CN117025610A - Bumblebee candida utilis inducible Picl promoter and application thereof - Google Patents

Abstract

The application belongs to the technical field of biology, and discloses a bumblebee candida utilis inducible Picl promoter and application thereof. The application takes bumblebee candida as a research object, and digs, clones, screens and evaluates the inducible promoter. And detecting the response level of the inducible promoters to different carbon sources by using qPCR technology, and screening four inducible promoters with different induction modes. These promoters have stronger inducibility with the corresponding inducer as the sole carbon source or lower leakage expression before induction than the known inducible promoters Pgalk. The application provides a powerful tool for gene regulation and control of the bumblebee candida, enriches the synthetic biological elements and also provides assistance for development of genetic engineering strains.

Description

Bumblebee candida utilis inducible Picl promoter and application thereof

The application is application number 202310768904.8, and the application is named as follows: bumblebee candida utilis inducible promoter and application thereof, and the application of the bumblebee candida utilis inducible promoter is a divisional application of a Chinese patent application patent application of which the application date is 2023, 6 and 28.

Technical Field

The application belongs to the technical field of biology, and relates to a bumblebee candida utilis inducible Picl promoter and application thereof.

Background

The bumblebee candida (Starmerela bombicola) belongs to ascomycete yeasts and can be used for producing glycolipid biosurfactants very effectively. Due to the natural high-sugar-ester production capacity>200g-L ^-1 ) The bumblebee candida has become the most well known and studied species of glycolipid-producing yeasts (Gao, r., et al Production of sophorolipids with enhanced volumetric productivity by means of high cell density reference. Appl Microbiol Biotechnol,2013.97 (3): p.1103-11.). Glycolipids, one of the most important biosurfactants, are widely used in the industries of cosmetics, petroleum development, environmental remediation, pharmaceuticals, etc., with their high productivity, high surface activity, low toxicity and good environmental compatibility (Van Bogaert, i.n., et al, microbial production and application of autophorolide. Appl Microbiol Biotechnol,2007.76 (1): p.23-34).

Genetic engineering of strains is an extremely important means to achieve efficient synthesis of target specific bio-based products, but up to now, bumblebee candida has lacked efficient molecular tools and genetic modification attempts to make genetically engineered strains have been very limited. The promoter element plays an important role in the gene expression process and controls the level of gene transcription. Generally, there are two main options for transcription of a gene of interest: inducible or constitutive promoters. More alternatives are available in the case of the constitutive promoters of candida bumblebee, such as pgki (glyceraldehyde-3-phosphate dehydrogenase), pgki (3-phosphoglycerate kinase) or Ptef1 (translational elongation factor) etc. (Dan Yibo, et al, screening and strength analysis of candida bumblebee promoters, microbiology report, 2021.048 (010): p.3569-3579.), but constitutive promoters are not always desirable in transcriptional regulation, recombinant proteins continue to exert toxic effects on the host at high expression levels, and thus require inducible expression within a specific time, e.g., cas9 protein, cre or Rec recombinase. The development of stringent inducible promoters is therefore very important and urgent.

The inducible promoter plays a vital role in the expression and precise transcriptional regulation of the exogenous protein. As the research on genetic engineering of the bumblebee candida is less, available inducible promoters are very limited, and available Pgalk promoters only with galactose kinase genes are reported to be used at present (Zhang Jiangrui, et al, metabolic modification of the bumblebee candida to improve acid type sophorolipid yield.Microbiol. 2019.59 (11): p.13.; liu, J.; et al, A Cumulative Effect by Multiple-Gene Knockout Strategy Leads to a Significant Increase in the Production of Sophorolipids in Starmerella Bombicola CGMCC 1576.Front Bioeng Biotechnol,2022.10:p.818445.). For example, university of Jiangnan Zhang Jiangrui (Zhang Jiangrui, et al, metabolic modification of Candida buminosa to increase acid-type sophorolipid production, microbiology report, 2019.59 (11): p.13.), et al use a Pgalk-inducible promoter to regulate expression of the Rec protein, mediate deletion of the Rec protein and hygromycin resistance genes between six sites, and achieve recovery of hygromycin resistance genes. However, the system has low editing efficiency due to low Pgalk induction level and low stringency, and engineering strains containing target genes are difficult to screen. The genetic regulatory loop of the GAL1 gene encoding galactokinase is the most studied and understood regulatory system in Saccharomyces cerevisiae. The transcription of the GAL1 gene in Saccharomyces cerevisiae is strictly regulated, inhibited in cells grown in glucose culture, and induced about 1000-fold after growth in galactose culture. GAL1 in Candida bear peak is induced by D-galactose with low efficiency, and qPCR analysis shows that GAL1 is hardly induced by D-galactose. Thus, the lack of available inducible promoter tools in candida bumpy, also further limits the development speed of genetically engineered strains.

Disclosure of Invention

The application aims to excavate a carbon source dependent inducible promoter in candida bumblebee, detect the transcription level of the carbon source dependent inducible promoter under different carbon sources, find a feasible inducible promoter, provide a usable tool for carrying out induction regulation and control on the gene transcription level of candida bumblebee, and realize efficient gene editing and expression regulation and control. Specifically, the genome information of the bumblebee candida is compared with the carbon source dependent inducible promoter sequence of the saccharomyces cerevisiae source through NCBI database, and the corresponding gene sequence is searched. The transcript levels of the genes at the different carbon sources were then analyzed by qPCR to evaluate the corresponding inducers or inhibitors. Then, a Recsix gene editing system is constructed by using the promoter of the application, and compared and analyzed with Recsix under the control of Pgalk. Find out and carry on the induction regulation and control and provide the usable tool on the gene transcription level of the bumblebee candida, realize high-efficient gene editing and expression regulation and control.

The application firstly provides a bumblebee candida utilis inducible promoter, and the nucleotide sequence of the promoter is shown in any one of SEQ ID NO. 1-4.

It is a second object of the present application to provide an expression vector comprising the promoter.

Further, the expression vector is an over-expression vector suitable for the recovery of resistance of the bumblebee candida.

Further, the over-expression vector is an integrative vector which contains a left and right homology arm, a gene expression cassette and Pst1.3-Recsix and can be recovered from the resistance.

Further, the nucleotide sequence of Pst1.3-Recsix is shown as SEQ ID NO. 5.

A third object of the present application is to provide a bumblebee candida that contains the promoter.

The fourth object of the application is to provide the application of the promoter in genetic modification of the bumblebee candida.

Further, the use is to use the promoter to initiate expression of a constitutive gene.

Further, the application specifically comprises the following steps:

s1, recombining and cloning a left homologous arm and a right homologous arm of a site to be integrated, an overexpression box containing ori and kana resistance gene fragments derived from pUC-kana and a target gene to obtain an integrated expression vector;

s2, connecting the integrated expression vector obtained in the step S1 with a Recsix system to obtain an integrated expression vector with resistance recovery;

s3, connecting the promoter T4 with Recsix in S2 to obtain a novel integrated expression vector capable of recovering resistance;

s4, transferring the integrated expression vector obtained in the step S3 into a bumblebee candida growing host strain to obtain the non-resistance over-expressed bumblebee candida growing recombinant strain.

The application enriches available regulatory elements in the bumblebee candida, and provides a new tool for gene editing and transcription regulation. Compared with Pgalk, the Picl promoter has higher transcription level, the activity of the Picl promoter is inhibited by glucose, and the Picl promoter is induced by ethanol and sodium citrate, so that the Picl promoter has stronger inducibility. Compared with the Pgalk promoter, the Pst1.3 promoter is more rigorous in induction and regulation, the activity is inhibited under the condition of glucose, the transcription level is only 5% of that of Pgalk, the expression is induced in the environment without glucose, and the transcription level of D-galactose and ethanol can be further induced and improved. Padh promoter induces lower levels of pre-transcription than Pgalk, but D-galactose induces higher levels of transcription. Unlike other promoters, pst1.1 is induced by glucose and inhibited in the absence of a carbon source. The application solves the blank of the inducible promoter in the bumblebee candida (Starmerela bombicola) and provides a brand-new tool for the induction regulation and control in the bumblebee candida.

Drawings

FIG. 1 relative transcript levels of the promoters in the different media.

FIG. 2 relative transcript levels before and after induction of different promoters.

FIG. 3 construction of an antibiotic-free strain overexpressing A at the pxa locus using the Recsix system.

FIG. 4A shows a map of plasmid pGAB 1.

FIG. 4B plasmid pSAB1 map.

FIG. 5A screens transformants harboring the Pgalk-Recsix expression cassette.

FIG. 5B screens transformants harboring the Pst1.3-Recsix expression cassette.

FIG. 6A screen for non-resistant transformants following induction by the Pgalk-Recsix system.

FIG. 6B screens for non-resistant transformants following induction by the Pst1.3-Recsix system.

FIG. 7 sequencing verifies the pxa1 locus.

Detailed Description

The process according to the application is further illustrated by the following examples. The experimental method in which specific conditions are not specified in examples can be generally performed according to conditions in a routine experiment in the field of molecular biology or according to instructions of commercial manufacturers such as plasmids and strains. The present application may be better understood and appreciated by those skilled in the art by reference to the examples.

Example 1: mining of carbon-dependent inducible promoters

Saccharomyces cerevisiae is one of the most deeply studied eukaryotes at present, and more carbon-dependent promoters have been reported, generally induced or inhibited by specific carbon sources (Weinchandl, K., et al Carbon source dependent promoters in Yeast. Microb Cell face, 2014.13:p.5.). The application is based on a natural inducible promoter derived from Saccharomyces cerevisiae, takes an inducible protein sequence as a motherboard, compares the inducible protein sequence with a bumblebee candida genome, searches for corresponding homologous genes, and takes an upstream promoter region of the genes as a potential inducible promoter. The website of the comparison tool in the application is https:// blast.

4 homologous proteins from the bumblebee candida, ethanol dehydrogenase type 2, were retrieved, with 37.92% homology to the ADH2 (ethanol dehydrogenase type 2) protein in saccharomyces cerevisiae; isocitrate lyase type 1, 63.84% homologous to ICL1 (isocitrate lyase type 1) in saccharomyces cerevisiae; ST1.1 and ST1.3 were 28.88% and 31.58% homologous, respectively, to Hxt p (sugar transporter) in Saccharomyces cerevisiae.

TABLE 1Blast search alignment homologous proteins

In Saccharomyces cerevisiae, some inducers of these promoters are well defined. The GAL1 gene promoter is induced by D-galactose and inhibited by glucose as a carbon source. The ADH2 gene promoter was inhibited by glucose, the ADH2 gene promoter was not induced in most species, but a specific ADH2 promoter was isolated in Pichia pastoris, which was not under glucose control, but was oxygen dependent (low O ₂ Horizontal induction). The ICL1 gene promoter is inhibited by glucose and strongly induced by ethanol or acetate. ST1.1 and ST1.3 are highly similar to hexose transporter levels in saccharomyces cerevisiae, and these promoters are generally inhibited at high glucose concentrations and induced when the glucose concentration falls below a certain level. In candida bumpy, none of these promoters was characterized, and induction or inhibition at different carbon sources was tentatively understood.

The promoter sequence selected in the present application selects the sequence between the homologous protein coding gene and the upstream gene of the protein as the promoter sequence through sequence analysis, and is used for promoting protein expression. Wherein the Padh promoter sequence is shown as SEQ ID NO.1, the Picl promoter sequence is shown as SEQ ID NO.2, the Pst1.3 promoter sequence is shown as SEQ ID NO.3, and the Pst1.1 promoter sequence is shown as SEQ ID NO. 4.

Example 2: qPCR analysis of transcriptional Activity of promoters under different carbon Source cultures

The transcriptional activity of each promoter in different carbon source cultures was measured, and the promoters included YPD medium, carbon source-free medium (YP) without glucose added to YPD medium, D-galactose medium (YPG), ethanol medium (YPE) and sodium citrate medium (YPA) were each 1% of glucose in YPD.

TABLE 2 primers used in this example

Gene	Upstream primer sequences	Downstream primer sequences
			actin	GTCATCTGCTCAACGAACTGTAT	ATGTCCTTCTGAGCGGTCTG
Galk	ATTGTCAGAAGCCCTGGTCG	TGCACTTTGCCAAAACCTGG
			Adh	TGGACCCCTCAAGGTTCTGA	TGGCGTCTAGCACAAAACGA
Icl	GTGCGTGAGGGATACTACCG	GTGGTCCAGTTGAAGGAGGGG
			St1.1	ACGGCGCAATACAGGATCAA	GGGCCAAACTGAAAGCTGTG
St1.3	CCGACATAACAATGGCGCAG	TTGAAGCACCAATTCGCAGC

Preparation of a bacterial strain: the preparation method comprises the steps of selecting a candida bumpy raw material, performing single clone on the candida bumpy raw material to be cultured overnight in a YPD culture medium, transferring the candida bumpy raw material to culture in a culture medium containing 1% glucose (YPD), 1% D-galactose (YPG), 1% ethanol (YPE), 1% sodium citrate (YPA) and no sugar (YP) respectively, and taking thalli in a logarithmic growth phase to extract RNA for measuring the transcription level.

RNA extraction: RNA was extracted using the Rapid extraction kit for polymeric Meyer M5 EASYspin Yeast RNA.

1) 1ml (about 10) ⁷ Cells) in the logarithmic growth phase into 1.5ml centrifuge tubes, centrifugation at 12,000rpm for 30 seconds, and the supernatant was discarded as much as possible.

2) Add 100. Mu.l buffer SE (confirm that β -mercaptoethanol has been added to a final concentration of 0.2%), gently blow and fully resuspended cells; about 20. Mu.l of the snail enzyme stock solution was added according to the amount of yeast, mixed well by inversion, incubated at 37℃for 15-30 minutes to digest the cell wall, and the middle was inverted several times to aid digestion.

3) 380 μl of lysate RLT (confirming that β -mercaptoethanol has been added to a final concentration of 1%) was added, and after mixing by air-beating, shaking vigorously by hand for 20 seconds, and cleavage was complete. In general, no obvious lumps or insoluble substances should be seen after the sufficient vortex blowing after the addition of the lysate, and in rare cases if there are obvious lumps or insoluble substances, the lysate can be centrifuged at 13,000rpm for 3 minutes, uncleaved fragments or insoluble substances are precipitated, and the lysate supernatant is transferred to a new centrifuge tube for further processing. 280 μl of 96-100% ethanol was added, immediately blown and mixed without centrifugation.

4) The mixture was put into an adsorption column RA (the column was put into a collection tube), centrifuged at 13,000rpm for 30-60 seconds, and the waste liquid was discarded.

5) Mu.l of deproteinized liquid RW1 was added thereto, left at room temperature for 30 seconds, centrifuged at 12,000rpm for 30 seconds, and the waste liquid was discarded.

If DNA residues are apparent, they can be left at room temperature for 5 minutes after RW1 addition and centrifuged again.

6) Mu.l of rinse solution RW (please check whether absolute ethanol has been added-! ) Centrifuge at 12,000rpm for 30 seconds, discard the waste liquid. Mu.l of rinse RW was added and repeated.

7) The adsorption column RA was put back into the empty collection tube, centrifuged at 13,000rpm for 2 minutes, and the rinse solution was removed as much as possible to prevent the residual ethanol in the rinse solution from inhibiting downstream reactions.

8) The column RA was removed, placed in a sterile centrifuge tube, 30-50. Mu.l of DEPC treated water (previously heated in a water bath at 70-90 ℃ C. To increase the yield) was added to the middle portion of the adsorption membrane according to the expected RNA yield, and the mixture was left at room temperature for 1 minute and centrifuged at 12,000rpm for 1 minute.

9) If RNA yield > 30. Mu.g is expected, step 7 is repeated with 30-50. Mu.l DEPC treated water, the eluates are combined, or the steps are repeated one time with the first eluate added back to the column (if high RNA concentration is required).

RNA concentration was measured using an ultra-micro spectrophotometer.

Reverse transcription: primeScript Using TAKARA reagent ^TM RT reagent Kit with gDNA Eraser (Perfect Real Time) is subjected to reverse transcription to obtain a template cDNA for reaction.

1) Genomic DNA removal reaction

The reaction mixture was prepared on ice as follows: 5X gDNA Eraser Buffer in 2.0. Mu.l, gDNA Eraser in 1.0. Mu.l, total RNA <1ug, DEPC treated water to 10. Mu.l.

Preparing a premix according to the reaction number of +2, then sub-packaging the premix into each reaction tube, and finally adding an RNA sample.

The reaction procedure: 42 ℃ for 2min (or room temperature for 5 min), and 4 ℃ for constant temperature.

2) Reverse transcription reaction

The reaction solution was prepared on ice: the reaction solution of step 1 was used in an amount of 10.0. Mu.l, primeScript RT Enzyme Mix I was used in an amount of 1.0. Mu.l, RT Primer Mix was used in an amount of 1.0. Mu.l, 5X PrimeScript Buffer (for Real Time) was used in an amount of 4.0. Mu.l, DEPC treatment water was used in an amount of 4.0. Mu.l, and the total volume was 20. Mu.l.

The premix was prepared in the amount of +2, and then 10. Mu.l was dispensed into each reaction tube. After gentle mixing, reverse transcription was immediately performed.

The reaction procedure: 15min 6 at 37 ℃, 5sec at 85 ℃ and constant temperature at 4 ℃.

qPCR: fluorescence quantitative PCR reactions were performed using full gold PerfectStart Green qPCR SuperMix. The qPCR reaction system was configured as follows: the amount of cDNA template was 1. Mu.l, forward primer (10M) was 0.4. Mu.l, reverse primer (10M) was 0.4. Mu.l, 2xPerfectStarr Green qPCR SuperMix was 10. Mu.l, and DEPC treated water was added to 10. Mu.l.

The reaction procedure: 94 ℃ for 30sec, circulation section: 94℃for 5sec,50-60℃for 15sec,72℃for 10sec,40-45 cycles.

The transcription level of each promoter under YPD culture conditions was set to 1, and the relative transcription levels under other carbon source culture conditions were calculated. As a result, as shown in FIG. 1, the Pgalk promoter (GenBank: KU 172440.1) had the weakest response to the carbon source, and the transcript level of Pgalk under D-galactose conditions was consistent with that of glucose, indicating that D-galactose in Candida bumblebee has almost no inducibility to Pgalk. Padh promoter has strong inducibility under D-galactose condition, and the transcription level is improved by three times compared with that under glucose condition. The Picl promoter has the strongest inducibility under sodium citrate conditions, and is 12-fold higher than that under glucose conditions, and is also nearly 5-fold higher than that under ethanol conditions. The Pst1.3 promoter was inhibited by glucose and the transcription level was increased 13-fold under sugarless conditions relative to glucose conditions. In addition, D-galactose and ethanol had inducibility to Pst1.3, and the transcriptional level after D-galactose induction was 19-fold higher than that after glucose induction, and the transcriptional level after ethanol induction was 21-fold higher.

Unlike the inducible promoter mentioned previously, the Pst1.1 promoter responds to the carbon source with the strongest response to glucose and the weakest D-galactose with ethanol (FIG. 1). When the environment does not contain a carbon source, st1.1 is hardly expressed, the D-galactose induced transcription level is improved by 3.4 times, the ethanol induced transcription level is improved by 8.2 times, and the glucose induced transcription level is improved by 20 times.

The transcription level of each promoter before and after induction was measured (results are shown in FIG. 2). The transcription level of the reference gene before and after induction by the optimal inducer was calculated for each promoter with the transcription level of the reference gene under YPD culture conditions set to 1. Among them, the basal transcription level of the Pgalk promoter is 0.8 times that of the reference gene, and there is little inducibility. Padh has a basal transcriptional activity lower than that of the reference gene and a slightly higher level of transcription after induction than that of the reference gene. The Picl promoter itself has a basal transcription level 6 times that of the reference gene and a transcriptional activity 80 times that of the reference gene after induction. The pst1.1 promoter had a lower level of transcription before and after induction. The Pst1.3 promoter had very low levels of transcription before induction, compared to the reference gene, which was almost not expressed, and the levels of transcription after induction were 1.3 times that of the reference gene. The result shows that the Picl promoter has higher transcription level after induction and is more suitable for high-level expression of protein; the basic transcription level of Pst1.3 is lower, and is more suitable for realizing accurate regulation and control of gene editing and the like, such as transcription regulation and control of genes such as Cas9, rec and the like.

Example 3: efficient gene editing based on inducible promoters

For non-model strains with few selection markers, resistance recovery is an important means to achieve multiple rounds of gene editing. The candida bumblepeak is a non-model strain, and available resistance screening markers only comprise hygromycin and Noralserin, so that a Recsix system under the control of a Pgalk promoter is the only polygene editing system capable of realizing resistance recovery in the candida bumblepeak at present. However, the Pgalk promoter has low induction level and low stringency, so that the editing efficiency of the system is low, and the target engineering strain is difficult to screen. The application establishes a high-efficiency resistance recovery method based on the newly excavated inducible promoter.

The application establishes a high-efficiency resistance recovery method by using the Pst1.3 promoter, and the resistance recovery process is shown in figure 3. Under the condition of ethanol or D-galactose, the Pst1.3 promoter is used for inducing the expression of Rec recombinase, the Rec recombinase can recognize the six sequences, and fragments between the two six sequences are excised, and a single six sequence is left, so that the recycling of the resistance gene is realized. Because of the low leakage expression level of Pst1.3, compared with the original Recsxi system, the recombination system has more positive transformants after electrotransformation, and the higher transcription level after induction leads to higher efficiency of induced excision and is improved by nearly 4 times.

3.1 construction of resistance recovery expression cassettes

The original Pgalk promoter is replaced by the Pst1.3 promoter to construct a Recsix system, and an A gene overexpression box containing the Pgalk/Pst1.3-Recsix system at the PXA1 gene locus is constructed. The Pgalk-Recsix sequence is synthesized by Nanjing Jinsri and is shown as SEQ ID NO. 6; the Pst1.3-Recsix sequence is constructed on the basis of Pgalk-Recsix, the Pst1.3 promoter is substituted for the Pgalk promoter, the sequence is shown as SEQ ID NO.5, and the construction process is as follows:

primers in this experiment:

primer name	Primer sequences
		PUC-Kana-F	TCACCGTCATCACCGAAAC
PUC-Kana-R	GAGGCGGTTTGCGTATTG
		PXA1-ZUOBI-F	gtttcggtgatgacggtgacttctgggaatgatgctact
PXA1-ZUOBI-R	GCACACGCACCCTAAGCACCgcgatgcacttacactatca
		Pgki-F	GGTGCTTAGGGTGCGTGT
Ttrpc-R	agaccgtggagagccGCGGCCGCGAAGAGCaacccaggggc
		PXA1-YOUBI-F	GCGGCCGCggctctccacggtctattat
PXA1-YOUBI-R	caatacgcaaaccgcctctccaacgcaaaatccggc
		ST1.3-Apal-R	ACGGGGGCCCGCTTTGCTGCAATTCAGC
STL1.3-Ascl-F1	TGCAAAGgcgcgccTAGAAACAATGTGGCCGAAT
		SIX-F1	AAGTAAGGGCCCatggccaagatcggctac
SIX-R1	TAAAggcgcgccTTTGCACATACATACGCG

The primer PUC-Kana-F, PUC-Kana-R was used to amplify the Cana resistance marker gene and ori sequence in E.coli using Puc-Kana as template. The primer PXA1.ZUOBI-F, PXA1-ZUOBI-R is used for amplifying a 1KB homology arm sequence on the left side of a pXA gene by taking the genome of the bumblebee candida as a template, and the primer PXA1-YOUBI-F, PXA-YOUBI-R is used for amplifying a pXA 1KB homology arm sequence on the right side of the gene. The Pgki promoter, A, ttrpc terminator ligation sequence was synthesized from Nanjing Jinsri and its full length sequence was amplified using primer Pgki-F, ttrpc-R. The fragments are utilized to fully utilize goldUni Seamless Cloning and Assembly Kit the above fragments were spliced and transformed into E.coli competent cells. Colony PCR identification was performed using primers PXA1-ZUOBI-F, PXA1-ZUOBI-R, and plasmid extraction was performed to verify that the pretreatment was metDuring the phase, plasmid pAB1 was constructed.

The Pgalk-Recsix sequence was synthesized by Nanjing Jinsrui, inc., and cloned upstream of the right homology arm of pAB1 plasmid pAX1 to construct plasmid pGAB1 (FIG. 4A). The primers SIX-F1 and SIX-R1 were used to linearize the vector using the plasmid pGAB1 as a template, the primers ST1.3-Apa1-R, STL1.3-Asc1-F1 were used to amplify the 1kb sequence upstream of the ST1.3 gene as a promoter sequence fragment using the S.bumblebee genome as a template, the above fragment and vector were digested with Apa1, asc1 restriction endonucleases, and the above fragment and vector were ligated using T4 ligase. Colony PCR was performed using primers ST1.3-Apa1-R, STL1.3-Asc1-F1 to select transformants, and plasmid pSAB1 was constructed as expected by restriction enzyme verification (FIG. 4B). Plasmid pSAB1 comprises the resistance recovery expression cassette Pst1.3-Recsix.

3.2 construction of a non-resistant engineering Strain S22214 (Ppgki:: A,. DELTA.PXA1) using the Pst1.3-Recsix Gene editing System

Primers used in this experiment

Primer name	Primer sequences
		YZ-HYG-F	accgatggctgtgtagaag
YZ-HYG-R	tgccgccagaggatttat
		YZ-ZUO-F	tccatactgggaccaacaa
CX-R1	GCCATCGGTGAGACGGGTTT
		CX-R2	tcagaaacagccgagaacc

The expression cassette was amplified with pGAB1, pSAB1 templates using the primers PXA1-ZUOBI-F, PXA1-YOUBI-R, respectively. The expression cassette and yeast competent cells to be transformed were transferred to a pre-chilled 2mm electrobeaker. After standing on ice for 5min, carrying out electric transfer by using an electric transfer instrument, wherein the parameter is 15KV (200Ω), and the electric shock time is 5ms. The cells were resuspended using 1mL of pre-chilled 1M sorbitol and incubated at 30℃for 1.5h in a 200rpm shaker. Mu.l of the bacterial liquid was taken out and plated on YPD plates containing hygromycin (working concentration: 500 mg/L) and incubated at 28℃for 2d.

The right-exchanged recombinant strain was screened using the primer YZ-HYG-F, YZ-HYG-R with transformant colonies as templates. As shown in FIGS. 5A and 5B, the number of transformants carrying the Pst1.3-Recsix expression cassette was significantly better than the number of transformants carrying the Pgalk-Recsix expression cassette.

Further, the positive transformants were cultured in YPG medium at 30℃and in a shaker at 200rpm for 18 hours, and the bacterial liquid was diluted and plated on YPD plates. Single colonies were picked and transferred to YPD plates and hygromycin-containing plates, respectively, and placed in a 28℃incubator for cultivation. After 24h, the target transformants were not grown in plates containing the antibiotic but grown well in plates. As a result, as shown in FIG. 6A, the Recsix system transformants under Pgalk control were screened for 179 single colonies, 2 of which were expected (circled transformants). The Pst1.3-Recsix system transformants were screened for a total of 79 single colonies, 4 of which were expected (as shown in FIG. 6B, where the circled transformants). The results show that the Pst1.3-Recsix system induces 4 times more efficiency than the Pgalk-Recsix system.

Further, the target transformant Pxa1 gene locus sequence was amplified using the primers YZ-HYG-F, YZ-ZUO-F, submitted to the biological engineering Co., ltd, and sequenced with the sequencing primers CX-R1 and CX-R2. As shown in FIG. 7, the pxa1 locus sequencing results showed that the six sites had recombined and the hygromycin resistance gene had been lost, and that the genome retained only 1 six site.

Claims (7)

1. The inducible promoter in the bumblebee candida is characterized in that the nucleotide sequence of the promoter is shown as SEQ ID NO. 2.

2. An expression vector comprising the promoter of claim 1.

3. Use of the promoter according to claim 1 for expression of a gene of interest.

4. The use according to claim 3, wherein the promoter is linked to a gene of interest for promoting expression of the gene of interest.

5. Use of the promoter according to claim 1 for genetic engineering of candida bumblebee.

6. The use according to claim 5, wherein said promoter is used to induce expression of a gene of interest.

7. The application according to claim 6, characterized in that it comprises in particular the following steps:

s1, recombining and cloning a left homologous arm and a right homologous arm of a site to be integrated, ori and kana resistance gene fragments suitable for escherichia coli and an overexpression box of a target gene to obtain an integrated expression vector;

s2, connecting the integrated expression vector obtained in the step S1 with a Rec/six system to obtain an integrated expression vector with resistance recovery;

s3, connecting the promoter to the S2 to obtain a novel integrative expression vector capable of recovering resistance;

s4, transferring the integrated expression vector obtained in the step S3 into a bumblebee candida growing host strain to obtain the non-resistance over-expressed bumblebee candida growing recombinant strain.