while the above-described examples describe in detail certain embodiments of the invention, this is not meant to limit the scope of the invention. Indeed, it will be apparent to those skilled in the art that various modifications and optimization can be made without departing from the basic idea and principle of the invention, and all such modifications and optimization should be considered as being within the scope of the invention.
Claims (6)
1. An SNP molecular marker associated with the streptococcus agalactiae resistance of trachinotus ovatus, which is characterized in that: the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1, wherein the 121 rd position is A/C.
2. The SNP molecular marker associated with the streptococcus agalactiae resistance trait of trachinotus ovatus according to claim 1, characterized in that: when the genotype is CC, the capacity of the trachinotus ovatus against streptococcus agalactiae is obviously better than that of the trachinotus ovatus with genotypes of AC and AA.
3. A primer for amplifying the SNP molecular marker associated with the streptococcus agalactiae resistance trait of trachinotus ovatus according to claim 1 or 2, characterized in that: the primer comprises a primer SNPLG918597184FA, a primer SNPLG918597184FC and a primer SNPLG918597184R, wherein the sequence of the primer SNPLG918597184FA is shown as seq id No.2, the sequence of the primer SNPLG918597184FC is shown as seq id No.3, and the sequence of the primer SNPLG918597184R is shown as seq id No. 4.
4. A kit, characterized in that: comprising the primer of claim 3.
5. The detection method for the streptococcus agalactiae trachinotus ovatus is characterized by comprising the following steps of:
(1) Extracting genome DNA from the trachinotus ovatus to be detected;
(2) Carrying out PCR amplification on the genomic DNA of the trachinotus ovatus to be detected by using the primer in claim 3 or the kit in claim 4, thereby obtaining a PCR amplification product;
(3) And (3) determining the genotype of the trachinotus ovatus to be detected by analyzing the fluorescence signal of the PCR amplification product, and judging the streptococcus agalactiae resistance according to the genotype.
6. Use of the SNP molecular marker of claim 1 or 2, the primer of claim 3, the kit of claim 4 or the method of claim 5 in selective breeding of trachinotus ovatus resistant to streptococcus agalactiae trait.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311310995.7A CN117051130B (en) | 2023-10-11 | 2023-10-11 | SNP molecular marker associated with streptococcus agalactiae resistance of trachinotus ovatus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311310995.7A CN117051130B (en) | 2023-10-11 | 2023-10-11 | SNP molecular marker associated with streptococcus agalactiae resistance of trachinotus ovatus and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN117051130A true CN117051130A (en) | 2023-11-14 |
| CN117051130B CN117051130B (en) | 2023-12-22 |
Family
ID=88669560
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202311310995.7A Active CN117051130B (en) | 2023-10-11 | 2023-10-11 | SNP molecular marker associated with streptococcus agalactiae resistance of trachinotus ovatus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117051130B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104694660A (en) * | 2015-03-24 | 2015-06-10 | 海南大学 | Oval pompanos trevally family paternity test method |
| CN108411007A (en) * | 2018-05-25 | 2018-08-17 | 海南晨海水产有限公司 | SNP marker and its application |
| CN111088370A (en) * | 2020-01-20 | 2020-05-01 | 中国水产科学研究院南海水产研究所 | Sex-specific molecular marker primer for Trachinotus ovatus, identification method and application of sex-specific molecular marker primer |
| CN113186299A (en) * | 2021-04-25 | 2021-07-30 | 中国水产科学研究院南海水产研究所 | Trachinotus ovatus cryptocaryon irritans disease associated SNP molecular marker, primer and application thereof |
| CN116516029A (en) * | 2023-06-30 | 2023-08-01 | 中国海洋大学三亚海洋研究院 | Golden pomfret whole genome breeding chip and application |
| US20230310518A1 (en) * | 2020-07-28 | 2023-10-05 | Icahn School Of Medicine At Mount Sinai | Compositions and Methods for Treating Infections of the Gastrointestinal Tract |
-
2023
- 2023-10-11 CN CN202311310995.7A patent/CN117051130B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104694660A (en) * | 2015-03-24 | 2015-06-10 | 海南大学 | Oval pompanos trevally family paternity test method |
