CN116983434B

CN116983434B - Nucleic acid constructs for gene therapy and uses thereof

Info

Publication number: CN116983434B
Application number: CN202311275130.1A
Authority: CN
Inventors: 吴昊泉; 陈非飞; 周浩; 杨伟涛
Original assignee: Kanglin Bio Tech Hangzhou Co ltd
Current assignee: Kanglin Bio Tech Hangzhou Co ltd
Priority date: 2023-09-28
Filing date: 2023-09-28
Publication date: 2024-03-15
Anticipated expiration: 2043-09-28
Also published as: CN116983434A

Abstract

The present invention provides nucleic acid constructs encoding anti-PCSK 9 antibodies or antigen-binding fragments thereof for use in gene therapy and uses thereof. The invention also provides recombinant viruses such as recombinant adeno-associated viruses and recombinant lentiviruses made from the nucleic acid constructs, and uses of the nucleic acid constructs and recombinant viruses in the treatment of hyperlipidemic disorders.

Description

Nucleic acid constructs for gene therapy and uses thereof

Technical Field

The invention belongs to the field of gene therapy, and in particular relates to a nucleic acid construct for gene therapy of hyperlipoidemia diseases. The nucleic acid construct can be used for gene therapy of familial hypercholesterolemia, atherosclerosis and other diseases.

Background

CVD is most commonly used in the treatment of atherosclerotic cardiovascular disease (ASCVD), accounting for over 95% of all etiologies.

Familial Hypercholesterolemia (FH) is a genetic disease closely related to early atherosclerotic cardiovascular disease (ASCVD) and high mortality, which is a genetic disease of lipoprotein metabolism, and one of the most common genetic metabolic diseases. The root cause of FH is a genetic defect in the low-density lipoprotein receptor (LDL-R) or in proteins regulating its metabolism, resulting in abnormally low uptake of low-density lipoprotein (LDL) by the liver. Thus, cholesterol accumulation in the circulation results, leading to an increased risk of cardiovascular disease.

The current mode for treating hyperlipidemia (including FH) mainly comprises statin drugs and non-statin drugs, and also comprises antibody PCSK9 inhibitors, which have respective advantages in treatment effect, but have corresponding defects at the same time. Statin drugs lower total cholesterol and low density lipoprotein cholesterol (LDL-C) by inhibiting 3-hydroxy-3-methylglutaryl CoA (HMG-CoA) reductase. Several studies clearly demonstrate that statins can reduce LDL-C levels, thereby reducing the risk of CVD in patients and reducing mortality and disease progression in clinical ASCVD patients. Statin drugs are the primary drugs for the treatment of hyperlipidemia including FH. However, while statins are generally well tolerated, they can cause a number of adverse effects, including gastrointestinal events, musculoskeletal pain, respiratory tract infections, and headaches. Statin drugs may also be associated with elevated blood glucose and glycosylated hemoglobin (A1C) levels. Statin drugs are forbidden in patients with active liver disease, unknown reasons and elevated chronic liver enzyme transaminases. This has led to the need for patients who are not suitable for statins to seek treatment with other drugs.

For patients who do not respond well to or are intolerant to statins, several non-statin drugs may be used as adjuvant therapy. Including bile acids, fibric acids, niacin, cholesterol absorption and synthesis inhibitors, and PCSK9 inhibitors. Non-statin drugs achieve the effect of lowering lipoproteins mainly by combining bile acids, hindering bile acid reabsorption and intestinal hepatic circulation, increasing the conversion of cholesterol to bile acids, increasing the number of hepatic LDL-R to lower cholesterol, lowering triglycerides, increasing HDL-C, lowering Very Low Density Lipoprotein (VLDL) levels, inhibiting cholesterol absorption in the gut, and the like.

Proprotein convertase subtilisin/Kexin type 9 (PCSK 9) is a serine protease produced by hepatocytes. PCSK9 prevents LDL-R recycling by binding to LDL-R on the surface of hepatocytes, followed by induction of proteolytic degradation of LDL-R. This results in accumulation of LDL in the circulation and ultimately promotes atherosclerosis. Therefore, as long as the combination of PCSK9 and LDL-R can be blocked, and further the degradation of LDL-R in liver mediated by PCSK9 can be blocked, the level of LDL-R on the surface of liver cells can be increased, so that the uptake and removal of LDL-C are promoted, and the level of LDL-C in blood plasma is reduced. According to this concept, there are two currently approved antibody drugs for blocking PCSK9, a Mo Luobu mab (Alirocumab (Praluent)) developed in combination with cinnoline and regenerator, and an allo You Shan mab (Evolocumab (Repatha)) developed in progress, for heterozygous FH (HeFH) adults or clinical ASCVD patients requiring additional reduction of LDL-C. PCSK9 inhibitors have good lipid lowering effects, but at the same time have some drawbacks, such as susceptibility to allergic reactions, leading to discontinuation of the medication. Furthermore, evolocumab (Repatha) has a half-life of 11-17 days and Alirocumab (Praluent) has a half-life of 17-20 days (Chanukya Dahagam, aditya Goud, abdelhai Abdelqader1 et al, PCSK9 inhibitors and their role in high-risk patients in reducing LDL cholesterol levels: alirocumab. Future cardiol 2016; 12 (2): 149-57.) resulting in the need for a patient to inject the drug every half month or so.

Therefore, there is still a need to develop a novel drug for hyperlipidemia diseases, which can prolong the duration of drug effect and avoid inconvenience caused by repeated administration to patients while ensuring good therapeutic effect.

Disclosure of Invention

According to the principle that the combination of PCSK9 and LDL-R can be blocked to reduce LDL-C, the invention creatively invents a recombinant adeno-associated virus (rAAV) vector and a recombinant lentiviral vector for treating hyperlipidemia, the vector carries a gene for encoding an anti-PCSK 9 antibody or an antigen binding fragment thereof, and the anti-PCSK 9 antibody or the antigen binding fragment thereof can be continuously produced by a body in a mode of in-vivo administration, so that the PCSK9 content in the body is reduced, the LDL-R content is improved, and the aim of reducing the LDL-C content is fulfilled.

Accordingly, in a first aspect, the invention provides a nucleic acid construct for use in gene therapy comprising a nucleotide sequence encoding an anti-PCSK 9 antibody or antigen-binding fragment thereof, wherein the nucleotide sequence encoding an anti-PCSK 9 antibody or antigen-binding fragment thereof comprises a first coding region encoding a heavy chain variable region of the antibody and a second coding region encoding a light chain variable region of the antibody, and the first coding region and the second coding region are linked by a nucleotide sequence encoding a linker or an Internal Ribosome Entry Site (IRES).

In some embodiments, the anti-PCSK 9 antibody is selected from the group consisting of Alirocumab and evorocumab.

In some embodiments, the antigen-binding fragment derived from an anti-PCSK 9 antibody may be selected from Fab, fab ', F (ab') ₂ Fv, scFv and ds-scFv.

In some embodiments, the nucleic acid construct comprises a first coding region encoding a heavy chain of an anti-PCSK 9 antibody and the second coding region encoding a light chain of an anti-PCSK 9 antibody. In some embodiments, the nucleic acid construct encodes from 5 'to 3' the following structure:

(1) Alirocoumab heavy chain-linker-Alirocoumab light chain;

(2) Alirocoumab light chain-linker-Alirocoumab heavy chain;

(3) Evolocumab heavy chain-linker-Evolocumab light chain; or (b)

(4) Evolokumab light chain-linker-Evolokumab heavy chain;

wherein linker is a nucleotide sequence encoding a linker or an Internal Ribosome Entry Site (IRES).

In some embodiments, the Alirocoumab heavy chain comprises an amino acid sequence as set forth in SEQ ID NO. 17, or an amino acid sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99% sequence identity to SEQ ID NO. 17. In some embodiments, the nucleotide sequence encoding an Alirocoumab heavy chain in a nucleic acid construct of the present invention comprises a nucleotide sequence as set forth in SEQ ID NO. 19 or 21, or a nucleotide sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98% or at least 99% sequence identity to SEQ ID NO. 19 or 21.

In some embodiments, an Alirocoumab light chain comprises an amino acid sequence as set forth in SEQ ID NO. 18, or an amino acid sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99% sequence identity to SEQ ID NO. 18. In some embodiments, the nucleotide sequence encoding an Alirocoumab light chain in a nucleic acid construct of the present invention comprises a nucleotide sequence as set forth in SEQ ID NO. 20 or 22, or a nucleotide sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98% or at least 99% sequence identity to SEQ ID NO. 20 or 22.

In some embodiments, the Evolocumab heavy chain comprises an amino acid sequence as shown in SEQ ID NO. 23, or an amino acid sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99% sequence identity to SEQ ID NO. 23. In some embodiments, the nucleotide sequence encoding the Evolocumab heavy chain in a nucleic acid construct of the invention comprises the nucleotide sequence set forth in SEQ ID No. 25 or 27, or a nucleotide sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98% or at least 99% sequence identity to SEQ ID No. 25 or 27.

In some embodiments, the Evolocumab light chain comprises an amino acid sequence as shown in SEQ ID NO. 24, or an amino acid sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99% sequence identity to SEQ ID NO. 24. In some embodiments, the nucleotide sequence encoding an Evolocumab light chain in a nucleic acid construct of the invention comprises the nucleotide sequence set forth in SEQ ID No. 26 or 28, or a nucleotide sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98% or at least 99% sequence identity to SEQ ID No. 26 or 28.

The 2A peptide is a short peptide derived from a virus, which enables translation of a single transcript to produce multiple polypeptide chains. The 2A peptide acts by allowing the ribosome to jump over the synthesis of glycine and proline peptide bonds at the C-terminus of the 2A element, ultimately resulting in separation of the 2A sequence end and downstream polypeptide chains. After translation of the two proteins linked by the nucleotide sequence encoding the 2A peptide, the C-terminus of the upstream protein will add some additional 2A residues, while the N-terminus of the downstream protein will have additional proline.

In some embodiments, the linker encoded by the nucleotide sequence linking the first coding region and the second coding region is a 2A peptide linker. In some embodiments, the 2A peptide linker comprises a 2A peptide selected from the group consisting of: foot-and-mouth disease virus 2A peptide (F2A), porcine teschovirus 2A peptide (P2A), thosea asign virus 2A peptide (T2A), and equine rhinitis virus 2A peptide (E2A). In some preferred embodiments, the 2A peptide linker comprises an amino acid sequence selected from any one of SEQ ID NOs 30-33. In some more preferred embodiments, the 2A peptide linker comprises the amino acid sequence shown as SEQ ID NO. 31.

In some embodiments, the 5' ends of the first and second coding regions further comprise a nucleotide sequence encoding a signal peptide, and the signal peptides encoded by the first and second coding regions may be the same or different. In some preferred embodiments, the signal peptide may be selected from: SAP signal peptide, IHC signal peptide, ILC signal peptide, AP signal peptide, CSP signal peptide, IL2 signal peptide, TPA signal peptide, L1 signal peptide, H7 signal peptide, SP1 signal peptide, and H1 signal peptide. In some more preferred embodiments, the signal peptide may be selected from: IL2 signal peptide, TPA signal peptide, SP1 signal peptide, H7 signal peptide, H1 signal peptide, CSP signal peptide, and L1 signal peptide.

In some embodiments, the SAP signal peptide comprises an amino acid sequence as set forth in SEQ ID NO. 6.

In some embodiments, the IHC signal peptide includes the amino acid sequence shown as SEQ ID NO. 7.

In some embodiments, the ILC signal peptide comprises the amino acid sequence set forth in SEQ ID NO. 8.

In some embodiments, the AP signal peptide comprises the amino acid sequence shown as SEQ ID NO. 9.

In some embodiments, the CSP signal peptide comprises the amino acid sequence shown as SEQ ID NO. 10.

In some embodiments, the IL2 signal peptide comprises the amino acid sequence shown as SEQ ID NO. 11.

In some embodiments, the TPA signal peptide comprises the amino acid sequence shown as SEQ ID NO. 12.

In some embodiments, the L1 signal peptide comprises the amino acid sequence set forth in SEQ ID NO. 13.

In some embodiments, the H7 signal peptide comprises the amino acid sequence set forth in SEQ ID NO. 14.

In some embodiments, the SP1 signal peptide comprises the amino acid sequence set forth in SEQ ID NO. 15.

In some embodiments, the H1 signal peptide comprises the amino acid sequence set forth in SEQ ID NO. 16.

In some embodiments, the nucleic acid constructs of the invention comprise a nucleotide sequence as set forth in any one of SEQ ID NOs 41-51, or a nucleotide sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98% or at least 99% sequence identity to any one of SEQ ID NOs 41-51. In some preferred embodiments, the nucleic acid constructs of the invention comprise a nucleotide sequence as set forth in SEQ ID NO. 41 or 42, or a nucleotide sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98% or at least 99% sequence identity to SEQ ID NO. 41 or 42.

In some embodiments, a promoter is also included in the nucleic acid construct of the invention, operably linked to the nucleotide sequence encoding the anti-PCSK 9 antibody or antigen-binding fragment thereof, for expression of the nucleotide sequence. In some embodiments, the promoter is selected from any one of a CMV promoter, CBH promoter, EF1 a promoter, CAG promoter, CAGG promoter, CASI promoter, desmin promoter, TMCK promoter, MCK promoter, MHCK7 promoter, PGK promoter, TTR promoter. In some preferred embodiments, the promoter is selected from the group consisting of CAG promoter, CAGG promoter, and CBH promoter.

In some embodiments, the CMV promoter comprises a nucleotide sequence as shown at positions 235-818 of GenBank accession number MN 996867.1.

In some embodiments, the CBH promoter comprises a nucleotide sequence as set forth in SEQ ID NO. 1.

In some embodiments, the EF1 a promoter comprises a nucleotide sequence as shown in GenBank accession number KY447299.1, positions 529-1710.

In some embodiments, the CAG promoter comprises a nucleotide sequence as set forth in GenBank accession No. KC152483.1 at positions 200-1096.

In some embodiments, the CAGG promoter comprises a nucleotide sequence as shown at positions 63-1664 of GenBank accession No. GU 299216.1.

In some embodiments, the CASI promoter comprises a nucleotide sequence as shown in GenBank accession No. ON512571.1 at positions 80-1104.

In some embodiments, the desmin promoter comprises a nucleotide sequence as set forth in GenBank accession No. M63391.1 at positions 2194-3233.

In some embodiments, the TMCK promoter comprises the nucleotide sequence set forth in SEQ ID NO. 2.

In some embodiments, the MCK promoter comprises a nucleotide sequence as set forth in SEQ ID NO. 3.

In some embodiments, the MHCK7 promoter comprises a nucleotide sequence as set forth in SEQ ID NO. 4.

In some embodiments, the PGK promoter comprises a nucleotide sequence as shown at positions 683-1192 of GenBank accession number JF 313343.1.

In some embodiments, the TTR promoter comprises a nucleotide sequence set forth in SEQ ID NO. 5.

In some embodiments, the nucleic acid construct of the invention is a viral vector. In some embodiments, the viral vector of the invention is selected from the group consisting of bovine papilloma viral vectors, epstein barr viral vectors, retroviral vectors (e.g., lentiviral vectors), and adeno-associated viral vectors.

In some embodiments, the viral vector is an adeno-associated viral vector. In some preferred embodiments, the adeno-associated viral vector further comprises one or more elements selected from the group consisting of polyadenylation signal of SV40 virus (SV 40 SL), woodchuck hepatitis b virus post-transcriptional regulatory element (WPRE), and Inverted Terminal Repeat (ITR).

In some embodiments, the viral vector is a lentiviral vector. In some preferred embodiments, the lentiviral vector further comprises one or more elements selected from the group consisting of chimeric LTR promoter, HIV-1 packaging signal (ψ), central polypurine region (cPPT), rev Responsive Element (RRE), polypurine fragment (PPT), woodchuck hepatitis B virus post transcriptional regulatory element (WPRE), SV40 virus polyadenylation signal (SV 40 SL), SV40 virus replication initiation site (SV 40 ori) and self-inactivating long terminal repeat.

In a second aspect, the invention provides a viral particle comprising a nucleic acid construct as in the first aspect of the invention. In some preferred embodiments, the viral particles of the invention are adeno-associated viral particles or lentiviral particles.

In some embodiments, the viral particles of the invention are adeno-associated viral particles, and the adeno-associated viral particles are AAV8 or AAV6 serotypes.

In a third aspect, the invention provides a cell comprising a nucleic acid construct as in the first aspect of the invention.

In some embodiments, the nucleic acid construct comprised in the cell of the invention is an adeno-associated viral vector, said cell further comprising a serotype plasmid and/or helper plasmid for assembling said nucleic acid construct into a viral particle. In some preferred embodiments, the serotype plasmid is an AAV8 or AAV6 serotype plasmid.

In some embodiments, a serotype plasmid suitable for use in the present invention comprises a nucleotide sequence as set forth in SEQ ID NO 34 or 35 or a nucleotide sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98% or at least 99% sequence identity to SEQ ID NO 34 or 35.

In some embodiments, helper plasmids suitable for use in the present invention comprise a nucleotide sequence as set forth in SEQ ID NO. 36, or a nucleotide sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98% or at least 99% sequence identity to SEQ ID NO. 36.

In some embodiments, the nucleic acid construct comprised in the cell of the invention is a lentiviral vector, the cell further comprising an envelope plasmid and/or a packaging plasmid for assembling the nucleic acid construct into a viral particle.

In a fourth aspect, the invention provides a vector system comprising the nucleic acid construct of the first aspect of the invention, and optionally one or more additional vectors.

In some embodiments, the one or more additional vectors are plasmid vectors.

In some embodiments, the nucleic acid construct in the vector system is an adeno-associated viral vector, the vector system further comprising a serotype plasmid and/or helper plasmid for assembling the nucleic acid construct into a viral particle. In some preferred embodiments, the serotype plasmid is an AAV8 or AAV6 serotype plasmid.

In some embodiments, a serotype plasmid suitable for use in the present invention comprises a nucleotide sequence as set forth in SEQ ID NO 34 or 35 or a nucleotide sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98% or at least 99% sequence identity to SEQ ID NO 34 or 35. In some embodiments, helper plasmids suitable for use in the present invention comprise a nucleotide sequence as set forth in SEQ ID NO. 36, or a nucleotide sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98% or at least 99% sequence identity to SEQ ID NO. 36. In some embodiments, the vector system further comprises a host cell, preferably the host cell is a 293T cell.

In some embodiments, the nucleic acid construct in the vector system is a lentiviral vector, the vector system further comprising a helper plasmid (e.g., an envelope plasmid and/or a packaging plasmid) for assembling the nucleic acid construct into a viral particle. In some embodiments, the helper plasmid comprises one or more nucleotide sequences encoding gag and pol proteins and optionally nucleotide sequences encoding other viral packaging components. In some embodiments, the helper plasmid may include a packaging plasmid and/or an envelope plasmid. In some embodiments, the vector system further comprises a host cell, which may be a lentiviral producing cell, for example, 293T cell.

In a fifth aspect, the invention provides a composition comprising a nucleic acid construct as in the first aspect of the invention, a viral particle as in the second aspect of the invention, a cell as in the third aspect of the invention or a vector system as in the fourth aspect of the invention. Optionally, the compositions of the present invention further comprise a pharmaceutically acceptable carrier and/or excipient.

In a sixth aspect, the invention provides a kit comprising a nucleic acid construct as in the first aspect of the invention, a viral particle as in the second aspect of the invention, a cell as in the third aspect of the invention, a vector system as in the fourth aspect of the invention or a composition as in the fifth aspect of the invention. In some embodiments, the kits of the invention further comprise a device for intramuscular or intravenous injection.

In a seventh aspect, the present invention provides a method for preventing, ameliorating or treating a hyperlipidemic disorder in a subject, the method comprising the step of administering to the subject a nucleic acid construct as in the first aspect of the invention, a viral particle as in the second aspect of the invention, a cell as in the third aspect of the invention, a vector system as in the fourth aspect of the invention or a composition as in the fifth aspect of the invention. In some embodiments, the hyperlipidemia disease is selected from familial hypercholesterolemia and atherosclerosis.

In some preferred embodiments, the nucleic acid construct, viral particle, cell, vector system or composition of the invention is administered to a subject by intramuscular injection or intravenous injection.

The nucleic acid construct, viral particle, cell, vector system or composition of the invention has the following advantages in preventing, ameliorating or treating hyperlipidemic disorders in a subject:

1. the half-life of the traditional antibody in human body is relatively short after administration, so that the antibody medicine needs to be injected once every two weeks to one month, which brings much inconvenience to patients. The recombinant AAV vector is adopted to carry the gene of the anti-PCSK 9 antibody, so that the recombinant AAV vector can continuously express the anti-PCSK 9 antibody in the organism for a long time, and can treat hyperlipidemia (by reducing PCSK9 and increasing LDL-R, thereby reducing LDL-C) without repeated administration;

2. The technology of the invention only needs to obtain purified recombinant AAV virus, and the recombinant AAV virus is directly injected into a patient, thus completing the administration link.

Drawings

FIG. 1 shows the design concept of rAAV constructs.

FIG. 2 shows the results of protein detection of cell culture media after transient transfection of the plasmid of the monoclonal antibody rAAV construct into 293T cells.

FIG. 3 shows the results of protein expression assays following transduction of C2C12 cells by different constructs and different serotypes of rAAV.

FIG. 4A shows in vivo antibody protein expression levels of rAAV using different signal peptides.

FIG. 4B shows in vivo antibody protein expression levels of rAAVs of different serotypes.

FIG. 4C shows in vivo antibody protein expression levels of rAAV using different promoters.

FIG. 5A shows the free hPCSK9-flag concentration in the cell culture medium after infection of hPCSK 9-flag-expressing HepG2 cells with rAAV carrying the mab construct.

FIG. 5B shows LDLR and LDLR/GAPDH levels of HepG2 cells after infection of hPCSK 9-flag-expressing HepG2 cells with rAAV harboring the mab construct.

FIG. 6A shows the antibody protein expression levels of rAAV carrying a mab Alirocoumab construct in golden mice.

FIG. 6B shows the effect of rAAV carrying the mab Alirocoumab construct in lowering low density lipoprotein cholesterol (LDL-C) in golden mice.

FIG. 7 shows the effect of rAAV carrying the monoclonal antibody Evolocumab construct in reducing LDL-C and total cholesterol (T-CHO) in golden mice.

FIG. 8 shows antibody concentration in serum after injection of C57 mice with the rAAV carrying the mab construct.

Detailed Description

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

For easier understanding of the present disclosure, certain terms are first defined below. Additional definitions of the following terms and other terms are set forth throughout the specification.

As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

In this document, the terms "comprising," "having," "including," and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to").

Herein, "and/or" refers to and includes any and all possible combinations of one or more of the associated listed items. For example, composition comprising a and/or B may be interpreted as composition comprising a, composition comprising B, or composition comprising a and B.

All numerical designations, such as pH, temperature, time, concentration and molecular weight, including ranges, are approximations that may be varied by either 1.0 or 0.1 increments, or alternatively by +/-15%, 10%, 5%, 2% changes. It should be understood that all numerical designations are preceded by the term "about". It is also to be understood that the reagents described herein are merely exemplary and that equivalents thereof are known in the art. The term "about" as used herein when referring to a measurable amount, such as an amount or concentration, etc., is meant to include a change within 20%, 10%, 5%, 1%, 0.5% or 0.1% of the specified amount.

The terms "protein," "peptide," "polypeptide," and "amino acid sequence" are used interchangeably and refer in their broadest sense to a polymeric form of two or more amino acid subunits, amino acid analogs, or peptidomimetics. "protein", "peptide", "polypeptide" and "amino acid sequence" contain at least two amino acids, and there is no limitation on the maximum number of amino acids. The term "amino acid" as used herein refers to natural and/or unnatural or synthetic amino acids, including D and L optical isomers and amino acid analogs.

The terms "nucleic acid", "nucleic acid molecule", "nucleic acid sequence", "nucleotide sequence" and "polynucleotide" are used interchangeably herein and refer to a polymeric form of nucleotides of any length (ribonucleotides or deoxyribonucleotides). Thus, the term includes, but is not limited to, single-stranded, double-stranded or double-stranded DNA or RNA, genomic DNA, cDNA, DNA RNA hybrids, or polymers comprising, consisting of, or consisting essentially of purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derivatized nucleotide bases.

In this context, "expression" refers to the process by which a nucleic acid sequence is transcribed into mRNA and/or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, amino acid sequence, or protein. If the nucleic acid sequence is derived from genomic DNA, expression may include splicing mRNA in eukaryotic cells.

The term "encoding" when applied to a nucleic acid sequence refers to a nucleic acid sequence that is said to "encode" a polypeptide if it can be transcribed to produce mRNA and/or translated to produce the polypeptide in its natural state or when manipulated by methods well known to those of skill in the art. The antisense strand is the complement of such a nucleic acid and from which the coding sequence can be deduced.

"homology" or "identity" refers to sequence similarity between two polypeptides or between two nucleic acid sequences. The percent identity may be determined by comparing the positions in each sequence, which may be aligned for comparison purposes. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are identical at that position. The degree of identity between sequences depends on the number of matched positions that are shared. "unrelated" or "non-homologous" sequences share less than 40% identity, less than 25% identity with one of the sequences of the present invention. The alignment and percent sequence identity of the nucleic acid or amino acid sequences provided herein can be determined by introducing the nucleic acid or amino acid sequence into ClustalW (available from https:// genome. Jp/tools bin/ClustalW) and using the ClustalW.

The term "promoter" as used herein refers to an expression control sequence that controls the initiation and rate of transcription of a gene or transgene. Promoters may be, for example, constitutive, inducible, repressible or tissue specific. Promoters may contain genetic elements that regulate the binding of proteins and molecules such as RNA polymerase and transcription factors.

Non-limiting examples of promoters include pol I promoter, pol II promoter, pol III promoter, T7 promoter, U6 promoter, H1 promoter, retrovirus Rous sarcoma virus LTR promoter, cytomegalovirus (CMV) promoter, SV40 promoter, dihydrofolate reductase promoter, beta-actin promoter, elongation factor 1 alpha short (EFS) promoter, beta Glucuronidase (GUSB) promoter, cytomegalovirus (CMV) early (IE) enhancer and/or promoter, chicken beta-actin (CBA) promoter or derivatives thereof such as CAG promoter, CB promoter, (human elongation factor 1 alpha-subunit (EF 1 alpha) promoter, ubiquitin C (UBC) promoter prion promoters, neuron-specific enolase (NSE), neurofilament light chain (NFL) promoters, neurofilament heavy chain (NFH) promoters, platelet-derived growth factor (PDGF) promoters, platelet-derived growth factor B chain (PDGF-beta) promoters, synapsin (Syn) promoters, synapsin 1 (Syn 1) promoters, methyl-CpG binding protein 2 (MeCP 2) promoters, ca2+/calmodulin-dependent protein kinase II (CaMKII) promoters, metabotropic glutamate receptor 2 (mGluR 2) promoters, neurofilament light chain (NFL) promoters, neurofilament heavy chain (NFH) promoters, beta-globin minigene nβ2 promoters, pre-enkephalin (PPE) promoters, enkephalin (Enk) promoter, excitatory amino acid transporter 2 (EAAT 2) promoter, glial Fibrillary Acidic Protein (GFAP) promoter, myelin Basic Protein (MBP) promoter, or functional fragments thereof.

It is known in the art that the nucleotide sequences of these promoters can be modified to increase or decrease the efficiency of mRNA transcription. Promoters of synthetic origin may be used for ubiquitous or tissue-specific expression. In addition, promoters of viral origin, some of which are described above, may be used in the methods disclosed herein, such as CMV, HIV, adenovirus, and AAV promoters. In embodiments, the use of a promoter with an enhancer may increase transcription efficiency. Non-limiting examples of enhancers include the gap retinoid binding protein (IRBP) enhancer, the RSV enhancer, or the CMV enhancer.

As used herein, "poly A signal", "polyadenylation signal" or "polyadenylation signal" refers to an RNA sequence located downstream of the 3 'most coding region and is recognized by RNA cleavage complexes that cleave the 3' terminal sequence of newly transcribed RNA by RNA polymerase (e.g., pol II) such that polyadenylation can occur. Then, by adding an adenosine monophosphate unit from ATP to the nascent cleaved 3' end of the RNA, a poly a tail is added and extended by a poly a polymerase. The poly A tail (or poly A tail) protects the mRNA from exonuclease attack and is important for transcription termination, nuclear export of the mRNA and subsequent translation.

Exemplary polyadenylation signals include bovine growth hormone polyadenylation signal (bg poly a), small poly a Signal (SPA), human growth hormone polyadenylation signal (hGH poly a), SV40 viral polyadenylation signal (SV 40 poly a), rabbit β -globin poly a sequence (rBG poly a), or variants thereof.

Herein, the term "antibody" refers to an immunoglobulin molecule that has the ability to specifically bind to a particular antigen. Antibodies typically comprise a variable region and a constant region in each of the heavy and light chains. The variable regions of the heavy and light chains of antibodies contain binding domains that interact with the antigen. The constant region of an antibody may mediate the binding of an immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and components of the complement system such as C1q (the first component of the classical pathway of complement activation). Thus, most antibodies have a heavy chain variable region (VH) and a light chain variable region (VL) that together form the part of the antibody that binds to an antigen.

The term "antibody" as used herein is to be understood in its broadest sense and includes monoclonal antibodies (including full length monoclonal antibodies), polyclonal antibodies, antibody fragments, and multispecific antibodies (e.g., bispecific antibodies) that contain at least two antigen-binding regions. Antibodies may contain additional modifications such as non-naturally occurring amino acids, mutations in the Fc region, and mutations in glycosylation sites. Antibodies also include post-translationally modified antibodies, fusion proteins comprising an epitope of an antibody, and any other modified immunoglobulin molecule comprising an antigen recognition site, so long as the antibodies exhibit the desired biological activity.

In this context, the term "monoclonal antibody" generally refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies in the population are identical except for the small number of natural mutations that may be present. Monoclonal antibodies are generally highly specific for a single antigenic site. Moreover, unlike conventional polyclonal antibody preparations (which typically have different antibodies directed against different determinants), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, monoclonal antibodies have the advantage that they can be synthesized by hybridoma culture without contamination by other immunoglobulins. The modifier "monoclonal" refers to the characteristics of the antibody as obtained from a substantially homogeneous population of antibodies and is not to be construed as requiring production of the antibody by any particular method. For example, monoclonal antibodies for use according to the invention may be prepared in hybridoma cells or may be prepared by recombinant DNA methods.

Herein, the term "antigen-binding fragment" of an antibody refers to one or more fragments of an antibody that retain the ability to specifically bind an antigen (e.g., PCSK9 protein described herein). It has been shown that the antigen binding function of an antibody can be performed by fragments of full length antibodies.

Examples of the term "antigen binding fragment" of an antibody include: (i) A Fab fragment, a monovalent fragment consisting of VL, VH, CL and CH1 domains; (ii) F (ab') ₂ A fragment comprising a bivalent fragment of two Fab fragments linked by a disulfide bond at the hinge region; (iii) Fab' fragments, which are essentially Fab with a partial hinge region; (iv) Fd fragment consisting of VH and CH1 domains; (v) Fd' fragments having VH and CH1 domains and one or more cysteine residues at the C-terminus of the CH1 domain; (vi) Fv fragment consisting of VL and VH domains of the antibody single arm; (vii) a dAb fragment consisting of a VH domain; (viii) individual Complementarity Determining Regions (CDRs); (ix) Nanobodies, heavy chain variable regions containing a single variable domain and two constant domains. Furthermore, although the two domains of the Fv fragment, VL and VH, are encoded by separate genes, they can be joined, using recombinant methods, by a synthetic linker, enabling them to form a single protein chain, in which the VL and VH regions pair to form monovalent molecules, known as single chain Fv (scFv). Such single chain antibodies are also intended to be encompassed within the term "antigen-binding fragment" of an antibody. In addition, the term also includes "linear antibodies" comprising a pair of tandem Fd fragments (VH-CH 1-VH-CH 1) that together form an antigen binding region with a complementary light chain polypeptide and any modified form of the foregoing fragments that retain antigen binding activity.

These antigen binding fragments can be obtained using conventional techniques known to those skilled in the art and the fragments screened for utility in the same manner as whole antibodies.

In this context, the term "binding" or "specific binding" refers to a non-random binding reaction between two molecules, such as an antibody and its target antigen. The binding specificity of an antibody may be determined based on affinity and/or avidity. Affinity is expressed by the equilibrium constant (KD) for antigen-to-antibody dissociation, a measure of the strength of binding between an epitope and the antigen binding site of an antibody: the smaller the value of KD, the stronger the binding strength between the epitope and the antibody. Alternatively, affinity can also be expressed as an affinity constant (KA), which is 1/KD. Avidity is a measure of the strength of binding between an antibody and the associated antigen. Avidity relates to the affinity between an epitope and the antigen binding site of an antibody and the number of relevant binding sites present on the antibody.

Specific binding of an antibody to an antigen or antigenic determinant can be determined in any known suitable manner, including, for example, scatchard analysis and/or competitive binding assays, such as Radioimmunoassays (RIA), enzyme Immunoassays (EIA) and sandwich competition assays, as well as different variants thereof known in the art.

Equivalents having one or more amino acid modifications as compared to the antibodies or antigen binding fragments thereof described herein are also contemplated within the scope of the invention, provided that the one or more amino acid modifications do not affect or substantially affect the ability of the antibodies or antigen binding fragments thereof to specifically bind to an antigen. In this context, an amino acid modification may be an amino acid substitution, an amino acid deletion or an amino acid insertion. Amino acid substitutions may be conservative amino acid substitutions or non-conservative amino acid substitutions. Conservative substitutions (also known as conservative mutations, conservative substitutions or conservative variations) are amino acid substitutions in a protein that change a given amino acid to a different amino acid having similar biochemical properties (e.g., charge, hydrophobicity, or size). In this context, "conservative substitution" refers to the replacement of an amino acid residue by another, biologically similar residue. Examples of conservative substitutions include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another; or one charged or polar residue for another, such as arginine for lysine, glutamic for aspartic acid, glutamine for asparagine, and the like. Other illustrative examples of conservative substitutions include the following variations: alanine to serine; asparagine to glutamine or histidine; aspartic acid to glutamic acid; cysteine to serine; glycine to proline; histidine to asparagine or glutamine; lysine to arginine, glutamine or glutamic acid; phenylalanine to tyrosine and serine to threonine; threonine to serine; tryptophan changes to tyrosine; tyrosine to tryptophan or phenylalanine; etc.

The term "vector" generally refers to a nucleic acid molecule capable of self-replication in a suitable host, which transfers the inserted nucleic acid molecule into and/or between host cells. The vector may include a vector mainly used for inserting DNA or RNA into a cell, a vector mainly used for replicating DNA or RNA, and a vector mainly used for expression of transcription and/or translation of DNA or RNA. The carrier also includes a carrier having a plurality of functions as described above. The vector may be a polynucleotide capable of transcription and translation into a polypeptide when introduced into a suitable host cell. Typically, the vector will produce the desired expression product by culturing a suitable host cell comprising the vector.

Herein, "viral vector" refers to a vector capable of being packaged to recombinantly produce viral particles that contains a polynucleotide to be delivered into a host cell in vivo, ex vivo, or in vitro. Examples of viral vectors include retroviral vectors, AAV vectors, lentiviral vectors, adenoviral vectors, alphaviral vectors, and the like.

In this context, the term "cell" generally refers to an individual cell, cell line or cell culture which may or has contained a plasmid or vector comprising a nucleic acid molecule as described herein, or which is capable of expressing an antibody or fusion protein as described herein. The cell may comprise progeny of a single host cell. The progeny cells may not necessarily be identical in morphology or in genome to the original parent cell due to natural, accidental or deliberate mutation, but are capable of expressing the antibody fusion proteins described herein. The cells may be obtained by transfecting the cells in vitro using the vectors described herein. The cells may be prokaryotic cells (e.g., E.coli) or eukaryotic cells (e.g., yeast cells, e.g., COS cells, chinese Hamster Ovary (CHO) cells, heLa cells, HEK293 cells, COS-1 cells, NS0 cells, or myeloma cells). In some cases, the cell may be a mammalian cell. For example, the mammalian cell may be a CHO-K1 cell. As used herein, the term "recombinant cell" generally refers to a cell into which a recombinant nucleic acid construct has been introduced. The recombinant host cell includes not only a particular cell but also the progeny of such a cell.

As used herein, the terms "transduction," "transfection," and "transformation" refer to the process by which delivery of a heterologous polynucleotide to a host cell occurs to produce a polypeptide product by transcription and translation, including the use of recombinant viruses to introduce the heterologous polynucleotide into the host cell.

As used herein, the term "infection" refers to the process by which a virus or viral particle comprising a polynucleotide component delivers a polynucleotide into a cell and produces its RNA and protein products, as well as the replication process of the virus in a host cell.

"multiplicity of infection" (abbreviated MOI) herein refers to the ratio of virus to the number of cells added when infecting cells with the virus.

The term "titer" of a virus refers herein to the number of virus vector particles capable of infecting per volume of liquid. The number of viral vector particles having a defined transduction capacity per milliliter of viral vector product, i.e. Transduction Units (TU) per milliliter (TU/ml), is specified herein.

As used herein, the term "expression cassette" or "expression cassette" refers to a polynucleotide sequence having the potential to encode a protein, which may comprise a promoter, coding sequence, terminator, and optionally, enhancer, untranslated region (UTR), intron, polyadenylation signal, and the like.

The "adeno-associated virus" or "AAV" belongs to the genus dependently parvovirus (Parvovirus), family Parvoviridae. AAV is a single stranded DNA virus, consisting of a viral genome and a capsid. AAV genomes include the rep gene and cap gene flanked by two Inverted Terminal Repeats (ITRs). Wherein, the Rep protein encoded by the Rep gene is related to the replication and packaging of the virus, and the cap gene encodes the capsid protein of the virus. "ITRs" or "inverted terminal repeats" can form T-palindromic structures that are involved in the replication and packaging process of AAV, which are typically necessary to complete the cleavage and latent life cycle of AAV. AAV is itself replication-defective and can only be rendered latent in host cells in the absence of helper virus. Thus, production of AAV vectors typically requires helper plasmids (phelpers) to provide the key genes involved in AAV replication and serotype plasmids to provide the capsid proteins encoding the AAV particles.

AAV has now been found to exist in more than ten common serotypes and hundreds of varieties, the major differences being the differences in cap genes encoding capsid proteins. Serotypes of AAV are primarily determined by the structure of the capsid proteins and include, but are not limited to: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, AAV-DJ/B, AAV php.b, AAV php.eb, AAV php.s, AAVrh74.

Herein, "AAV vector" and "recombinant AAV (rAAV) vector" are used interchangeably and refer to a vector comprising one or more heterologous nucleic acid sequences and one or more ITRs. When an AAV vector is present in a host cell, the AAV vector carrying the gene of interest can be replicated and packaged into infectious viral particles with the aid of helper and serotype plasmids.

In this context, lentiviral vectors (Lentiviral vector) include viral vectors engineered on the basis of HIV-1 virus that are capable of efficiently introducing a gene of interest (or RNAi) into primary cells or cell lines of animals and humans. The lentiviral vector genome is a positive strand RNA, and after entering a cell, the genome is inverted into DNA in the cytoplasm by a reverse transcriptase carried by the genome itself, so that a DNA pre-integration complex is formed, and after entering the cell nucleus, the DNA is integrated into the cell genome. The integrated DNA transcribes mRNA back into the cytoplasm and expresses the protein of interest.

Lentiviral vectors are capable of efficient infection and integration into non-dividing cells, a property that makes lentiviral vectors distinct compared to other viral vectors, such as non-integrating adenovirus vectors, low integration adeno-associated virus vectors, traditional retroviral vectors that integrate dividing cells only. A large number of literature studies indicate that tissues or cells for long-term expression of a target gene mediated by lentiviral vectors include brain, liver, muscle, retina, hematopoietic stem cells, bone marrow mesenchymal stem cells, macrophages, and the like. The lentiviral vector does not express any HIV-1 protein, has low immunogenicity, no cellular immune response at the injection site, and lower humoral immune response, and does not affect the second injection of the viral vector.

The terms "patient" and "subject" are used interchangeably herein and in their conventional sense to refer to an organism suffering from or susceptible to a condition that can be prevented or treated by administration of a viral vector or viral particle or composition of the invention, and include humans and non-human animals.

The subject may be a non-human animal (e.g., chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs; birds including poultry, wild birds and game birds such as chickens, turkeys and other chickens, ducks, geese, etc.). In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.

Herein, the term "administering" is intended to mean delivering a substance to a subject, such as an animal or a human. Administration may be performed in a single dose, continuously or intermittently throughout the course of treatment. Methods of determining the most effective mode and dosage of administration are known to those skilled in the art and will vary with the composition used for treatment, the purpose of the treatment, and the age, health, or sex of the subject being treated. In some embodiments, single or multiple administrations may be performed, with the dosage level and pattern selected by the physician, or in the case of pets and other animals, by the veterinarian.

Herein, the term "treatment" includes: (1) Inhibiting a condition, disease, or disorder, i.e., arresting, reducing, or delaying the progression of the disease or its recurrence or the progression of at least one clinical or sub-clinical symptom thereof; or (2) alleviating the disease, i.e., causing regression of at least one of the condition, disease, or disorder, or a clinical or subclinical symptom thereof.

In this context, the term "improvement" refers to an improvement in a symptom associated with a disease, and may refer to an improvement in at least one parameter that measures or quantifies the symptom.

Herein, the term "preventing" a condition, disease, or disorder includes: preventing, delaying or reducing the incidence and/or likelihood of the occurrence of at least one clinical or subclinical symptom of a condition, disease or disorder developing in a subject who may have or be susceptible to the condition, disease or disorder but who has not yet experienced or exhibited the clinical or subclinical symptom of the condition, disease or disorder.

The term "pharmaceutically acceptable" refers to a carrier, excipient, or diluent that is, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

The term "pharmaceutical composition" generally refers to a formulation that exists in a form that allows for the biological activity of the active ingredient to be effective and that does not contain additional ingredients that have unacceptable toxicity to the subject to which the composition is to be administered. The composition is sterile. The "sterile" composition is sterilized, or is free of all living microorganisms and their spores.

Exemplary carriers for use in the pharmaceutical compositions of the invention include saline, buffered saline, dextrose, and water. Exemplary excipients for use in the compositions of the present invention include fillers, binders, disintegrants, coating agents, adsorbents, anti-adherent agents, glidants, preservatives, antioxidants, flavoring agents, coloring agents, sweeteners, solvents, co-solvents, buffering agents, chelating agents, viscosity imparting agents, surfactants, diluents, wetting agents, carriers, diluents, preservatives, emulsifiers, stabilizers, and tonicity adjusting agents. The selection of suitable excipients to prepare the compositions of the present invention is known to those skilled in the art. In general, the choice of suitable excipients depends inter alia on the active agent used, the disease to be treated and the desired dosage form of the composition.

The term "kit" generally refers to a packaged product comprising components for administering the nucleic acid constructs, viral vectors, or pharmaceutical compositions of the invention to treat or prevent a related disease. The components of the kit may be contained in separate vials (i.e., a kit having separate portions), or provided within a single vial. The kit may comprise reagents such as buffers, protein stabilizing reagents, signal generating systems (e.g., fluorescent signal generating systems), antibodies, control proteins, and test containers. The kit may also comprise instructions for carrying out the method. In some embodiments of the invention, the kit may further comprise an administration device capable of administering the pharmaceutically active ingredient (e.g., an antibody or antigen binding fragment thereof of the invention) in the kit to a subject in a suitable manner.

The invention will be further described with reference to specific embodiments and drawings in order to make the objects, technical solutions and advantages of the invention more apparent, and the advantages and features of the invention will be more apparent from the description. It should be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental procedure, without specific conditions noted in the examples below, is by molecular cloning according to conditions conventional in the art, for example, sambrook and Russeii et al: laboratory manual (third edition) (2001), conditions described in CSHL press, or conditions recommended by the manufacturer. Unless otherwise indicated, the experimental materials and reagents used in the following examples are all commercially available.

Examples

Example 1: rAAV construct design for anti-PCSK 9 antibody monoclonal antibody structure

The gene expression frame of the target protein is designed and optimized, and the gene expression frame is inserted into an adeno-associated virus vector pAAV-Amp, so that a recombinant adeno-associated virus construct plasmid capable of expressing the required protein can be obtained (figure 1). The pAAV-Amp vector is derived from Kang Lin Biotechnology (Hangzhou) and comprises elements such as the polyadenylation signal (SV 40 SL) and the Inverted Terminal Repeat (ITR) of the SV40 virus.

The amino acid sequence was decoded as a nucleotide sequence based on the heavy chain amino acid sequence of the anti-PCSK 9 antibody Alirocumab (SEQ ID NO: 17), the light chain amino acid sequence (SEQ ID NO: 18), the heavy chain amino acid sequence of Evolocumab (SEQ ID NO: 23), and the light chain amino acid sequence (SEQ ID NO: 24), and sequence optimization was performed. The GC content of the nucleotide sequences encoding the heavy and light chains may be about 52% before optimization or about 62% after optimization (expressed as (GC)). Before sequence optimization, the nucleotide sequences of the heavy chain and the light chain of Alirocumab are SEQ ID NO. 19 and SEQ ID NO. 20 respectively; the nucleotide sequences encoding the heavy and light chains of Evolocumab are SEQ ID NO. 25 and SEQ ID NO. 26, respectively. After sequence optimization, the nucleotide sequences of the heavy chain and the light chain of Alirocumab are SEQ ID NO. 21 and SEQ ID NO. 22 respectively; the nucleotide sequences encoding the heavy and light chains of Evolocumab are SEQ ID NO 27 and SEQ ID NO 28, respectively.

Designing a gene expression cassette comprising a nucleotide sequence encoding Alirocumab or evorocumab, the expression cassette may comprise: promoters, kozak sequences, heavy chain signal peptides, heavy chain sequences, cleavable 2A peptides, light chain signal peptides, light chain sequences, WPRE (SEQ ID NO: 29), UTR (SEQ ID NO: 40).

The promoter may be any one of CMV promoter (GenBank: MN996867.1, 235-818), CBH promoter (SEQ ID NO: 1), EF 1. Alpha. Promoter (GenBank: KY447299.1, 529-1710), CAG promoter (GenBank: KC152483.1, 200-1096), CAGG promoter (GenBank: GU299216.1, 63-1664), CASI promoter (GenBank: ON512571.1, 80-1104), desmin promoter (GenBank: M63391.1, 2194-3233), TMCK promoter (SEQ ID NO: 2), MCK promoter (SEQ ID NO: 3), MHCK7 promoter (SEQ ID NO: 4), PGK promoter (GenBank: JF313343.1, 683-2), TTR promoter (SEQ ID NO: 5). The signal peptide may be any one of SAP signal peptide (SEQ ID NO: 6), IHC signal peptide (SEQ ID NO: 7), ILC signal peptide (SEQ ID NO: 8), AP signal peptide (SEQ ID NO: 9), CSP signal peptide (SEQ ID NO: 10), IL2 signal peptide (SEQ ID NO: 11), TPA signal peptide (SEQ ID NO: 12), L1 signal peptide (SEQ ID NO: 13), H7 signal peptide (SEQ ID NO: 14), SP1 signal peptide (SEQ ID NO: 15) and H1 signal peptide (SEQ ID NO: 16). The 2A peptide may be any of T2A (SEQ ID NO: 30), F2A (SEQ ID NO: 31), E2A (SEQ ID NO: 32), P2A (SEQ ID NO: 33).

Example 2: construction of anti-PCSK 9 antibody monoclonal antibody rAAV construct plasmid

The gene expression cassette of the anti-PCSK 9 antibody designed in example 1 was cloned into a rAAV vector, the rAAV construct backbone was derived from pAAV-Amp, a company of Kang Lin biotechnology (hangzhou).

Sequence fragments of the gene expression cassette of the anti-PCSK 9 antibody designed in example 1 were obtained: sequences of Alirocoumab and Evolocumab were synthesized by general biosystems (Anhui), and sequence fragments of elements such as promoter, signal peptide, WPRE, etc., were obtained by Polymerase Chain Reaction (PCR) amplification as known in the art.

The obtained fragment was cloned between the multiple cloning sites MluI/XhoI on the adeno-associated viral nucleic acid construct pAAV-Amp by methods known in the art, sequence information was confirmed by sequencing after cloning was completed, and rAAV was named according to a combination of different elements, such as pAAV-Amp-CBH-Alirocumab et al (rAAV without labeled signal peptide used signal peptide H7).

The obtained rAAV construct plasmid is transiently transfected into 293T cells, supernatant of the 293T cells is obtained after 48 hours, 20 mu L of supernatant is subjected to SDS-PAGE electrophoresis, and the expressed antibody is transferred onto a PVDF membrane. Western blotting experiments were performed with HRP-labeled goat anti-human IgG Fc antibody (available from KPL, cat. No. 01-10-06) as the secondary antibody. The experimental results (fig. 2) show that the rAAV construct plasmid can efficiently express the protein of interest after transient transfection of cells in vitro and secrete the mature antibody protein into the cell culture supernatant.

Example 3: virus packaging of anti-PCSK 9 antibody monoclonal antibody rAAV

rAAV construct plasmids constructed in example 2 (e.g., pAAV-amp-CBH-Alirocoumab et al), AAV serotype plasmids (pAAV-RC 8, having the nucleotide sequence shown in SEQ ID NO: 34 or pAAV-RC6.2FF, having the nucleotide sequence shown in SEQ ID NO: 35), and Helper plasmids (pAAV-Helper, having the nucleotide sequence shown in SEQ ID NO: 36) were co-transfected simultaneously with 293T cells (available from American Type Culture Collection (ATCC), accession No. CRL-3216) and rAAV viral packaging was performed in the 293T cell line. The transfection method is transient transfection of eukaryotic cells mediated by PEI cationic polymer, PEI-Max transfection reagent (from Polysciences, cat# 24765-1) purchased from Polysciences, the transfection procedure was performed with reference to the manufacturer's recommended standardization procedure, the transfection scale was 15cm ² Cell culture dishes.

After 72 hours of transfection, the cell supernatants and cells were collected together into 50mL centrifuge tubes. Cells and supernatants were first isolated by centrifugation on a bench bucket machine at 4200rpm for 10 minutes at room temperature. Transfer supernatant to fresh 50mL centrifuge tube and add MgCl ₂ And ribozyme, mix well for use. Adding ribozyme and cell lysate into the rest cells, standing at room temperature for 1h, centrifuging at room temperature 10000g for 10min, transferring supernatant to original cell supernatant, mixing, performing affinity purification concentration, filling 5mL chromatographic column with affinity filler (POROS AAVX affinity resin, thermo, product No. A36743), balancing column with balancing solution (20 mmol/L PB,0.15mol/L NaCl, pH 7.4+ -0.2), loading sample after balancing, balancing solution for 5 column volumes after loading, eluting AAV sample about 8mL with eluting buffer (0.1 mol/L glycine,0.15mol/L NaCl, pH 2+ -0.1), concentrating and changing solution to 1mL with 100KD ultrafilter (Milpore, product No. UFC 8100), and changing AAV solvent to 180mM NaCl,10mM PB,0.001% F-68. And (5) sub-packaging the purified sample, and freezing the sample in a refrigerator at the temperature of-80 ℃.

The physical titer of the rAAV virus is calculated according to the quantitative PCR result and the AAV standard as a reference by a method well known in the art, wherein the rAAV standard is AAV2 with known titer, the inclusion gene is CMV-EGFP (purchased from ATCC, product number VR-1616), the AAV standard is cracked by using AAV lysate, gradient dilution is used as a standard, the sample rAAV is diluted to the range included by a standard curve according to the estimated titer after being cracked by using the lysate, and qPCR is used for titer measurement and converted to VG/mL.

The primer probe sequences used for quantitative PCR are:

ITR-forward primer: GGAACCCCTAGTGATGGAGTT (SEQ ID NO: 37)

ITR probe: 5'-CACTCCCTCTCTGCGCGC-3' (SEQ ID NO: 38)

ITR-reverse primer: CGGCCTCAGTGAGCGA (SEQ ID NO: 39)

Wherein the ITR probe has a FAM fluorescent group at the 5 'end and a BHQ1 fluorescent group at the 3'.

Example 4: expression detection of anti-PCSK 9 antibody monoclonal antibody rAAV virus

The rAAV obtained after the packaging and purification process in example 3 was subjected to verification of intracellular expression in a C2C12 cell line. The C2C12 cell line is a sub-strain of the mouse myoblast line established by YaffeD, saxelO. The cells differentiate rapidly and can differentiate into myotubes with multinuclear under the condition of low horse serum induction. According to rAAV vector resuspension titer, rAAV was inoculated at multiplicity of infection (Multiple of Infection, MOI) of 5E4 into C2C12 cell lines pre-plated in 24 well cell culture plates and differentiated, and cell supernatants were harvested 3 days after infection for the following experiments:

The supernatant of rAAV-infected C2C12 cells was collected, 20. Mu.L of the supernatant was subjected to SDS-PAGE, and the expressed antibody was transferred to PVDF membrane. Western blotting experiments were performed with HRP-labeled goat anti-human IgG Fc antibody (purchased from KPL, cat# 01-10-06) as the secondary antibody. The experimental results (FIG. 3) show that recombinant adeno-associated virus can efficiently express the target protein after in vitro transduction of cells, and secrete the mature antibody protein into the cell culture supernatant.

The rAAV virus obtained after the packaging purification process in example 3 was validated in 57bl/6 mice purchased from velocin, injected with the same dose of rAAV by intramuscular injection, sampled periodically through the orbit and subjected to the following test:

blood samples from the eyesockets were centrifuged at 4200rpm for 5 minutes to obtain serum, hPCSK9 coated ELISA plates were prepared, the serum was added to the ELISA plates at 5 μl/well, the standard was purified Alirocumab or Evolokumab protein, and the concentration of Alirocumab or Evolokumab protein in the serum was measured by ELISA detection. The experimental results show that recombinant adeno-associated viruses with different signal peptides (table 1, fig. 4A), different serotypes (table 2, fig. 4B) and different promoters (table 3, fig. 4C) can all effectively express the target protein in mice and secrete the mature antibody protein into serum.

TABLE 1 expression levels of antibody proteins using different Signal peptides

TABLE 2 expression levels of antibody proteins for rAAV of different serotypes

TABLE 3 expression levels of antibody proteins using different promoters

Example 5: in vitro lipid lowering effect of anti-PCSK9 antibody monoclonal antibody rAAV

The rAAV product AAV8-CAGG- (GC) Alirocumab-WPRE produced from the construct pAAV-amp-CAGG- (GC) Alirocumab-WPRE was packaged, hepG2 cells highly expressing hPCK 9-flag were infected at different multiplicity of viral infection (MOI), and after 72H the cell culture supernatants were harvested, the concentration change of free hPCK 9-flag in the cell culture medium was detected by ELISA methods well known in the art, and the primary antibody was anti-PCSK9 rabbit antibody (purchased from sin, cat# 10594-T24) and the secondary antibody was HRP-labeled goat anti-rabbit IgG (H+L) antibody (purchased from KPL, cat# 5220-0283). Meanwhile, hepG2 cells were lysed using protein lysate, and the change in LDLR/GAPDH in the cell lysate was detected by Western blotting method well known in the art, primary antibodies were anti-LDLR rabbit antibody (purchased from sino, cat.10231-R202) and anti-GAPDH mouse antibody (purchased from BBI, cat# D190090-0100), secondary antibodies were HRP-labeled goat anti-rabbit IgG (H+L) antibody (purchased from KPL, cat# 5220-0283) and HRP-labeled goat anti-mouse IgG Fc antibody (purchased from KPL, cat# 5220-0341), and the band gray values were analyzed by ImageJ software. The results show that the rAAV product can reduce the concentration of free hPCSK9-flag in a cell culture medium (table 4, figure 5A) and improve the content of LDLR (table 5, figure 5B) under the condition of different MOI, namely the rAAV product has good lipid-lowering effect, and the effect is proportional to the dosage in a certain range.

TABLE 4 free hPCSK9-flag concentration in cell culture Medium under different MOI infection conditions

TABLE 5 variation of LDLR levels of HepG2 cells under different MOI infection conditions

Example 6: in vivo lipid lowering effect of anti-PCSK 9 antibody monoclonal antibody rAAV

The rAAV product AAV6.2FF-CAG-UTR-IL2- (GC) Alirocumab-WPRE produced by packing pAAV-amp-CAG-UTR-IL2- (GC) Alirocumab-WPRE was injected into golden rats at different doses (injection doses of 5E12vg/Kg, 5E11vg/Kg for high dose and low dose groups, respectively), and the purchased finished drug Praluant was injected at weeks 1 and 2 with 10mg/Kg as positive control, respectively, followed by periodic detection of blood lipid changes in golden rats. In terms of antibody concentration, the concentration of Alirocumab produced by the low dose group of rAAV product was comparable to the positive control, and the concentration of Alirocumab produced by the high dose group was consistently higher than the positive control group (fig. 6A). In terms of efficacy, the high dose group of rAAV product could achieve an effect similar to that of the finished drug Praluent at weeks 1 to 4, whereas the finished drug Praluent had failed at week 12, but the high dose group of rAAV product remained effective (fig. 6B).

The rAAV product AAV6.2FF-CAG-UTR-IL2- (GC) Evoloumab-WPRE produced by the pAAV-amp-CAG-UTR-IL2- (GC) Evoloumab-WPRE package was injected into golden mice at a high dose (30 mg/kg), and the purchased finished drug, repath, was injected at 10mg/kg, 30mg/kg, followed by periodic detection of blood lipid changes in golden mice. The results show that the high dose group of rAAV products (30 mg/kg) can reduce the concentration of low density lipoprotein cholesterol and total cholesterol (fig. 7), with an effect similar to that of finished drug Repatha, which failed due to short half-life after day 14, but the rAAV products still maintained the effect.

There are studies showing that the effect of lowering free PCSK9 and LDL-C can be achieved by maintaining the Alirocumab concentration at 5. Mu.g/mL in patients (Jennifer G Robinson, michel Farnier, john J P Kastelein, et al Relationship between Alirocumab, PCSK9, and LDL-C levels in four phase 3 ODYSSEY trials using 75 and 150 mg doses. J Clin Lipidol. 2019 Nov-Dec;13 (6): 979-988.e10.), whereas the rAAV products of the invention can be maintained at concentrations above 5. Mu.g/mL for long periods of time by Intravenous (IV) and Intramuscular (IM) injections at low doses (Table 6, FIG. 8).

TABLE 6 antibody concentration in serum after injection of rAAV in C57 mice (μg/mL)

/>

Claims

1. A vector system comprising an adeno-associated virus (AAV) vector for gene therapy and a serotype plasmid for assembling the AAV vector into a viral particle, the AAV vector comprising a nucleotide sequence encoding an anti-PCSK 9 antibody or antigen-binding fragment thereof, wherein the nucleotide sequence encoding an anti-PCSK 9 antibody or antigen-binding fragment thereof comprises a first coding region encoding a heavy chain variable region of the antibody and a second coding region encoding a light chain variable region of the antibody, and the first coding region and the second coding region are linked by a nucleotide sequence encoding a linker or an Internal Ribosome Entry Site (IRES);

Wherein the anti-PCSK 9 antibody is selected from the group consisting of an a Mo Luobu mab (Alirocumab) and an allo You Shan antibody (evorocumab);

wherein the nucleotide sequence encoding the anti-PCSK 9 antibody or antigen-binding fragment thereof is operably linked to a promoter, and the promoter is selected from the group consisting of a CAG promoter and a CAGG promoter;

wherein the serotype plasmid is an AAV8 or AAV6 serotype plasmid.

2. The vector system of claim 1, wherein the serotype plasmid is a AAV6.2FF serotype plasmid.

3. The vector system of claim 1, wherein the vector system further comprises a helper plasmid.

4. The vector system of claim 1A system, wherein the antigen binding fragment is selected from the group consisting of: fab, fab ', F (ab') ₂ Fv, scFv and ds-scFv.

5. The vector system of claim 1, wherein said first coding region encodes a heavy chain of said antibody and said second coding region encodes a light chain of said antibody.

6. The vector system of claim 1, wherein the AAV vector encodes the following structure from 5 'end to 3' end:

(1) Alirocoumab heavy chain-linker-Alirocoumab light chain;

(2) Alirocoumab light chain-linker-Alirocoumab heavy chain;

(3) Evolocumab heavy chain-linker-Evolocumab light chain; or (b)

(4) Evolokumab light chain-linker-Evolokumab heavy chain;

7. The vector system of claim 6, wherein said Alirocumab heavy chain has an amino acid sequence as set forth in SEQ ID No. 17 and said Alirocumab light chain has an amino acid sequence as set forth in SEQ ID No. 18; and/or the Evolocumab heavy chain has an amino acid sequence as shown in SEQ ID NO. 23, and the Evolocumab light chain has an amino acid sequence as shown in SEQ ID NO. 24.

8. The vector system of claim 1, wherein the linker is a 2A peptide linker.

9. The vector system of claim 8, wherein the 2A peptide linker comprises a 2A peptide selected from the group consisting of: foot-and-mouth disease virus 2A peptide (F2A), porcine teschovirus 2A peptide (P2A), thosea asign virus 2A peptide (T2A), and equine rhinitis virus 2A peptide (E2A).

10. The vector system of claim 9, wherein said 2A peptide linker comprises an amino acid sequence selected from any one of SEQ ID NOs 30-33.

11. The vector system of claim 1, wherein the 5' ends of the first coding region and the second coding region further comprise a nucleotide sequence encoding a signal peptide, and the signal peptides encoded by the first coding region and the second coding region may be the same or different.

12. The carrier system of claim 11, wherein the signal peptide is selected from the group consisting of: SAP signal peptide, IHC signal peptide, ILC signal peptide, AP signal peptide, CSP signal peptide, IL2 signal peptide, TPA signal peptide, L1 signal peptide, H7 signal peptide, SP1 signal peptide, and H1 signal peptide.

13. The carrier system of claim 12, wherein the signal peptide is selected from the group consisting of: IL2 signal peptide, TPA signal peptide, SP1 signal peptide, H7 signal peptide, H1 signal peptide, CSP signal peptide, and L1 signal peptide.

14. The vector system of claim 1, wherein the AAV vector comprises a nucleotide sequence set forth in any one of SEQ ID NOs 41-51.

15. The vector system of claim 14, wherein the AAV vector comprises the nucleotide sequence shown in SEQ ID No. 41 or 42.

16. The vector system of claim 1, wherein the AAV vector further comprises one or more elements selected from the group consisting of polyadenylation signal of SV40 virus (SV 40 SL), woodchuck hepatitis b virus post-transcriptional regulatory element (WPRE), and Inverted Terminal Repeat (ITR).

17. The vector system of claim 1, further comprising a host cell.

18. The vector system of claim 17, wherein the host cell is a 293T cell.

19. An adeno-associated viral particle comprising an AAV vector for gene therapy and an AAV capsid, the AAV vector comprising a nucleotide sequence encoding an anti-PCSK 9 antibody or antigen-binding fragment thereof, wherein the nucleotide sequence encoding an anti-PCSK 9 antibody or antigen-binding fragment thereof comprises a first coding region encoding a heavy chain variable region of the antibody and a second coding region encoding a light chain variable region of the antibody, and the first coding region and the second coding region are linked by a nucleotide sequence encoding a linker or an Internal Ribosome Entry Site (IRES);

wherein the AAV capsid has an AAV8 or AAV6 serotype.

20. The adeno-associated virus particle of claim 19, wherein the AAV capsid has a serotype AAV6.2FF.

21. The adeno-associated virus particle of claim 19, wherein the antigen-binding fragment is selected from the group consisting of: fab, fab ', F (ab') ₂ Fv, scFv and ds-scFv.

22. The adeno-associated virus particle of claim 19, wherein the first coding region encodes a heavy chain of the antibody and the second coding region encodes a light chain of the antibody.

23. The adeno-associated virus particle of claim 19, wherein the AAV vector encodes the following structure from 5 'end to 3' end:

(1) Alirocoumab heavy chain-linker-Alirocoumab light chain;

(2) Alirocoumab light chain-linker-Alirocoumab heavy chain;

(3) Evolocumab heavy chain-linker-Evolocumab light chain; or (b)

(4) Evolokumab light chain-linker-Evolokumab heavy chain;

24. The adeno-associated virus particle of claim 23, wherein the Alirocumab heavy chain has an amino acid sequence as set forth in SEQ ID No. 17 and the Alirocumab light chain has an amino acid sequence as set forth in SEQ ID No. 18; and/or the Evolocumab heavy chain has an amino acid sequence as shown in SEQ ID NO. 23, and the Evolocumab light chain has an amino acid sequence as shown in SEQ ID NO. 24.

25. The adeno-associated virus particle of claim 19, wherein the linker is a 2A peptide linker.

26. The adeno-associated virus particle of claim 25, wherein the 2A peptide linker comprises a 2A peptide selected from the group consisting of: foot-and-mouth disease virus 2A peptide (F2A), porcine teschovirus 2A peptide (P2A), thosea asign virus 2A peptide (T2A), and equine rhinitis virus 2A peptide (E2A).

27. The adeno-associated virus particle of claim 26, wherein the 2A peptide linker comprises an amino acid sequence selected from any one of SEQ ID NOs 30-33.

28. The adeno-associated virus particle of claim 19, wherein the 5' ends of the first and second coding regions further comprise a nucleotide sequence encoding a signal peptide, and the signal peptides encoded by the first and second coding regions may be the same or different.

29. The adeno-associated virus particle of claim 28, wherein the signal peptide is selected from the group consisting of: SAP signal peptide, IHC signal peptide, ILC signal peptide, AP signal peptide, CSP signal peptide, IL2 signal peptide, TPA signal peptide, L1 signal peptide, H7 signal peptide, SP1 signal peptide, and H1 signal peptide.

30. The adeno-associated virus particle of claim 29, wherein the signal peptide is selected from the group consisting of: IL2 signal peptide, TPA signal peptide, SP1 signal peptide, H7 signal peptide, H1 signal peptide, CSP signal peptide, and L1 signal peptide.

31. The adeno-associated virus particle of claim 19, wherein the AAV vector comprises a nucleotide sequence shown in any one of SEQ ID NOs 41-51.

32. The adeno-associated virus particle of claim 31, wherein the AAV vector comprises the nucleotide sequence shown in SEQ ID No. 41 or 42.

33. The adeno-associated virus particle of claim 19, wherein the AAV vector further comprises one or more elements selected from the group consisting of polyadenylation signal of SV40 virus (SV 40 SL), woodchuck hepatitis b virus post-transcriptional regulatory element (WPRE), and Inverted Terminal Repeat (ITR).

34. A cell comprising the vector system of claim 1.

35. A composition comprising the vector system of any one of claims 1-18, the adeno-associated virus particle of any one of claims 19-33, or the cell of claim 34.

36. The composition of claim 35, wherein the composition further comprises a pharmaceutically acceptable carrier and/or excipient.

37. A kit comprising the vector system of any one of claims 1-18, the adeno-associated virus particle of any one of claims 19-33 or the cell of claim 34, and a device for intramuscular or intravenous injection.

38. Use of the vector system of any one of claims 1-18, the adeno-associated virus particle of any one of claims 19-33 or the cell of claim 34 in the manufacture of a medicament for preventing, ameliorating or treating a hyperlipidemic disorder in a subject.

39. The use of claim 38, wherein the hyperlipidemic condition is selected from familial hypercholesterolemia and atherosclerosis.