CN116987787A - Apparatus for detecting recurrence of bladder cancer and computer readable storage medium - Google Patents

Apparatus for detecting recurrence of bladder cancer and computer readable storage medium Download PDF

Info

Publication number
CN116987787A
CN116987787A CN202310683493.2A CN202310683493A CN116987787A CN 116987787 A CN116987787 A CN 116987787A CN 202310683493 A CN202310683493 A CN 202310683493A CN 116987787 A CN116987787 A CN 116987787A
Authority
CN
China
Prior art keywords
mutation
gene
methylation
detection
bladder cancer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202310683493.2A
Other languages
Chinese (zh)
Other versions
CN116987787B (en
Inventor
马同辉
辛亚群
赵丹丹
李伟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genetron Health Beijing Co ltd
Original Assignee
Genetron Health Beijing Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genetron Health Beijing Co ltd filed Critical Genetron Health Beijing Co ltd
Priority to CN202310683493.2A priority Critical patent/CN116987787B/en
Publication of CN116987787A publication Critical patent/CN116987787A/en
Application granted granted Critical
Publication of CN116987787B publication Critical patent/CN116987787B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
    • G16B20/20—Allele or variant detection, e.g. single nucleotide polymorphism [SNP] detection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/154—Methylation markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • Organic Chemistry (AREA)
  • Pathology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Oncology (AREA)
  • General Engineering & Computer Science (AREA)
  • Hospice & Palliative Care (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Evolutionary Biology (AREA)
  • Medical Informatics (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Theoretical Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The application discloses a device and a computer readable storage medium for detecting whether bladder cancer recurs. The device detects the genomic DNA of urinary sediment cells of a patient with bladder cancer to be detected; predicting whether the bladder cancer patient to be detected recurs or not based on the mutation detection results of 16 sites of the TERT gene and the methylation detection result of the ONECUT2 gene in the genome DNA. Patients with bladder cancer that have a positive test for TERT gene mutation and/or a positive test for oneut 2 gene methylation are predicted to relapse. The device provided by the application has the advantages that the detection is noninvasive, the sample is easy to obtain, the follow-up visit of patients with different recurrence risks can be guided, the cystoscope use times of patients with low recurrence risk are reduced, the times of hospital visits and related expenses are reduced, the life quality of the patients is improved, and medical resources are saved.

Description

Apparatus for detecting recurrence of bladder cancer and computer readable storage medium
Technical Field
The present application relates to an apparatus and a computer-readable storage medium for detecting whether bladder cancer recurs in the field of diagnosis.
Background
Bladder cancer is a common urinary system tumor that develops a progressive annual trend, associated with personal lifestyle, air pollution and genetic factors. Bladder cancer can be classified into non-myogenic invasive bladder cancer (non-muscle-invasive bladder cancer, NMIBC) and myogenic invasive bladder cancer (muscle-invasive bladder cancer, MIBC) according to tumor infiltration depth. About 80% of patients with bladder cancer are initially diagnosed with NMIBC. Transurethral cystectomy (TURBT) is the main mode for treating bladder cancer, but patients have a high recurrence rate after operation, 70% of patients are likely to relapse, and 10-20% of patients are progressed to MIBC. Therefore, for bladder cancer patients, accurate diagnosis and strict monitoring of recurrence is of paramount importance. However, the current monitoring methods have certain limitations, which place a great burden on the quality of life and medical resources of the patient. Currently, clinical monitoring of recurrence of bladder cancer is based on imaging, urine and endoscopy. Imaging examinations include ultrasonic examination, CT examination, MRI examination and the like, which have limited clinical value for single use, are difficult to meet the qualitative requirement of tumor, and comprehensive examination can improve the accuracy of diagnosis. Urine examination currently common methods are urine shed cytology and fluorescence in situ hybridization (fluorescence in situ hybridization, FISH). The urine abscisic cytology examination is one of the main methods of the postoperative follow-up of bladder cancer, and the detection of cancer cells in urine is one of the qualitative diagnoses of bladder cancer. Specificity of urine shed cytology examination is 85% -100%, but sensitivity is only 13% -75%. The fluorescent in situ hybridization detection can detect chromosome abnormality of the urine abscisic cells, and the combination of the fluorescent in situ hybridization detection and the urine abscisic cytology detection can greatly improve diagnosis sensitivity, but the cost improvement caused by the sharing of multiple detection means limits the use of the fluorescent in-situ hybridization detection during each postoperative follow-up. Endoscopy is classified into cystoscopy and ureteroscopy, etc., and cystoscopy and pathological biopsy are the most reliable methods of diagnosing bladder cancer, and are the "gold standard" for diagnosing bladder cancer. However, the invasive nature of cystoscopy can cause additional pain and complications to the patient, and the resulting localized adhesions or trauma can also increase the risk of postoperative recurrence. Bladder cancer is very susceptible to recurrence due to its nature, and therefore has strict follow-up time and criteria after surgery, and requires cystoscopy every three months or half year of follow-up, which also increases patient pain and economic costs.
Thus, a current challenge for bladder cancer management is to develop a reliable, non-invasive method that improves the accuracy of screening bladder cancer patients while reducing the frequency of cystoscope use. For this reason, there have been some urine biomarker studies attempting to reduce the number of unnecessary cystoscopies. However, due to insufficient sensitivity or negative predictive value (negative predictive value, NPV), no biomarker is currently widely used. For example, FDA approved NMP22, BTA, and FISH urine detection methods have a sensitivity of 57% -82% and NPV of 21% -48% in the primary diagnosis and monitoring of bladder cancer.
Disclosure of Invention
The application aims to solve the technical problems of detecting whether bladder cancer recurs or not and/or predicting the recurrence risk of bladder cancer patients.
In order to solve the above technical problems, the present application firstly provides a device for detecting or assisting in detecting whether a bladder cancer patient recurs, which may include the following modules:
a1 Sample acquisition module): the method comprises the steps of obtaining genomic DNA of urinary sediment cells of a patient with bladder cancer to be detected;
a2 Gene mutation detection and methylation detection module: the method is used for detecting mutation of TERT genes and methylation of ONECUT2 genes in the genome of the bladder cancer patient to be detected based on the genome DNA;
a3 Risk prediction module): is used for predicting whether the bladder cancer patient to be tested is recurrent or not based on the mutation detection of the TERT gene and the methylation detection result of the ONECUT2 gene.
The TERT gene mutation detection result may be positive or negative.
And predicting whether the patient with the bladder cancer to be detected is recurrent or not can be the positive detection result of the TERT gene mutation and/or the positive detection result of the ONECUT2 gene methylation, and the patient with the bladder cancer to be detected is predicted to be recurrent, wherein the detection result of the TERT gene mutation is negative and the detection result of the ONECUT2 gene methylation is negative.
Methylation of the ONECUT2 gene described above may be methylation of CpG islands of the ONECUT2 gene promoter region.
In the above device, the positive detection result of the TERT gene mutation may be that the TERT gene mutation is detected. A negative test result of the TERT gene mutation can be that the mutation of the TERT gene is not detected. The mutated reference genome is NCBI GRCh37/Hg19 (human reference genome Hg 19). The TERT gene is nm_198253.3 (updated at 2023, 5, 29).
The ONECUT2 gene is nm_004852.3 (updated at 2022, 12, 27).
The detection result of the ONECUT2 gene methylation is positive, and the ONECUT2 gene has methylation modification. A negative detection result of the ONECUT2 gene methylation can be that the ONECUT2 gene has no methylation modification.
In the above device, the mutation of the TERT gene may be a mutation at least one of the following 16 nucleotide positions of the TERT gene: c. -45g > t; c. -54c > a; c. -57a > c; 62-63insCATT; c. 80C > T; c. -86c > t; c. -89c > t; c. -93t > g, c. -124c > t; c. -124c > a; c. -124_ -125gg > aa; c. -138c > t; c. -139_ -140gg > tt; c. -139c > t; c. -141g > a; c. -146c > t;
the mutation is a non-synonymous mutation.
The number "in the mutation indicates the position on the chromosome," - "indicates upstream of the ATG translation initiation site," > "indicates the substitution," ins "indicates the insertion," _ "indicates the substitution of the antisense strand for T with the annotation template, e.g., c..45G > T indicates the substitution of G for T at position 45 upstream of the translation initiation site, c.62-63insCATT indicates the insertion of CATT between positions 62-63 upstream of the translation initiation site, c..124_ -125GG > AA indicates the substitution of GG for AA at positions 124-125 upstream of the translation initiation site (with the antisense strand of the reference genome as the template). The translation initiation position is 1295104 of chromosome 5.
In the above device, in the gene mutation detection and methylation detection module of A2), the methylation detection of the ONECUT2 gene can be achieved by a method comprising the following steps: and performing a bisulfite conversion reaction on the genomic DNA to obtain a bisulfite conversion product, and performing methylation fluorescent quantitative PCR detection on the bisulfite conversion product to obtain a methylation detection result of the ONECUT2 gene.
And the methylation detection result of the ONECUT2 gene is determined according to the difference value between the Ct value detected by the methylation fluorescent quantitative PCR of the ONECUT2 gene and the Ct value detected by the methylation fluorescent quantitative PCR of the reference gene.
The reference gene may be a GAPDH gene. The methylation fluorescence quantitative PCR detection Ct value of the reference gene can be in the range of 26-33. The difference value between the Ct value detected by ONECUT2 gene methylation fluorescent quantitative PCR and the Ct value detected by internal reference gene methylation fluorescent quantitative PCR is smaller than or equal to a certain threshold value, and the ONECUT2 gene methylation detection result can be positive; the difference between the Ct value detected by ONECUT2 gene methylation fluorescent quantitative PCR and the Ct value detected by internal reference gene methylation fluorescent quantitative PCR is larger than a threshold value, or the methylation detection result of ONECUT2 gene without Ct value detected by ONECUT2 gene methylation fluorescent quantitative PCR can be negative. The threshold may be 8.
In the above device, in the gene mutation detection and methylation detection module of A2), the mutation detection of TERT gene can be achieved by a method comprising the steps of: and carrying out library construction sequencing on the genome DNA to obtain genome sequencing data of the bladder cancer patient to be tested, and carrying out mutation detection on the genome sequencing data to obtain a mutation detection result of the TERT gene.
In order to solve the above technical problem, the present application also provides a computer-readable storage medium for detecting or assisting in detecting whether a bladder cancer patient recurs, the computer-readable storage medium may include a computer program, the computer program may cause a computer to execute the steps of:
b1 Obtaining genomic DNA of urinary sediment cells of a patient with bladder cancer to be detected;
b2 Performing mutation detection of a TERT gene and methylation detection of an ONECUT2 gene in the genome of the bladder cancer patient to be tested based on the genomic DNA;
b3 Detecting whether the bladder cancer patient to be detected recurs or not based on the mutation detection result of the TERT gene and the methylation detection result of the ONECUT2 gene.
And predicting whether the patient with the bladder cancer to be detected recurs can be determined that the patient with the bladder cancer to be detected has positive detection result of the TERT gene mutation and/or the patient with the bladder cancer to be detected has positive detection result of the ONECUT2 gene methylation, and the patient with the bladder cancer to be detected is determined that the patient with the bladder cancer to be detected has negative detection result of the TERT gene mutation and the patient with the bladder cancer to be detected has negative detection result of the ONECUT2 gene methylation.
The TERT gene mutation detection result may be positive or negative.
In the above computer-readable storage medium, the positive detection of the TERT gene mutation may be detection of a mutation of the TERT gene. A negative test result of the TERT gene mutation can be that the mutation of the TERT gene is not detected. The mutated reference genome is NCBI GRCh37/Hg19 (human reference genome Hg 19).
The TERT gene is nm_198253.3 (updated at 2023, 5, 29).
The ONECUT2 gene is nm_004852.3 (updated at 2022, 12, 27).
The detection result of the ONECUT2 gene methylation is positive, and the ONECUT2 gene has methylation modification. A negative detection result of the ONECUT2 gene methylation can be that the ONECUT2 gene has no methylation modification. In the above computer-readable storage medium, the positive test result of the TERT gene mutation may be that there is a mutation at least one of the following 16 nucleotide positions of the TERT gene:
the mutation of the TERT gene is a mutation in at least one of the following 16 nucleotide positions of the TERT gene: c. -45g > t; c. -54c > a; c. -57a > c; 62-63insCATT; c. 80C > T; c. -86c > t; c. -89c > t; c. -93t > g; c. -124c > t; c. -124c > a; c. -124_ -125gg > aa; c. -138c > t; c. -139_ -140gg > tt; c. -139c > t; c. -141g > a; c. 146C > T.
The mutation is a non-synonymous mutation.
The number "in the mutation indicates the position on the chromosome," - "indicates upstream of the ATG translation initiation site," > "indicates the substitution," ins "indicates the insertion," _ "indicates the substitution of the antisense strand for T with the annotation template, e.g., c..45G > T indicates the substitution of G for T at position 45 upstream of the translation initiation site, c.62-63insCATT indicates the insertion of CATT between positions 62-63 upstream of the translation initiation site, c..124_ -125GG > AA indicates the substitution of GG for AA at positions 124-125 upstream of the translation initiation site (with the antisense strand of the reference genome as the template). The translation initiation position is 1295104 of chromosome 5.
In the above computer-readable storage medium, B2) the methylation detection result of the ONECUT2 gene can be achieved by analyzing data of the following methylation detection experiments: and performing a bisulfite conversion reaction on the genomic DNA to obtain a bisulfite conversion product, and performing methylation fluorescent quantitative PCR detection on the bisulfite conversion product to obtain methylation detection experimental data of the ONECUT2 gene.
The methylation detection result of the ONECUT2 gene can be determined according to the difference value between the Ct value detected by the methylation fluorescent quantitative PCR of the ONECUT2 gene and the Ct value detected by the methylation fluorescent quantitative PCR of the reference gene.
The mutation detection result of the TERT gene can be realized by mutation detection of sequencing data of the genome DNA; the genomic sequencing data is obtained by library-building sequencing the genomic DNA.
The reference gene may be a GAPDH gene. The methylation fluorescence quantitative PCR detection Ct value of the reference gene can be in the range of 26-33. The difference value between the Ct value detected by ONECUT2 gene methylation fluorescent quantitative PCR and the Ct value detected by internal reference gene methylation fluorescent quantitative PCR is smaller than or equal to a certain threshold value, and the ONECUT2 gene methylation detection result can be positive; the difference between the Ct value detected by the methylation fluorescent quantitative PCR of the ONECUT2 gene and the Ct value detected by the methylation fluorescent quantitative PCR of the reference gene is larger than a threshold value, or the methylation detection result of the ONECUT2 gene without the Ct value detected by the methylation fluorescent quantitative PCR of the ONECUT2 gene can be negative. The threshold may be 8.
In order to solve the technical problems, the application also provides a gene marker combination for detecting or assisting in detecting bladder cancer recurrence of a subject, wherein the gene marker combination can consist of ONECUT2 methylation and mutation of TERT genes; the mutation of the TERT gene comprises a mutation of at least one of the following 16 nucleotide positions:
c.-45G>T；c.-54C>A；c.-57A>C；c.62-63insCATT；c.-80C>T；c.-86C>T；c.-89C>T；c.-93T>G,c.-124C>T；c.-124C>A；c.-124_-125GG>AA；c.-138C>T；c.-139_-140GG>TT；c.-139C>T；c.-141G>A；c.-146C>T。
the mutation is a non-synonymous mutation.
The number "in the mutation indicates the position on the chromosome," - "indicates upstream of the ATG translation initiation site," > "indicates the substitution," ins "indicates the insertion," _ "indicates the substitution of the antisense strand for T with the annotation template, e.g., c..45G > T indicates the substitution of G for T at position 45 upstream of the translation initiation site, c.62-63insCATT indicates the insertion of CATT between positions 62-63 upstream of the translation initiation site, c..124_ -125GG > AA indicates the substitution of GG for AA at positions 124-125 upstream of the translation initiation site (with the antisense strand of the reference genome as the template). The translation initiation position is 1295104 of chromosome 5.
The subject may be a bladder cancer patient. The bladder cancer patient may be a non-myogenic invasive bladder cancer patient.
In order to solve the technical problems, the application also provides application of a substance for detecting the methylation of the ONECUT2 and the mutation of the TERT gene in preparing a product for identifying or assisting in identifying the recurrence of bladder cancer in a subject.
The subject may be a bladder cancer patient. The bladder cancer patient may be a non-myogenic invasive bladder cancer patient.
The substance may be a reagent and/or device for DNA sequencing, and/or reagents required for methylation detection (e.g., reagents required for PCR and/or reagents required for bisulfite conversion).
In such applications, the substance may be a reagent and/or device for DNA sequencing pooling, and/or a reagent required for methylation detection. The DNA sequencing and library building reagent can be a primer composition shown as a sequence 1-a sequence 13 in a sequence table; the reagent required for methylation detection can be a primer composition shown as a sequence 14-a sequence 19 in a sequence table.
Aiming at the limitations of the existing methods, the patent provides an innovative method for recurrence monitoring of patients with bladder cancer, which aims to improve the accuracy of recurrence detection by combining gene mutation and methylation biomarkers, reduce the risk of missed diagnosis of recurrence tumors, and reduce unnecessary cystoscopy in follow-up visit of patients with bladder cancer, thereby improving the life quality of patients and saving medical resources.
The present application is directed to an apparatus and computer readable storage medium for detecting whether bladder cancer recurs. Gene mutation and methylation combined detection kit and application thereof. The product is expected to improve detection sensitivity and NPV by detecting two combined markers of TERT gene mutation and ONECUT2 methylation, so as to provide clinical guidance for bladder cancer recurrence monitoring.
Due to the adoption of the technical scheme, the application has the following advantages:
1. noninvasive detection: the bladder cancer gene mutation and methylation detection can be used for monitoring bladder cancer recurrence by detecting urinary sediment cell DNA, the detection is noninvasive, the sample is easy to obtain, and the compliance of patients is high.
2. Can be used as an important index for diagnosing bladder cancer recurrence: the product can detect the patients with abnormal genome at the molecular level more widely and accurately by detecting two markers, namely the gene mutation and the methylation, which are closely related to the occurrence of bladder cancer, so that the product can be used as an important biological index in the bladder cancer recurrence monitoring process.
3. Can be used for prompting the recurrence risk of bladder cancer: the product has a certain recurrence prediction value in the bladder cancer follow-up process, can be used for guiding follow-up of patients with different recurrence risks, and reduces the cystoscope use times of patients with low recurrence risk.
4. Possibility of home detection: the patient can collect urine and send samples at home, and whether the patient needs to be admitted to the hospital for cystoscope detection is determined according to the detection result, so that the number of times of hospital visits and related cost are reduced, the life quality of the patient is improved, and medical resources are saved.
Drawings
FIG. 1 is a graph showing the relationship between the urine test results and clinical diagnosis results of patients and follow-up recurrence in the present application.
FIG. 2 shows the results of the detection and clinical diagnosis of the method of the application corresponding to 17 patients with follow-up recurrence in the present application.
FIG. 3 is a graph showing the relationship between the urine test results of patients and the survival without Recurrence (RFS) of the patients in the present application.
Detailed Description
The following detailed description of the application is provided in connection with the accompanying drawings that are presented to illustrate the application and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the application in any way.
The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.
Some definitions or terms in the embodiments of the present application are as follows:
1. noninvasive liquid biopsies: refers to a molecular diagnostic technique performed by blood, urine, saliva, etc. The method for detecting tumor cells and tumor DNA fragments in blood or body fluid has important clinical significance for early tumor screening diagnosis, medication guidance, recurrence monitoring and the like. Compared with tissue or puncture biopsy, liquid biopsy has the advantages of noninvasive, simple operation, repeated sampling, low cost and the like.
2. Polymerase chain reaction PCR: for amplifying a target sequence, the steps comprising: the mixture is denatured by heating, and then the primer anneals to the complement of the target sequence. And (3) performing primer amplification under the action of polymerase after annealing to form a new complementary strand. Higher concentrations of target sequence fragments are obtained by cycles of denaturation, annealing and extension.
3. Primer: typically two oligonucleotide sequences are artificially synthesized, one primer being complementary to one strand of the DNA template at one end of the target region and the other primer being complementary to the other strand of the DNA template at the other end of the target region. The purpose of primer design is to find a suitable pair of nucleotide fragments that will allow efficient amplification of the template DNA sequence.
4. And (3) probe: is a small single-stranded DNA or RNA fragment for detecting a nucleic acid sequence complementary thereto. The double-stranded DNA is denatured by heating to become single-stranded, and then labeled with a radioisotope (typically phosphorus-32), a fluorescent dye, or an enzyme (e.g., horseradish peroxidase) to become a probe.
5. Site mutation: the nucleotide changes, only the mutation site which causes the change of the coding amino acid is considered in the present application.
6. Gene methylation: refers to a form of genetic chemical modification by covalent bonding of a methyl group at the cytosine number 5 carbon position of a genomic CpG dinucleotide under the action of DNA methyltransferase.
7. Fluorescent quantitative PCR: in the method, a fluorescent group is added in a DNA amplification reaction, a PCR product is detected through a fluorescent signal, and then a template is quantitatively analyzed through a standard curve.
8. Sulfite reagent: refers to an agent comprising sulfite or a combination thereof. Sulfite treated DNA, unmethylated cytosine will be converted to uracil, while methylated cytosine is unchanged, distinguishing between methylated and unmethylated DNA.
Example 1, apparatus for detecting recurrence of bladder cancer based on combination of gene mutation and methylation.
DNA extraction.
The detection method is based on urine sediment cells after urine centrifugation. DNA from patient urinary sediment cells was extracted using a nucleic acid extraction purification kit (QIAamp DNA Mini Kit, QIAGEN) and then concentration detection was performed on the DNA using a nucleic acid quantification kit (Qubit dsDNAHS Assay Kits, thermo Fisher Scientific) for subsequent detection of telomerase reverse transcriptase (telomerase reverse transcriptase, TERT) gene mutation and detection of ONECUT2 (one cut homebox 2; OC-2) gene methylation.
2. Constructing a DNA sequencing library.
Sequencing libraries involved the following primers:
the upstream primer F1 consists of a sequencing joint 1, a Barcode sequence and a general sequence 1;
the upstream primer F2 consists of a general sequence 1, a molecular tag and a TERT gene upstream specific primer sequence;
a downstream outer primer R1, which consists of a sequencing joint 2 and a general sequence 2;
the downstream inner primer R2 consists of a general sequence 2 and a primer sequence specific to the downstream of the TERT gene.
The molecular tag in the upstream primer includes a random sequence and a specific sequence, and in this embodiment, the molecular tag is:
NNNNACNNNN where AC is a specific sequence and the others are random sequences where N is randomly selected from A, T, G or C, i.e. N is A, T, G or C.
The respective sequences are combined into an upstream primer and a downstream primer, respectively. The primer sequences were dissolved after synthesis to prepare a DNA amplification mix. In this example, the DNA amplification primer mixture was mixed with the upstream primer F2 and the downstream outer primer R1 and the downstream inner primer R2 of the TERT gene in a ratio. Wherein the initial concentrations of F1, F2, R1 and R2 primers added are 50 mu M, and the volume ratio is 10:5:5. And mixing and diluting the TERT gene upstream primer F1 solution with a TE buffer solution 1:1 respectively, wherein the concentration of the mixed TERT gene upstream primer F1 is 50 mu M.
In this example, the primer sequences are as follows:
wherein the thickening sequence of the TERT downstream outer primer R1 is a sequencing joint 1, and the underlined sequence is a general sequence 2; the underlined sequence of the inner primer R2 at the downstream of TERT is a general sequence 2; the underlined sequence of the TERT upstream primer F2 is a general sequence 1; the tertiary upstream primer F1 has a thickened sequence of sequencing adapter 1 and an underlined sequence of universal sequence 1.
After the library was constructed successfully, sequencing was performed on Ion Torrent platform.
Mixing the DNA amplification primer mixed solution with the F1 solution, the polymerase mixed solution (Sieimer) and the GC enhancement mixed solution (Sieimer) before the experiment, and then carrying out instantaneous centrifugation for standby.
The PCR amplification reaction system is as follows:
the components Dosage of
DNA amplification primer mixture 2μL
Upstream primer F1 0.4μL
DNA sample (template) 20ng
DNA polymerase mixed solution 15μL
GC enhancement mixed liquor 6μL
Nuclease-free water Make up to a total volume of 30. Mu.L
The PCR amplification reaction conditions were as follows
3. And (5) purifying the library.
The PCR product (sequencing library) from step 2 was left at room temperature and then vortexed with magnetic beads (Agencourt AMPure XP, beckman Coulter, A63880). The sequencing library and the magnetic beads are mixed according to the volume ratio of 1:1.2 (60 mu library and 72 mu L magnetic beads), vortex mixed evenly and placed on a magnetic rack for standing for 5min, and the supernatant is discarded. 200 μl of freshly prepared 80% ethanol was added and washed twice. And then airing on a magnetic rack for not more than 3min. Add 33. Mu.L of nuclease free water to wash out, aspirate 30. Mu.L of supernatant and place in a new PCR tube.
4. Library on-machine sequencing and sequencing data analysis.
The sequencing library constructed in this example was sequenced according to the instructions of a general kit for sequencing reaction (Beijing pantoea gene technologies Co., ltd., record No. Beijing Chang mechanical arm 20190005, beijing Chang mechanical arm 20190001) suitable for DA8600 and Genetron S5 sequencers.
After the sequencing data is taken off, firstly, carrying out quality control judgment on sample data taken off (standard: more than or equal to 1000reads, wherein target area accounts for more than or equal to 90% of total target area), then converting original BAM data into FASTQ file, comparing the FASTQ file with a ginseng genome (NCBI GRCh37/Hg 19)), extracting molecular tags, clustering sequencing reads (reads) according to the molecular tags at each site to form family (the requirement that the reads need more than or equal to 2 nucleotides on the basis of the same molecular tags, and 80% of the reads support the same basic type is regarded as the same family), and counting ref (Reference) of each site: wild-type base sequence of the reference genomic locus) type and alt (Alternative: the mutant base sequence at the post-mutation site) type family, respectively obtaining the respective corresponding family depth (family number), then carrying out quality control (pass or fail) on each site according to the site quality control standard, and calculating the mutation frequency according to the family numbers of ref type and alt type of each site, wherein the calculation method comprises the following steps: mutation frequency = alt type family depth/(alt type family depth + ref type family depth).
In this example, TERT gene mutations include mutations at 16 sites of the TERT gene on chromosome 5 of the human genome (nm_ 198253.3 updated at 2023, 5 months 29): c. -45g > t; c. -54c > a; c. -57a > c; 62-63insCATT; c. 80C > T; c. -86c > t; c. -89c > t; c. -93t > g, c. -124c > t; c. -124c > a; c. -124_ -125gg > aa; c. -138c > t; c. -139_ -140gg > tt; c. -139c > t; c. -141g > a; c. 146C > T.
Wherein the number "indicates a position on the chromosome," - "indicates upstream of the ATG translation initiation site," > "indicates a substitution," ins "indicates an insertion," _indicates an annotation template with the antisense strand, e.g., c.-45G > T indicates a substitution of G for T at position 45 upstream of the translation initiation site, c.62-63insCATT indicates an insertion of CATT between positions 62-63 upstream of the translation initiation site, c.-124_ -125GG > AA indicates a substitution of GG for AA at positions 124-125 upstream of the translation initiation site (with the antisense strand as the annotation template). The translation initiation position is 1295104 of chromosome 5.
Detection of ONECUT2 Gene methylation.
Methylation detection requires bisulfite conversion of the DNA extracted in step 1 (EZ DNA Methylation-Lightning) TM Kit,ZYMO,D5031)。
The heavy sulfurous acid conversion system is as follows:
the bisulfite conversion reaction conditions were as follows:
temperature (temperature) Time
98℃ 8min
54℃ 60min
4℃ Holding
The transformation products were recovered according to the protocol (EZ DNA Methylation-LightningTMKit, ZYMO, D5031) and the recovered products were PCR amplified.
The methylation reaction mixture is prepared by mixing a primer probe of a methylation gene, a primer probe of an internal reference gene and a polymerase solution.
The primer probe sequences of the methylation genes included in the methylation reaction are as follows:
primer name Primer sequence (5 '-3')
ONECUT 2-upstream primer ATTTTTGTATTATTCGTTTTTGTGCGTATA (sequence 14)
ONECUT 2-downstream GCGTTTTCGGCGATTCGTTTGGGCGGTT (sequence 15)
ONECUT 2-probe CCGTTCAACGCATTAACTTCGCGA (sequence 16)
Internal reference GAPDH-upstream primer GGGTGGTTATTGTGAAAAG (sequence 17)
Internal reference GAPDH-downstream primer CTCCAATCCCTAACCCTACCTT (sequence 18)
GAPDH-probes CTACTAAAACCCAAAACCAAAC (sequence 19)
The methylation PCR amplification system is as follows:
the components Dosage of
Methylation reaction mixtures 12.5μL
Bisulfite conversion of DNA 15ng
Nuclease-free water Make up to a total volume of 20. Mu.L
The methylation fluorescent quantitative PCR amplification procedure was:
6. and (5) judging results.
6.1 mutation site detection.
The mutation frequency of the TERT gene detection site is more than or equal to 0.5%, wherein the mutation frequency of the C228T site of the TERT is more than or equal to 3%, and the TERT gene detection site is positive to mutation.
6.2 methylation detection.
And setting corresponding thresholds according to different models used for detection by the sample to be detected to obtain a mutation signal and an internal reference signal. In this embodiment, the CFX96 system is used, and the threshold is set to 200. The methylation mutation signal is used for collecting fluorescence through a FAM channel, and the internal reference signal is used for collecting fluorescence signal through a VIC channel. Firstly, confirming whether a result is valid, namely that a blank control FAM channel and a VIC channel have no amplification curve, the FAM signal Ct of a positive control is less than or equal to 33, and the VIC signal 26 is less than or equal to 33; and secondly, judging the signal of the sample to be detected, wherein the Ct of the VIC signal is 26-33. According to the delta Ct=mutation Ct value-internal reference Ct value (delta Ct=Ct FAM-Ct VIC), if the delta Ct of the sample to be detected is less than or equal to 8, the sample is considered to be methylation positive; if the delta Ct of the sample to be detected is more than 8 or the FAM channel has no Ct value, the sample is considered to be methylation negative.
6.3 comprehensive detection and judgment
The gene marker combination used for detecting relapse of NMIBC patients comprises TERT gene mutation and ONECUT2 methylation, and if any one or both of the TERT gene mutation and the ONECUT2 methylation are positive, the detection result is positive; if both are negative, the detection result is negative.
The positive detection result indicates that the patient has recurrence, and cystoscope and pathology should be immediately implemented for confirmation; negative detection results indicate that the patient does not have recurrence and can delay invasive cystoscopy.
Example 2 noninvasive diagnosis and detection of recurrence of bladder cancer patients using gene marker combinations examples.
To verify the detection effect of the detection method based on bladder cancer gene mutation and methylation established in example 1 in the recurrence diagnosis of bladder cancer patients, 93 NMIBC patients admitted to the department of urology of Ruijin Hospital, shanghai university of transportation medical school, including 2021, 6 months to 2022, were selected. The patients were both cystoscopic and urine samples were collected prior to cystoscopy. Patients entered into the group all signed informed consent. Of these, 8 patients with recurrence were confirmed clinically by cystoscope and pathology, and 85 patients without recurrence. The results of the assays and the detailed results of the clinical confirmation using the methods of the application are shown in tables 1 and 2.
TABLE 1 sample detection results
Note that: mutation + methylation negative indicates that mutation and methylation are both negative, and mutation + methylation positive indicates that mutation and/or methylation are positive.
TABLE 2 mutation or methylation positive sample detection results
And (3) comparing cystoscope with pathological results in an NMIBC recurrence diagnosis scene according to the comprehensive detection result, and calculating to obtain sensitivity, specificity, a negative predictive value (Negative Predictive Value, NPV) and a positive predictive value (Positive Predictive Value, PPV) according to the following formula:
sensitivity = number of samples with true positive detection result/total number of samples with true positive and false negative;
specificity = number of samples with detection result of true negative/total number of samples of true negative and false positive;
PPV = number of samples with true positive detection/total number of samples with true positive and false positive;
NPV = number of samples with true negative/total number of samples with true negative and false negative as detected.
Wherein a true positive sample refers to a sample (8 cases in total) that is positive for mutation and/or methylation detection and clinically confirmed to be recurrent, a false negative sample refers to a sample (0 cases in total) that is negative for mutation and methylation detection and clinically confirmed to be recurrent, a true negative sample refers to a sample (61 cases in total) that is negative for mutation and methylation detection and clinically confirmed to be non-recurrent, and a false positive sample refers to a sample (24 cases in total) that is positive for mutation and/or methylation detection and clinically confirmed to be non-recurrent.
In NIMBC recurrence diagnosis, the diagnosis method of the technical scheme of the application can effectively judge that patients with NIMBC recurrence have sensitivity, specificity, PPV and NPV of 100%, 71.8%, 25% and 100% respectively (Table 3); and the unnecessary cystoscope can be effectively reduced according to the result of the scheme of the application, and the reduction rate reaches 65.6 percent.
TABLE 3 Performance of the inventive process
Example 3 recurrence prediction was performed on bladder cancer patients, distinguishing patients with high risk recurrence in follow-up.
Next, the present application further evaluates the predictive value of the detection method of the present application for recurrence. This example continued to follow-up on 93 patients in example 2 (follow-up time 0.03-17.27 months) and monitored for patient relapse. In the process, the follow-up recurrence information of 13 patients is unknown, wherein the follow-up recurrence information of 11 patients is lost, and the recurrence diagnosis result of 2 patients is ambiguous, so that the 13 patients do not count into statistical data. In total 17 patients were diagnosed with relapse in follow-up, and 63 patients did not relapse (table 4).
Table 4 patient follow-up condition
Note that: mutation + methylation negative indicates that mutation and methylation are both negative, and mutation + methylation positive indicates that mutation and/or methylation are positive.
The application is based on the obvious correlation between the detection results of gene mutation and methylation and follow-up recurrence. The risk of relapse is significantly increased in follow-up for patients who are positive versus patients who are negative for detection. The recurrence rate was 46.7% (14/30) in patients with positive detection, whereas only 6% (3/50) of patients with negative detection had recurrence (FIG. 1). Compared with clinical indexes, only 47.1 percent (8/17) of patients can be accurately predicted, and 82.4 percent (14/17) of patients can be effectively predicted to relapse. It is worth mentioning that 6 patients diagnosed clinically as non-recurrent but tested positive eventually found recurrent in follow-up (fig. 2). Meanwhile, the detection result can be used for risk stratification of recurrent patients. Patients who tested positive for relapse-free survival (RFS; time to relapse from last surgery) were shorter than negative patients (median time 49 months vs were not reached; risk ratio hr=5.8, 95% confidence interval 2.0-16.5, and significant difference p=0.001) (fig. 3).
In summary, the detection result of the method of the application can indicate whether the NMIBC patient recurs. For the patient with positive result, the patient should be treated in time by closer follow-up, while the patient with negative result has no recurrence, so that the follow-up frequency of hospital and the use frequency of cystoscope can be reduced. Therefore, the method can be clinically applied to follow-up monitoring of bladder cancer, reduces the use frequency of cystoscope, and reduces the medical and psychological burden of patients.
The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains.