| CN108411007A (en) * | 2018-05-25 | 2018-08-17 | 海南晨海水产有限公司 | SNP marker and its application |
| CN111088370A (en) * | 2020-01-20 | 2020-05-01 | 中国水产科学研究院南海水产研究所 | Sex-specific molecular marker primer for Trachinotus ovatus, identification method and application of sex-specific molecular marker primer |
| US20230310518A1 (en) * | 2020-07-28 | 2023-10-05 | Icahn School Of Medicine At Mount Sinai | Compositions and Methods for Treating Infections of the Gastrointestinal Tract |
| CN113186299A (en) * | 2021-04-25 | 2021-07-30 | 中国水产科学研究院南海水产研究所 | Trachinotus ovatus cryptocaryon irritans disease associated SNP molecular marker, primer and application thereof |
| CN116516029A (en) * | 2023-06-30 | 2023-08-01 | 中国海洋大学三亚海洋研究院 | Golden pomfret whole genome breeding chip and application |
Non-Patent Citations (3)
| Title |
|---|
| ZHICHENG LI等: "Skin transcriptomic analysis and immune-related gene expression of golden pompano (Trachinotus ovatus) after Amyloodinium ocellatum infection", FISH & SHELLFISH IMMUNOLOGY, vol. 128, pages 188 - 195, XP087177299, DOI: 10.1016/j.fsi.2022.07.052 * |
| 武沛文等: "湛江卵形鲳鲹致病链球菌的分离、鉴定及药敏实验", 基因组学与应用生物学, vol. 38, no. 12, pages 5403 - 5411 * |
| 熊向英等: "广西卵形鲳海豚链球菌基因分型、耐药谱型以及毒力基因检测", 水产学报, vol. 42, no. 4, pages 586 - 595 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN117051130B (en) | 2023-12-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Gundry et al. | Direct mutation analysis by high-throughput sequencing: from germline to low-abundant, somatic variants | |
| US9133513B2 (en) | High throughput methylation detection method | |
| CN113308562B (en) | Cotton whole genome 40K single nucleotide site and application thereof in cotton genotyping | |
| Good | Reduced representation methods for subgenomic enrichment and next-generation sequencing | |
| CN112695108B (en) | Reproductive performance SNP (single nucleotide polymorphism) locus combination of meat sheep and application thereof | |
| CN109825598B (en) | SNP (Single nucleotide polymorphism) marker remarkably related to Australian white sheep hair thickness, molecular marker and application | |
| WO2017024991A1 (en) | Swine bcr heavy-chain multiplex pcr primer and application thereof | |
| Negi et al. | Applications and challenges of microarray and RNA-sequencing | |
| CN110669834A (en) | Method for developing polymorphic SSR (simple sequence repeat) marker based on transcriptome sequence | |
| CN109706231B (en) | High-throughput SNP (single nucleotide polymorphism) typing method for molecular breeding of litopenaeus vannamei | |
| CN109337997B (en) | Camellia polymorphism chloroplast genome microsatellite molecular marker primer and method for screening and discriminating kindred species | |
| CN111485026A (en) | Sheep birth weight related SNP (single nucleotide polymorphism) site, application, molecular marker and primer | |
| CN114196761A (en) | Method for manufacturing liquid chip for selecting reward of parent strain pig feed | |
| CN117051130B (en) | SNP molecular marker associated with streptococcus agalactiae resistance of trachinotus ovatus and application thereof | |
| KR20190045957A (en) | Single nucleotide polymorphism markers associated with daily weight gain trait in pig and use thereof | |
| CN114875118A (en) | Methods, kits and devices for determining cell lineage | |
| CN114875157A (en) | SNP (Single nucleotide polymorphism) marker related to individual growth traits of pelteobagrus fulvidraco and application | |
| D’Agaro | New advances in NGS technologies | |
| KR20190045958A (en) | Single nucleotide polymorphism markers associated with backfat thickness trait in pig and use thereof | |
| CN110016510B (en) | Molecular marker for genetic breeding of macrobrachium rosenbergii | |
| Meilan et al. | Forest genomics and biotechnology | |
| CN106520955B (en) | Development method of rice microsatellite marker locus and length detection method of microsatellite marker in microsatellite marker locus | |
| CN118389706B (en) | Marker combination for mandarin fish genotyping and whole genome liquid phase chip using same | |
| CN113151492B (en) | SNP molecular marker related to trachinotus ovatus hypoxia-resistant character and application thereof | |
| CN118460742B (en) | SNP molecular marker related to eye muscle area of large white pig and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |