CN117003855B

CN117003855B - T cell receptor and application thereof

Info

Publication number: CN117003855B
Application number: CN202311211460.4A
Authority: CN
Inventors: 任之尧; 朱国栋; 张蓓
Original assignee: Guang Zhoushilaorenyuan
Current assignee: Guang Zhoushilaorenyuan
Priority date: 2023-09-20
Filing date: 2023-09-20
Publication date: 2024-02-23
Anticipated expiration: 2043-09-20
Also published as: CN117003855A

Abstract

The invention belongs to the technical field of immunotherapy, and particularly relates to a T cell receptor and application thereof. The technical problem to be solved by the invention is to provide a new choice for TCR-T cell therapy. The invention provides a T cell receptor for recognizing MAGE-A10 epitope peptide. The T cell receptor can target MAGE-A10 epitope peptide, and provides a new way for the immunotherapy of melanoma related antigen A10 related tumors.

Description

T cell receptor and application thereof

Technical Field

The invention belongs to the technical field of immunotherapy, and particularly relates to a T cell receptor and application thereof.

Background

The Melanoma Antigen Gene (MAGE) -A10 is a member of the melanoma antigen gene family, and the expression product is a tumor-related antigen, which is expressed only in tumor tissues, testes and placenta tissues, and is recognized by cytotoxic T lymphocytes after being combined with human leukocyte antigen-I type molecules, so that tumor cells are specifically killed. The MAGE-A subfamily has a strict expression pattern, and MAGE-A10, which is a novel molecule of the MAGE-A family, is attracting attention because of its potential role in tumor cell-specific high expression and high tumor immunogenicity.

MAGE-A10 antigen is processed in cells to produce polypeptide fragments that are co-presented with cell surface Human Leukocyte Antigens (HLA) to form epitopes recognized by natural T Cell Receptors (TCRs) with a defined affinity. HLA-A 02:01 allele is the most common MHC allele subtype in Chinese population, and we have previously identified epitope peptide SLLKFLAKV derived from MAGE-A10 antigen, which can induce activation and killing of CD8T cells, using an in vitro antigen presentation system.

The TCR-T cell therapy principle is to transfect TCR alpha and TCR beta chain genes capable of recognizing tumor specific antigens into T cells, so that the TCR antigen binding region of the T cells is structurally changed, thereby being capable of specifically recognizing the corresponding tumor antigens, and then amplifying and inputting the corresponding tumor antigens back into a human body in vitro, and the T lymphocytes expressing the tumor antigen specific TCR (can recognize HLA-peptide complexes on the surfaces of the tumor cells) are used for triggering the immune effect of the T cells, so that the purpose of killing the tumor cells is achieved. Thus, identifying a specific TCR for MAGE-A10 is of great interest for the treatment of MAGE-A10 positive solid tumor TCR-T cells.

Disclosure of Invention

The technical problem to be solved by the invention is to provide a new choice for TCR-T cell therapy.

The technical scheme of the invention is a T cell receptor, and the T cell receptor specifically recognizes MAGE-A10 epitope peptide.

Further, the amino acid sequence of the MAGE-A10 epitope peptide is shown as SEQ ID No. 5.

In particular, the T cell receptor comprises an alpha chain and/or a beta chain; the alpha chain comprises CDR3 with an amino acid sequence shown as SEQ ID No. 1; the beta chain comprises CDR3 with an amino acid sequence shown as SEQ ID No. 2.

Further, the CDR3 region of the α chain is upstream of the V region of the TCR and downstream of the CDR3 region is the J region of the TCR.

In particular, the amino acid sequence of the alpha chain is shown in SEQ ID No. 3.

Further, the CDR3 region of the β chain is upstream of the V region of the TCR and downstream of the CDR3 region is the J and C regions of the TCR.

Specifically, the amino acid sequence of the beta chain is shown as SEQ ID No. 4.

The invention also provides nucleic acid molecules encoding the T cell receptors.

The invention still further provides an expression cassette, vector, cell or host expressing the T cell receptor or comprising a nucleic acid molecule encoding the T cell receptor.

Wherein the vector is an expression vector.

Further, the expression vector is a viral vector.

Still further, the viral vector is a lentiviral vector or an adenoviral vector.

In particular, in the vector, the nucleic acid sequences of the alpha and beta strands are linked by a 2A self-cleaving peptide.

Wherein the nucleotide sequence of the 2A self-cleaving peptide is shown as SEQ ID No. 6.

Further, cells expressing the T cell receptor or comprising a nucleic acid molecule encoding the T cell receptor are heterologous or autologous.

Wherein the cell expressing the T cell receptor or comprising a nucleic acid molecule encoding the T cell receptor is a T cell or a Jurkat cell.

Preferably, the T cells are cd8+.

The invention also provides the application of the T cell receptor, the nucleic acid molecule for encoding the T cell receptor, or an expression cassette, a vector, a cell or a host for expressing the T cell receptor or containing the nucleic acid molecule for encoding the T cell receptor in preparing antitumor vaccines or antitumor drugs.

Further, the tumor is lung cancer, melanoma, bladder cancer, head and neck cancer or liver cancer.

The invention still further provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier; also included are the above-described T cell receptors, the above-described nucleic acid molecules encoding the T cell receptors, or expression cassettes, vectors, cells or hosts expressing the T cell receptors or comprising nucleic acid molecules encoding the T cell receptors.

The invention has the beneficial effects that: the invention provides a T cell receptor for recognizing MAGE-A10 epitope peptide. The T cell receptor can target MAGE-A10 epitope peptide, and the TCR is used for constructing TCR-T cells, so that the T cell receptor has remarkable killing effect on tumors expressing melanomA-Associated antigen A10. The invention provides a new way for the immunotherapy of tumors related to melanoma related antigen A10.

Drawings

FIG. 1 is a graph of UMAP visualization results for candidate TCRs; a: UMAP visualization result diagram of sample MAGE-A10-1; b: UMAP visualization results for sample MAGE-A10-2. CCR7high CD 8T: CD8T cells with high expression of CCR7 gene; effector CD 8T: effector CD8T cells; cycling CD 8T: CD8T cells in the cell proliferation phase; the different colored dots represent the distribution of the different TCRs screened.

FIG. 2 shows green fluorescence of GFP under each group of cell microscopes. 18121ctrl:18121 empty plasmid control; TCR24: recombinant plasmid set transferred into TCR 24.

FIG. 3 is a graph showing the results of flow-through detection of TCR. Alpha./. Beta. In Jurkat76 cells. WT: jurkat76 wild-type cells, which do not express TCR themselves; 18121ctrl: jurkat76 cell control transfected with 18121 empty plasmid; flu ctrl: influenza double-stranded TCR (flu-TCR) was transferred into the Jurkat76 cell group as a positive control; TCR24: a Jurkat76 cell group transfected with TCR 24.

FIG. 4 is a graph showing the results of flow-through detection of CD69 expression by Jurkat76 cells under co-culture conditions of TCR-T cells and T2 cells; a: a graph of the results of the detection of CD69 activation in cells; b: bar graph of CD69 activation in cells. 18121ctrl: jurkat76 cell control transfected with 18121 empty plasmid; flu ctrl: influenza double-stranded TCR (flu-TCR) was transferred into the Jurkat76 cell group as a positive control; TCR24: jurkat76 cell group transfected with TCR24, no pep: no epitope peptide was added; MAGE-A10 pep: addition of MAGE-A10 _310-318 An epitope peptide.

FIG. 5 is a graph showing the results of flow-through detection of CD69 expression by Jurkat76 cells under co-culture conditions of TCR-T cells and PC9 cells; a: a graph of the results of the detection of CD69 activation in cells; b: bar graph of CD69 activation in cells. 18121ctrl: jurkat76 cell control transfected with 18121 empty plasmid; flu ctrl: influenza double-stranded TCR (flu-TCR) was transferred into the Jurkat76 cell group as a positive control; TCR24: jurkat76 cell group transfected with TCR24, no pep: no epitope peptide was added; MAGE-A10 pep: addition of MAGE-A10 _310-318 An epitope peptide.

FIG. 6 is a graph showing the survival of CFSE red fluorescence detection PC9 cells; a: red fluorescent photographing representative pictures of each group of cells; b: histogram of viable cell count. 18121ctrl: jurkat76 cell control transfected with 18121 empty plasmid; flu ctrl: influenza double-stranded TCR (flu-TCR) was transferred into the Jurkat76 cell group as a positive control; TCR (thyristor controlled reactor)24: jurkat76 cell group transfected with TCR24, no pep: no epitope peptide was added; MAGE-A10 pep: addition of MAGE-A10 _310-318 An epitope peptide.

Detailed Description

The invention will be further described in detail with reference to the drawings and specific examples, which are given solely for the purpose of illustration and are not intended to limit the scope of the invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials, reagents and the like used, unless otherwise specified, are those commercially available.

Example 1 prediction of HLA-A2 restricted epitope peptides of MAGE-A10

HLA-A2 restricted epitope prediction was performed on MAGE-A10 using MHC class I molecular prediction tools (http:// tools. IEDB. Org/mhci /) provided by the United states NIH epitope database (IEDB). The optimal peptide was selected as a candidate epitope based on the IC50 and Vaxijen scores. MAGE-A10 screening _310-318 The epitope peptide information specific for HLA-A2 restricted cd8+ T cells is shown in table 1.

TABLE 1MAGE-A10 _310-318 Epitope peptide information

Epitope of antigen	Position of	Sequence(s)	ann_IC50	vaxijen	Molecular weight
						MAGE-A10	310～318	SLLKFLAKV(SEQ ID No.5)	8.19	0.4604	1018.3

Example 2 screening of TCR for the recognition of MAGE-A10 epitope peptide

According to MAGE-A10 _310-318 Epitope peptide specific cd8+ T cell single cell transcriptome sequencing and TCR sequencing raw Fastq data the following data analysis was performed: 1) Differentiation of each specific CD8+ T cell based on cell barcode, differentiation of each mRNA molecule based on UMI, MAGE-A10 pair by existing marker genes _310-318 Grouping epitope peptide specific CD8+ T cells; 2) MAGE-A10 was obtained by counting the frequency of occurrence of the alpha and beta chains of each sample TCR and correlating each sample TCR to the single cell transcriptome data obtained in step 1) by cell barcode _310-318 Information on the specific TCR alpha and beta chains of the epitope peptide and information on the transcriptome of the cell in which the TCR is located; 3) UMAP visualization was performed on the cell grouping results.

The results of cell grouping visualization are shown in FIG. 1, including CCR7 ^high CD8+ T, effector CD8T cell populations (effector CD8T cells) and proliferating CD8T cell populations (cycling CD8T cells), wherein candidate TCR24 occurs simultaneously in two replicates of MAGE-A10-1 and MAGE-A10-2, with the highest frequency of clones and is located in effector CD8T cell populations.

The information for the α and β chains of TCR24 is shown in table 1, SEQ ID No.1 shows the amino acid sequence of the CDR3 region of the α chain of TCR24, the V region of TCR upstream of the CDR3 region, the J region of TCR downstream of the CDR3 region; SEQ ID No.2 shows the amino acid sequence of the β chain CDR3 region of TCR24, upstream of the CDR3 region the V region of the TCR and downstream of the CDR3 region the J and C regions of the TCR.

TABLE 2 alpha and beta chain information for MAGE-A10 antigen specific TCR

Example 3 preparation of TCR-T cells

1. Experimental method

(1) Determination of alpha and beta chain sequences of TCR

The amino acid sequences of the V region, J region and C region of the alpha and beta chains of the TCR were found using the IMGT database (http:// www.imgt.org /) according to the information of the alpha and beta chains of the candidate MAGE-A10 antigen-specific TCR described in Table 2, and the V region, J region and CDR3 region were spliced according to the uniprot database (https:// www.uniprot.org /) query results (amino acid sequences corresponding to the respective TCR) to obtain the amino acid sequences of the alpha and beta chains of the TCR, as shown in Table 3.

TABLE 3 amino acid sequences of alpha and beta chains of TCR

(2) Construction of recombinant plasmids

Synthesizing nucleic acid sequences encoding the alpha and beta chain correspondences of TCR24 shown in table 3 of step (1), ligating the alpha and beta chain nucleic acid sequences of TCR24 via a 2A self-cleaving peptide (SEQ ID No. 6) to give a ligation fragment, and synchronously subcloning the ligation fragment into the vector via the cleavage sites 5'ecori (GAATTC) and 3' bamhi (GGATCC): in 18121 plasmid (https:// www.addgene.org/18121 /), 4. Mu.g of plasmid dry powder is obtained, the instant centrifugation is carried out for 3min, 40. Mu.L of sterilized water is added to obtain 100 ng/. Mu.L of plasmid diluent, and the mixture is stirred uniformly and then is kept at room temperature for standby.

SEQ ID No.6：gtgaaacagactttgaattttgaccttctcaagttggcgggagacgtggagtccaacccagggccc

mu.L of plasmid dilutions (TCR 24 and 18121ctrl control plasmid) and 50. Mu.L of Stbl3 competent cells were mixed in an EP tube, and after mixing, the mixture was allowed to stand on ice for 30min, then water was used for 60s in a 42℃water bath, and after completion of the water bath, the EP tube was inserted into ice and allowed to stand for 3min to give an EP tube containing the recombinant strain.

To the EP tube containing the recombinant strain, 300. Mu.L of LB liquid medium was added, and the mixture was placed in a shaking table and shaken at 37℃and 225rpm for 60 minutes to obtain a bacterial solution.

Wherein the LB liquid medium comprises: 5g of NaCl, 5g of tryptone, 2.5g of yeast powder and 500mL of UP water; mixing the above materials, cooling under high pressure, and preserving at 4deg.C to obtain LB liquid medium.

Inoculating 100 mu L of bacterial liquid onto an LB plate, uniformly coating the bacterial liquid on the LB plate by using a coating rod, sealing, inverting, and culturing overnight in an incubator at 37 ℃ for 12-16 hours to obtain a plate full of single bacteria.

Wherein the LB plate comprises: 5g of NaCl, 5g of tryptone, 5g of yeast powder, 10g of agar powder and 500mL of UP water; mixing the above materials, heating, cooling to 50deg.C under high pressure, adding Amp to final concentration of 50 μg/mL, shaking, pouring into sterile culture dish, and preserving at 4deg.C to obtain LB plate.

200mL of LB liquid culture medium is taken, amp is added until the final concentration of Amp is 50 mug/mL, and after uniform mixing, the mixture is split into sterile shaking tubes (10 mL/tube) to obtain the Amp-resistant LB liquid culture medium.

Picking single bacteria on a flat plate full of single bacteria, placing the single bacteria in a shaking tube containing 10mL of Amp-resistant LB liquid culture medium, placing the shaking tube added with the single bacteria in a shaking table, and shaking the shaking table at 37 ℃ and 225rpm for 12-16 hours to obtain a shaking bacterial liquid.

The bacterial liquid after shaking is split-packed into an EP tube, centrifuged for 1min at 1300rpm, bacterial precipitate is collected, plasmid in bacterial precipitate is extracted by EndoFree Plasmid Midi Kit (Cwbio, cat#CW2105S) to obtain recombinant plasmid (TCR 24), the concentration of recombinant plasmid (TCR 24) and 18121ctrl control plasmid is detected by a spectrophotometer, and the recombinant plasmid is preserved at-80 ℃ for standby.

(3) Lentivirus package

Taking 5×10 ⁶ The 293T cells were spread in 10cm dishes at 37℃with 5% CO ₂ And (v/v) culturing in an incubator until the confluence is 70-90%, and replacing the culture medium with a fresh DEME high-sugar culture medium to obtain the 293T cells to be transfected.

To EP tube 1, 28. Mu.L of Lipo8000 transfection reagent (Beyotime, cat#C0533) and 272. Mu.L of Opti-MEM medium (Gibco, cat# 31985070) were added, and the mixture was allowed to stand at room temperature for 5min.

Mu.g of pCMV-VSV-G plasmid, 3. Mu.g of pMDLg pRRE plasmid, 3. Mu.g of pRSV-Rev plasmid, 9. Mu.g of the recombinant plasmid (TCR 24) obtained in step (2) or 18121ctrl control plasmid were added to EP tube 2, and the whole was supplemented with Opti-MEM medium (Gibco, cat # 31985070) to 300. Mu.L, and left to stand at room temperature for 5min.

Adding the liquid in the EP pipe 1 into the EP pipe 2, uniformly mixing, and standing at room temperature for 20min to obtain a mixed liquid. Adding the mixed solution into DEME high sugar culture medium containing 293T cells to be transfected dropwise, shaking, standing at 37deg.C, and 5% CO ₂ (v/v) culturing in an incubator for 6 hours, and then replacing the culture medium with a new DMEM high-sugar culture medium in a biosafety cabinet for transfection.

After 24h transfection, observing the cell state, wherein the cell is pollution-free and has good growth state (pollution-free and cell is not fallen off in large pieces); after 48 hours of transfection, collecting cell supernatant liquid to obtain virus liquid 1; after 72h transfection, the supernatant fluid of the cells was collected to obtain virus liquid 2. Virus solution 1 and virus solution 2 were mixed and centrifuged at 3500rpm for 10min, the supernatant was collected and filtered through a 0.45 μm filter into a new centrifuge tube to obtain a filtrate, which was concentrated using a universal virus concentration kit (Beyotime, cat#c2901L) to obtain virus concentrates (TCR 24 and 18121 ctrl) and placed in a 1.5mL EP tube for use.

(4) Lentivirus infects cells

Preparation of 400. Mu.L of Jurkat76 cells (2.5X10) in the logarithmic growth phase by using RPMI-1640 complete medium ⁵ mu.L of the virus concentrate obtained in the step (3) (and 18121 ctrl) was added thereto, and after gentle mixing, the cells were inoculated into a 24-well plate, centrifuged at 1000 Xg for 60min, and then placed at 37℃in 5% CO ₂ Culturing in a culture box for 12-16 h, and changing the liquid.

Observing and photographing under a fluorescence microscope after 72h of infection, and observing the fluorescence condition of cells;

96h after infection, cells from 24 well plates were collected in 1.5mL EP tubes, centrifuged at 200 Xg for 5min, the supernatant was discarded, the pellet was resuspended in 100. Mu.L of 1% BSA (1 g BSA+100mL PBS) to give a heavy suspension, 2. Mu.L of TCR. Alpha./beta. -APC antibody (BioLegend, cat # 306718) was added to the heavy suspension for staining, and then the expression of the. Alpha./beta. TCR was detected on-stream, and cells positive for expression were TCR-T cells (TCR-24).

Blank (WT) set as Jurkat76 wild-type cells (WT, not expressing TCR by itself); control (18121) was set up to transfer influenza double-stranded TCR (flu-TCR) into Jurkat76 cells transfected with 18121 empty plasmid, flu ctrl being the pre-laboratory.

TCR expression results were observed on-stream for the blank (WT) and control (18121) groups, respectively.

2. Experimental results

The spectrophotometric detection results of each plasmid are shown in Table 3.

TABLE 3 spectrophotometric detection results of plasmids

Recombinant plasmid designation	Concentration (μg/μl)	A260/A280
			18121ctrl	230.2	1.92
Recombinant plasmid (TCR 24)	226.2	1.92

The results show that: the A260/A280 of the 2 recombinant plasmids has the value of 1.80-2.0 and can be used for lentivirus packaging.

Cell transfection was observed by fluorescence, and the results are shown in FIG. 2. Jurkat76 cells were infected with 18121ctrl and TCR24 lentivirus for 72h, and GFP green fluorescence positive expression of the cells indicated successful plasmid transfection into Jurkat76 cells.

The detection result of the flow type on-line is shown in fig. 3, and the result shows that: the TCR positivity of the blank (WT) was 0% and that of the control (18121) was 1.99%, indicating that Jurkat76 cells and 18121 plasmid did not express TCR; the TCR positive rate of flu ctrl was 86.5% and that of TCR-T cells (TCR 24) was 28.1%. The results illustrate: the TCR-T cell constructed by the recombinant plasmid can effectively express TCR.

Example 4 in vitro activation of Jurkat76 cells

(1) Experimental method

T2 cells in the logarithmic growth phase were treated with mitomycin at 20. Mu.g/mL for 30min and washed 2 times with PBS. Add 1mL IMDM complete media to resuspend and count. Adjusting the cell concentration to 5×10 ⁵ cells/mL. Addition of MAGE-A10 _310-318 Epitope peptides (synthesized by GenScript, gold-sri organism) were prepared in a concentration of 10 μm in cell suspension. T2 cells at 1X 10 ⁵ Number of wells/well 96-well plates were placed at 37℃with 5% CO ₂ Culturing in an incubator of (v/v) for 4h to load the T2 cells with MAGE-A10 _310-318 Epitope peptide forming a peptide capable of presenting MAGE-A10 _310-318 Is a cell for antigen presentation.

The TCR-T cells constructed in example 3 were counted to prepare a cell suspension at a concentration of 1X 10 ⁶ cells/mL. After 4h, T2 cells were harvested, supernatant was removed by centrifugation at 300g, and 200. Mu.L of TCR transduced Jurkat76 cells were co-cultured (cell ratio 1:2). Cell culture was performed with co-stimulation of 1. Mu.g/mL of anti-human CD28 antibody and 50IU/mL of IL-2, and the medium was supplemented with 50IU/mL of IL-2 every two days during the culture. An experimental group and a control group were set as follows:

18121ctrl: co-culturing T2 cells and Jurkat76 cells transfected with 18121 empty plasmid;

flu ctrl group: co-culturing T2 cells and Jurkat76-flu-TCR cells;

TCR24 no peps group: co-culturing T2 cells and TCR-T cells (TCR 24) which are not loaded with the epitope peptide;

TCR24 MAGE-A10 peps group: load MAGE-A10 _310-318 T2 cells and TCR-T cells (TCR 24) of the epitope peptide are co-cultured.

After 16h incubation, the cells of each group were blocked with 1% BSA, stained with CD69-PerCP (BioLegend, cat # 310928) antibody for 30min, washed 2 times with 1% BSA, and detected on-stream.

2. Experimental results

The results of the cell activation detection for each group are shown in FIG. 4, which shows that: the extremely significant increase in the proportion of CD69 expressing cells in the TCR24 MAGE-A10 pep group (P < 0.01) compared to the TCR24 no peps group suggests that TCR-T cells constructed from TCR24 can specifically recognize the MAGE-A10 epitope peptide on the T2 cell surface of target cells and can be activated by both target cells.

Example 4 effect of TCR-T cells on target cells

1. Experimental method

PC9 cells in the logarithmic growth phase (human non-small cell lung cancer cells, HLA-A2 positive) were treated with 20. Mu.g/mL mitomycin for 30min and washed 2 times with PBS; infection was then grown with 5 μ M Cell Trace Far Red CFSE (Thermo Scientific, cat#C 34564) for 30min, IMDM complete medium (1:10) was added, washed 2 times with PBS, and counted. Then at 0.75X10 ⁵ 48-well plates were placed at 37℃in 5% CO ₂ Culturing for 12h in an incubator of (v/v), and adding the TCR-T cells constructed in the example 2 for co-culturing after the cells are attached (the cell ratio is 1:2). Cell culture was performed with co-stimulation of 1. Mu.g/mL of anti-human CD28 antibody and 50IU/mL of IL-2, and the medium was supplemented with 50IU/mL of IL-2 every two days during the culture.

The experimental group and the control group are respectively arranged in different culture mediums, and the experimental group and the control group are specifically as follows:

18121ctrl group: co-culturing PC9 cells and Jurkat76 cells transfected with 18121 empty plasmid;

flu ctrl group: PC9 cells and Jurkat76-flu-TCR cells were co-cultured; wherein the Jurkat76-Flu-TCR cell is obtained by transferring influenza double-chain TCR (Flu-TCR) into Jurkat76 cells;

TCR24 group: co-culturing PC9 cells and TCR-T cells (TCR 24);

flow cytometry detects cell activation: after 16h incubation, the Jurkat76 cells were flow-tested by staining with CD69-PerCP (BioLegend, cat# 310928) antibody.

The survival of the target cells was observed by fluorescence microscopy: after Cell Trace Far Red CFSE infection, PC9 target cells were labeled with red fluorescent markers, after 96h co-culture, 48-well plates were placed under a fluorescent microscope for observation and photographing, PC9 cell survival was recorded, and surviving cells were counted automatically using imageJ software.

2. Experimental results

The results of the cell activation detection for each group are shown in FIG. 5, which shows that: the extremely significant increase in the proportion of CD69 expressing cells in the TCR24 MAGE-A10 pep group (P < 0.01) compared to the TCR24 no peps group suggests that TCR-T cells constructed from TCR24 can specifically recognize the MAGE-A10 epitope peptide on the PC9 cell surface of target cells and can be activated by both target cells.

The results of red fluorescence photographing observation of the target cells are shown in fig. 6, which shows that: there was no significant difference in the number of survival of PC9 cells in flu ctrl group compared to 18121ctrl group; the number of PC9 cells surviving in the TCR24 MAGE-A10 pep group was significantly reduced (P < 0.01) compared to the TCR24 no peps group. The results illustrate: the TCR-T cells constructed by the TCR shown in Table 2 can specifically recognize MAGE-A10 epitope peptide on the surface of PC9 cells (target cells) and can play an obvious role in killing the PC9 cells.

Finally, it should be noted that the above embodiments are merely for illustrating the technical solution of the present invention and not for limiting the scope of the present invention, and that other various changes and modifications can be made by one skilled in the art based on the above description and the idea, and it is not necessary or exhaustive of all the embodiments. Any modification, equivalent replacement, improvement, etc. which come within the spirit and principles of the invention are desired to be protected by the following claims.

Claims

1. A T cell receptor, characterized by: the T cell receptor specifically recognizes MAGE-A10 epitope peptide; the T cell receptor comprises an alpha chain and a beta chain; the alpha chain comprises a CDR3 as shown in SEQ ID No.1, a V region of the TCR upstream of the CDR3, and a J region of the TCR downstream of the CDR3; the beta chain comprises a CDR3 with an amino acid sequence shown in SEQ ID No.2, a V region of the TCR upstream of the CDR3 and J and C regions of the TCR downstream of the CDR3; the amino acid sequence of the alpha chain is shown as SEQ ID No. 3; the amino acid sequence of the beta chain is shown as SEQ ID No. 4.

2. The T cell receptor of claim 1, wherein: the amino acid sequence of the MAGE-A10 epitope peptide is shown as SEQ ID No. 5.

3. A nucleic acid molecule encoding the T cell receptor of claim 1 or 2.

4. An expression cassette, vector or cell expressing the T cell receptor of claim 1 or 2 or comprising a nucleic acid molecule encoding the T cell receptor of claim 3.

5. The expression cassette, vector or cell of claim 4, wherein: the vector is a lentiviral vector or an adenovirus vector.

6. The expression cassette, vector or cell of claim 5, wherein: in the vector, the nucleic acid sequences of the alpha chain and the beta chain are connected through a 2A self-cleaving peptide, and the nucleotide sequence of the 2A self-cleaving peptide is shown as SEQ ID No. 6.

7. The expression cassette, vector or cell of claim 4, wherein: the cells expressing the T cell receptor or comprising a nucleic acid molecule encoding the T cell receptor are heterologous or autologous cd8+ T cells or Jurkat cells.

8. The use of the T cell receptor of claim 1 or 2, the nucleic acid molecule of claim 3, or the expression cassette, vector or cell of any one of claims 4 to 7 in the preparation of an anti-tumor vaccine or anti-tumor medicament, characterized in that: the tumor is human non-small cell lung cancer.

9. A pharmaceutical composition characterized by: the pharmaceutical composition comprises a pharmaceutically acceptable carrier; also included is a T cell receptor according to any one of claims 1 or 2, a nucleic acid molecule according to claim 3, or an expression cassette, vector or cell according to any one of claims 4 to 7.