Claims (10)

1. Device for detecting or assisting in detecting whether a patient with bladder cancer recurs, characterized in that: the device comprises the following modules:
a1 Sample acquisition module): the method comprises the steps of obtaining genomic DNA of urinary sediment cells of a patient with bladder cancer to be detected;
a2 Gene mutation detection and methylation detection module: the method is used for detecting mutation of TERT genes and methylation of ONECUT2 genes in the genome of the bladder cancer patient to be detected based on the genome DNA;
a3 Risk prediction module): and the method is used for predicting whether the bladder cancer patient to be tested recurs or not based on mutation detection of the TERT gene and methylation detection result of the ONECUT2 gene.
2. The apparatus according to claim 1, wherein: the mutation of the TERT gene is a mutation in at least one of the following 16 nucleotide positions of the TERT gene: c. -45g > t; c. -54c > a; c. -57a > c; 62-63insCATT; c. 80C > T; c. -86c > t; c. -89c > t; c. -93t > g; c. -124c > t; c. -124c > a; c. -124_ -125gg > aa; c. -138c > t; c. -139_ -140gg > tt; c. -139c > t; c. -141g > a; c. -146c > t;
the "c.number" indicates the position of the mutation on the chromosome, the "-" indicates upstream of the ATG translation start site, the ">" indicates substitution, the "ins" indicates insertion, and the "_" indicates templated by the antisense strand of the reference genome; the ATG translation initiation site is at position 1295104 of chromosome 5 of the human reference genome;
the mutation is a non-synonymous mutation.
3. The apparatus according to claim 1 or 2, characterized in that: a2 In the gene mutation detection and methylation detection module, methylation detection of the ONECUT2 gene is achieved by a method comprising the following steps: performing a bisulfite conversion reaction on the genomic DNA to obtain a bisulfite conversion product, and performing methylation fluorescent quantitative PCR detection on the bisulfite conversion product to obtain a methylation detection result of the ONECUT2 gene;
and the methylation detection result of the ONECUT2 gene is determined according to the difference value between the Ct value detected by the methylation fluorescent quantitative PCR of the ONECUT2 gene and the Ct value detected by the methylation fluorescent quantitative PCR of the reference gene.
4. The apparatus according to claim 1 or 2, characterized in that: a2 In the gene mutation detection and methylation detection module, the mutation detection of the TERT gene is realized by a method comprising the following steps: and carrying out library construction sequencing on the genome DNA to obtain genome sequencing data of the bladder cancer patient to be tested, and carrying out mutation detection on the genome sequencing data to obtain a mutation detection result of the TERT gene.
5. A computer readable storage medium for detecting or aiding in the detection of recurrence of a patient with bladder cancer, characterized in that: the computer-readable storage medium includes a computer program that causes a computer to execute the steps of:
b1 Obtaining genomic DNA of urinary sediment cells of a patient with bladder cancer to be detected;
b2 Performing mutation detection of a TERT gene and methylation detection of an ONECUT2 gene in the genome of the bladder cancer patient to be tested based on the genomic DNA;
b3 Detecting whether the bladder cancer patient recurs based on the mutation detection result of the TERT gene and the methylation detection result of the ONECUT2 gene.
6. The computer-readable storage medium according to claim 5, wherein: the mutation of the TERT gene is a mutation in at least one of the following 16 nucleotide positions of the TERT gene:
c.-45G>T；c.-54C>A；c.-57A>C；c.62-63insCATT；c.-80C>T；c.-86C>T；
c.-89C>T；c.-93T>G,c.-124C>T；c.-124C>A；c.-124_-125GG>AA；c.-138C>T；c.-139_-140GG>TT；c.-139C>T；c.-141G>A；c.-146C>T；
the "c.number" indicates the position of the mutation on the chromosome, the "-" indicates upstream of the ATG translation start site, the ">" indicates substitution, the "ins" indicates insertion, and the "_" indicates templated by the antisense strand of the reference genome; the ATG translation initiation site is at position 1295104 of chromosome 5 of the human reference genome;
the mutation is a non-synonymous mutation.
7. The computer-readable storage medium according to claim 5 or 6, wherein: b2 The methylation detection result of the ONECUT2 gene is achieved by analyzing the data of the following methylation detection experiments: performing a bisulfite conversion reaction on the genomic DNA to obtain a bisulfite conversion product, and performing methylation fluorescent quantitative PCR detection on the bisulfite conversion product to obtain methylation detection experimental data of the ONECUT2 gene;
the methylation detection result of the ONECUT2 gene is determined according to the difference value between the Ct value detected by the methylation fluorescent quantitative PCR of the ONECUT2 gene and the Ct value detected by the methylation fluorescent quantitative PCR of the reference gene;
the mutation detection result of the TERT gene is realized by carrying out mutation detection on the sequencing data of the genome DNA; the genomic sequencing data is obtained by library-building sequencing the genomic DNA.
8. A combination of genetic markers for use in the detection or assisted detection of bladder cancer recurrence in a subject, characterized by: the gene marker combination consists of ONECUT2 methylation and mutation of TERT genes; the mutation of the TERT gene comprises a mutation of at least one of the following 16 nucleotide positions:
c.-45G>T；c.-54C>A；c.-57A>C；c.62-63insCATT；c.-80C>T；c.-86C>T；
c.-89C>T；c.-93T>G,c.-124C>T；c.-124C>A；c.-124_-125GG>AA；c.-138C>T；c.-139_-140GG>TT；c.-139C>T；c.-141G>A；c.-146C>T；
the "c.number" indicates the position of the mutation on the chromosome, the "-" indicates upstream of the ATG translation start site, the ">" indicates substitution, the "ins" indicates insertion, and the "_" indicates templated by the antisense strand of the reference genome; the ATG translation initiation site is at position 1295104 of chromosome 5 of the human reference genome;
the mutation is a non-synonymous mutation.
9. Use of a substance that detects the methylation of oneut 2 and mutation of TERT gene in the genome of a subject in the manufacture of a product for identifying or aiding in identifying recurrence of bladder cancer in a subject.
10. The use according to claim 9, characterized in that: the substance is a reagent and/or a device for DNA sequencing library establishment and/or a reagent required for methylation detection; the DNA sequencing library-building reagent is a primer composition shown as a sequence 1-a sequence 13 in a sequence table; the reagent required for methylation detection is a primer composition shown as a sequence 14-a sequence 19 in a sequence table.
CN202310683493.2A 2023-06-09 2023-06-09 Apparatus for detecting recurrence of bladder cancer and computer readable storage medium Active CN116987787B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310683493.2A CN116987787B (en) 2023-06-09 2023-06-09 Apparatus for detecting recurrence of bladder cancer and computer readable storage medium

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310683493.2A CN116987787B (en) 2023-06-09 2023-06-09 Apparatus for detecting recurrence of bladder cancer and computer readable storage medium

Publications (2)

Publication Number Publication Date
CN116987787A true CN116987787A (en) 2023-11-03
CN116987787B CN116987787B (en) 2024-07-30

Family

ID=88532905

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310683493.2A Active CN116987787B (en) 2023-06-09 2023-06-09 Apparatus for detecting recurrence of bladder cancer and computer readable storage medium

Country Status (1)

Country Link
CN (1) CN116987787B (en)

Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015041788A1 (en) * 2013-09-23 2015-03-26 The Johns Hopkins University Tert promoter mutations in urothelial neoplasia
WO2015049063A1 (en) * 2013-10-02 2015-04-09 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Human tert promoter variants, as well as kits, methods and uses thereof
US20160208340A1 (en) * 2013-02-18 2016-07-21 The Johns Hopkins University TERT Promoter Mutations in Urothelial Neoplasia
CN106148516A (en) * 2016-06-29 2016-11-23 苏州捷诺威生物科技有限公司 A kind of test kit for detecting the sudden change of TERT gene promoter and detection method and application
WO2016207656A1 (en) * 2015-06-24 2016-12-29 Ucl Business Plc Methods of diagnosing bladder cancer
CN108138242A (en) * 2015-07-16 2018-06-08 迪莫·迪特里希 Determine the method being mutated in genomic DNA, the purposes of this method and the kit for implementing this method
CN108374047A (en) * 2018-02-09 2018-08-07 湖南优品司生物科技有限公司 A kind of kit detecting carcinoma of urinary bladder based on high throughput sequencing technologies
CN110055331A (en) * 2019-05-10 2019-07-26 人和未来生物科技（长沙）有限公司 A kind of kit and its application for bladder cancer auxiliary diagnosis or screening
CN110621788A (en) * 2017-05-18 2019-12-27 基美健有限公司 DNA methylation and mutation analysis methods for bladder cancer monitoring
CN110628910A (en) * 2019-10-17 2019-12-31 湖南大地同年生物科技有限公司 Bladder cancer driver gene point mutation methylation combined auxiliary diagnosis method, kit, system and application
CN114807377A (en) * 2022-06-29 2022-07-29 南京世和基因生物技术股份有限公司 Application of bladder cancer prognosis survival time marker, evaluation device and computer readable medium
CN116121380A (en) * 2022-11-30 2023-05-16 神州医疗科技股份有限公司 Primer probe combination for detecting bladder cancer related genes and detection method

Patent Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160208340A1 (en) * 2013-02-18 2016-07-21 The Johns Hopkins University TERT Promoter Mutations in Urothelial Neoplasia
WO2015041788A1 (en) * 2013-09-23 2015-03-26 The Johns Hopkins University Tert promoter mutations in urothelial neoplasia
WO2015049063A1 (en) * 2013-10-02 2015-04-09 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Human tert promoter variants, as well as kits, methods and uses thereof
WO2016207656A1 (en) * 2015-06-24 2016-12-29 Ucl Business Plc Methods of diagnosing bladder cancer
CN108138242A (en) * 2015-07-16 2018-06-08 迪莫·迪特里希 Determine the method being mutated in genomic DNA, the purposes of this method and the kit for implementing this method
CN106148516A (en) * 2016-06-29 2016-11-23 苏州捷诺威生物科技有限公司 A kind of test kit for detecting the sudden change of TERT gene promoter and detection method and application
CN110621788A (en) * 2017-05-18 2019-12-27 基美健有限公司 DNA methylation and mutation analysis methods for bladder cancer monitoring
CN108374047A (en) * 2018-02-09 2018-08-07 湖南优品司生物科技有限公司 A kind of kit detecting carcinoma of urinary bladder based on high throughput sequencing technologies
CN110055331A (en) * 2019-05-10 2019-07-26 人和未来生物科技（长沙）有限公司 A kind of kit and its application for bladder cancer auxiliary diagnosis or screening
CN110628910A (en) * 2019-10-17 2019-12-31 湖南大地同年生物科技有限公司 Bladder cancer driver gene point mutation methylation combined auxiliary diagnosis method, kit, system and application
CN114807377A (en) * 2022-06-29 2022-07-29 南京世和基因生物技术股份有限公司 Application of bladder cancer prognosis survival time marker, evaluation device and computer readable medium
CN116121380A (en) * 2022-11-30 2023-05-16 神州医疗科技股份有限公司 Primer probe combination for detecting bladder cancer related genes and detection method

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
HURST CD: "Comprehensive Mutation Analysis of the TERT Promoter in Bladder Cancer and Detection of Mutations in Voided Urine", EUROPEAN ASSOCIATION OF UROLOGY, pages 1 - 3 *

Also Published As

Publication number Publication date
CN116987787B (en) 2024-07-30

Similar Documents

Publication Publication Date Title
CN108977543B (en) Colorectal cancer early diagnosis reagent based on joint detection of SDC2 and SFRP2 gene methylation level
AU2017339984A1 (en) Method for multiplex detection of methylated DNA
CN114717311B (en) Marker, kit and device for detecting urothelial cancer
CN114891886B (en) Nucleic acid product, kit and application for diagnosing bladder cancer
KR102637032B1 (en) Composition for diagnosing bladder cancer using CpG methylation status of specific gene and uses thereof
CN118064593A (en) Prostate cancer biomarker, prostate cancer detection kit and application
CN116804218A (en) Methylation marker for detecting benign and malignant lung nodules and application thereof
US11535897B2 (en) Composite epigenetic biomarkers for accurate screening, diagnosis and prognosis of colorectal cancer
JP7522190B2 (en) Colon cancer detection method
CN117248021A (en) Nucleic acid combination, kit and application for detecting urothelial cancer or precancerous lesions
CN114959030B (en) Application of reagent for detecting HCG9 gene methylation in preparation of product for diagnosing bladder cancer
CN116987787B (en) Apparatus for detecting recurrence of bladder cancer and computer readable storage medium
JP2017510304A (en) Methods and kits for identifying precancerous colorectal polyps and colorectal cancer
CN111349700B (en) Gene marker combination, kit and method for detecting urothelial cancer
CN115094139B (en) Application of reagent for detecting methylation level in preparation of bladder cancer diagnosis product and bladder cancer diagnosis kit
CN114941029B (en) Biomarker, nucleic acid product and kit for liver cancer
CN118374600B (en) Primer group, kit, device for diagnosing gastrointestinal tumor and storage medium
CN116356027B (en) Reagent and kit for detecting esophageal squamous carcinoma or precancerous lesions and application of reagent and kit
CN118497350A (en) Reagent and kit for detecting prostate cancer and application thereof
CN117778572A (en) Nucleic acid combination for detecting thyroid cancer, detection kit and application
KR20240104309A (en) Method for detection of lung cancer using lung cancer-specific methylation marker gene
CN118497351A (en) Methylation detection reagent and kit for detecting prostate cancer and application of methylation detection reagent and kit
CN117568480A (en) Reagent and kit for breast cancer or precancerous lesion detection and application
CN115838798A (en) Application of reagent for detecting methylation level in preparation of colorectal cancer diagnosis product
CN117778573A (en) Nucleic acid combination for detecting thyroid cancer biomarker, kit and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant