CN117003833A - Liver-specific adeno-associated virus serotypes and uses thereof - Google Patents

Liver-specific adeno-associated virus serotypes and uses thereof Download PDF

Info

Publication number
CN117003833A
CN117003833A CN202210476844.8A CN202210476844A CN117003833A CN 117003833 A CN117003833 A CN 117003833A CN 202210476844 A CN202210476844 A CN 202210476844A CN 117003833 A CN117003833 A CN 117003833A
Authority
CN
China
Prior art keywords
liver
aav
mutant
gly
capsid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210476844.8A
Other languages
Chinese (zh)
Inventor
凌菲香
赵锴
肖啸
吴侠
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
East China University of Science and Technology
Original Assignee
East China University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by East China University of Science and Technology filed Critical East China University of Science and Technology
Priority to CN202210476844.8A priority Critical patent/CN117003833A/en
Publication of CN117003833A publication Critical patent/CN117003833A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14123—Virus like particles [VLP]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14151—Methods of production or purification of viral material
    • C12N2750/14152—Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Veterinary Medicine (AREA)
  • Biochemistry (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Virology (AREA)
  • Biomedical Technology (AREA)
  • Epidemiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention provides liver-specific adeno-associated virus serotypes and applications thereof. Specifically, the invention provides a genetically engineered capsid protein with an inserted liver targeting oligopeptide fragment, a corresponding mutant capsid, and a mutant AAV vector. The mutant AAV vectors of the invention have significantly improved liver affinity and liver-targeted gene delivery efficiency, lower immunogenicity, and better safety potential, and are expected to be applied in the prevention, diagnosis, and treatment of diseases involving the liver.

Description

Liver-specific adeno-associated virus serotypes and uses thereof
Technical Field
The invention belongs to the technical field of biomedicine, and particularly relates to a liver-specific adeno-associated virus serotype and application thereof.
Background
Adeno-associated virus (AAV) is one of the most safe and effective vectors for gene therapy. Adeno-associated viral gene therapy has evolved rapidly over the last decade, and liver-targeted rare treatments in particular have made significant progress. Rare diseases of the liver class include hemophilia, alpha 1 antitrypsin deficiency liver disease, hepatolenticular degeneration, gaucher's disease, sphingomyelin deposition disease, and the like.
Some AAV are used for disease treatment, however, currently existing AAV vectors have shortcomings. Studies have shown that adeno-associated viruses have a broad host range of tropism following systemic administration, but have limited transduction efficiency. Thus, in order to have adequate gene transduction in the target tissue, a high titre of vector dose needs to be injected into the patient, but this may lead to poor transduction of non-targeted tissues, leading to immune response side effects.
Furthermore, for many liver-targeting diseases, there is currently a lack of efficient AAV vectors that specifically target the infected liver and have low immunogenicity.
Thus, there is a strong need in the art to develop an AAV vector that is highly efficient, specifically targeted to infect the liver and has low immunogenicity for use in treating liver-related diseases.
Disclosure of Invention
The aim of the invention is to provide an AAV vector which has high efficiency, specificity, targeting infection of liver and low immunogenicity and application thereof in treating liver related diseases.
In a first aspect of the present invention, there is provided a liver-targeting adeno-associated virus (AAV) capsid protein mutant having inserted into the amino acid sequence of the original AAV capsid protein a liver-targeting short peptide element, wherein the liver-targeting short peptide element has a sequence shown in TRGSQARPNT (SEQ ID No: 3);
And, the AAV capsid protein mutants have increased liver targeting as compared to a protoaav capsid protein not inserted with the liver targeting short peptide element.
In another preferred embodiment, the "elevated liver targeting" means: the ratio of the affinity Q1 of the AAV capsid protein mutant to the liver cell to the affinity Q0 of the original AAV capsid protein without the liver targeting short peptide element inserted (i.e. Q1/Q0) to the liver cell is not less than 1.5, preferably not less than 2, more preferably not less than 5; or alternatively
The ratio of the affinity Z1 of AAV viral particles (or VLPs) formed from the AAV capsid protein mutant to the liver cells to the affinity Z0 of AAV viral particles (or VLPs) formed from the original AAV capsid protein without the liver-targeting short peptide element inserted (i.e., Z1/Z0) to the liver cells is 1.5 or more, preferably 2 or more, more preferably 5 or more.
In another preferred embodiment, the original AAV capsid protein comprises a wild type capsid protein, or a mutant capsid protein.
In another preferred embodiment, the AAV capsid proteins comprise capsid proteins selected from the group consisting of: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10.
In another preferred embodiment, the AAV capsid protein is an AAV5 capsid protein.
In another preferred embodiment, the liver targeting short peptide element is inserted at the following positions in the amino acid sequence of the AAV capsid protein:
(W1) between positions 561 to 591, preferably between positions 565 to 585, more preferably between positions 570 to 580, most preferably between positions 573 and 574, wherein said position numbering is based on the amino acid sequence of the wild-type AAV5 capsid protein (SEQ ID No: 4).
In another preferred embodiment, the liver-targeted AAV capsid protein mutant has the following amino acid sequence:
(i) An amino acid sequence obtained by inserting a stretch TRGSQARPNT (SEQ ID NO: 3) after the 561 th to 591 th (preferably the N573 rd) positions of the amino acid sequence corresponding to the wild-type AAV5 capsid protein;
(ii) Substitution, deletion, alteration or insertion of one or more amino acid residues is performed on the basis of the amino acid sequence of (i), or 1 to 10 amino acid residues (preferably 1 to 5 amino acid residues, more preferably 1 to 3 amino acid residues) are added at the N-terminus or C-terminus thereof, and an amino acid sequence having a sequence identity of not less than 85% (preferably not less than 90%, more preferably not less than 95%, for example not less than 96%, notless than 97%, notless than 98% or not less than 99%) with (i) is retained.
In another preferred embodiment, the AAV capsid protein mutant (preferably an AAV5 capsid protein mutant) further has one or more properties selected from the group consisting of:
(a) Specifically targeting liver cells;
(b) High transduction efficiency of liver cells is that: the AAV capsid mutants have a transduction rate in liver cells that is 2-4 times (preferably up to 4 times) that of other AAV capsids; and
(c) Low immunogenicity, which means: the AAV capsid mutants produce neutralizing antibody titers of 1:4 (preferably 1:2, more preferably 1:1) in the immune response.
In another preferred embodiment, the capsid protein mutant has an amino acid sequence selected from the group consisting of:
(i) An amino acid sequence shown as SEQ ID NO. 2; and
(ii) An amino acid sequence obtained by performing substitution, deletion, alteration or insertion of one or more amino acid residues, or adding 1 to 10 amino acid residues (preferably 1 to 5 amino acid residues, more preferably 1 to 3 amino acid residues) to the N-terminus or C-terminus thereof on the basis of the sequence shown in SEQ ID NO. 2; and the amino acid sequence obtained has a sequence identity of ≡85% (preferably ≡90%, more preferably ≡95%, for example ≡96%,. Gtoreq.97%,. Gtoreq.98% or ≡99%) to the sequence shown in SEQ ID NO. 2.
In another preferred embodiment, the AAV5 capsid protein mutant has an amino acid sequence selected from the group consisting of:
(i) An amino acid sequence obtained by inserting a stretch TRGSQARPNT (SEQ ID NO: 3) after the 561 th to 591 th (preferably the N573 rd) positions of the amino acid sequence corresponding to the wild-type AAV5 capsid protein;
(ii) Substitution, deletion, alteration or insertion of one or more amino acid residues is performed on the basis of the amino acid sequence of (i), or 1 to 10 amino acid residues (preferably 1 to 5 amino acid residues, more preferably 1 to 3 amino acid residues) are added at the N-terminus or C-terminus thereof, and an amino acid sequence having a sequence identity of not less than 85% (preferably not less than 90%, more preferably not less than 95%, for example not less than 96%, notless than 97%, notless than 98% or not less than 99%) with (i) is retained.
In another preferred embodiment, the amino acid sequence of the wild-type AAV5 capsid protein is depicted in SEQ ID NO. 4.
In a second aspect of the invention, there is provided a mutant AAV capsid comprising a capsid protein mutant according to the first aspect of the invention.
In a third aspect of the invention, there is provided a mutant AAV vector comprising a capsid protein mutant according to the first aspect of the invention or comprising a mutant AAV capsid according to the second aspect of the invention.
In another preferred embodiment, the mutant AAV vector is a serotype selected from the group consisting of: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10.
In another preferred embodiment, the mutant AAV vector is AAV type 5.
In another preferred embodiment, the mutant AAV vector comprises a foreign protein or foreign product to be expressed.
In another preferred embodiment, the exogenous protein comprises a therapeutic protein.
In another preferred embodiment, the exogenous product comprises a protein, a nucleic acid molecule, or a combination thereof for use in gene therapy.
In another preferred embodiment, the mutant AAV vector is a viral particle.
In another preferred embodiment, the AAV viral particles comprise:
(i) AAV capsid protein mutants according to the first aspect of the invention; and
(ii) Packaging nucleic acid in the AAV capsid protein mutants according to the first aspect of the invention, said nucleic acid comprising a recombinant viral gene nucleic acid sequence.
In a fourth aspect of the invention, there is provided a liver targeting oligopeptide, the sequence of which is shown in SEQ ID NO. 3.
In a fifth aspect of the invention there is provided a polynucleotide encoding a liver-targeting adeno-associated virus capsid protein mutant according to the first aspect of the invention, or a liver-targeting oligopeptide according to the fourth aspect of the invention.
In another preferred embodiment, the nucleotide sequence of the polynucleotide encoding the liver-targeting AAV adeno-associated virus capsid protein mutant is shown in SEQ ID No. 1.
In another preferred embodiment, the nucleotide sequence of the polynucleotide encoding the liver targeting oligopeptide is shown in SEQ ID No. 5.
In a sixth aspect of the invention there is provided an expression vector comprising a polynucleotide according to the fifth aspect of the invention.
In a seventh aspect of the invention there is provided a host cell comprising an expression vector according to the sixth aspect of the invention or a polynucleotide according to the fifth aspect of the invention integrated into the genome.
In another preferred embodiment, the host cell is a genetically engineered cell for an AAV viral particle.
In another preferred embodiment, the genetically engineered cell comprises:
(i) A first nucleic acid construct comprising a recombinant viral gene nucleic acid sequence; and
(ii) A second nucleic acid construct comprising rep and cap genes required for AAV packaging, wherein the cap gene encodes an AAV capsid protein mutant according to the first aspect of the invention.
In another preferred embodiment, the nucleic acid comprises an exogenous nucleotide construct,
in another preferred embodiment, the exogenous nucleotide construct has the following elements in order from the 5 'end to the 3' end: 5'ITR, promoter, gene sequence of interest, poly (A) sequence, 3' ITR.
In another preferred embodiment, the promoter is a CMV promoter, a CBh1 promoter or a CAG promoter.
In another preferred embodiment, the gene of interest is an exogenous reporter gene, including but not limited to: fluorescent protein family, beta-galactosidase, alkaline phosphatase, luciferase, and dihydrofolate reductase genes, or combinations thereof.
In another preferred embodiment, the family of fluorescent proteins comprises green fluorescent proteins.
In another preferred embodiment, the gene of interest is a nucleic acid encoding a native protein for therapeutic (e.g., medical or veterinary) use, and the treatment comprises treating a liver-related disorder.
In another preferred embodiment, the native protein is codon optimized or non-codon optimized.
In another preferred embodiment, the native protein is selected from the group consisting of: alpha 1 antitrypsin, ATP7B protein, glucocerebrosidase, sphingomyelinase, FVIII protein, FIX protein.
In another preferred embodiment, the gene of interest is a gene encoding an antibody or antigen.
In another preferred embodiment, the antibody or antigen is selected from the group consisting of: VEGF antibodies, anti-sclerostin antibodies and anti-RANKL antibodies, anti-complement component C5 antibodies, anti-PD-1 antibodies and PD-L1 antibodies, anti-CTLA-4 antibodies, anti-CGRP antibodies, anti-HER 2 antibodies and anti-EGFR antibodies, antibodies to pro-inflammatory cytokines and their receptors, spike proteins of coronavirus 2019 (covd 2019) or Severe Acute Respiratory Syndrome (SARS) coronavirus, envelope proteins of hepatitis a, b, C and Human Immunodeficiency Virus (HIV), various tumor cell immune antigens, or combinations thereof.
In another preferred embodiment, the VEGF antibody comprises bevacizumab, ranibizumab or bromolizumab (Brolucizumab).
In another preferred embodiment, the anti-sclerostin antibody comprises Luo Mozhu mab (romisozumab) or ibuprofen mab (bloozumab).
In another preferred embodiment, the anti-RANKL antibody comprises denoumab (Denosumab).
In another preferred embodiment, the anti-complement component C5 antibody comprises Ravulizumab (Ravulizumab) or Extranab (Eculizumab).
In another preferred embodiment, the anti-PD-1 antibody comprises Nivolumab (Nivolumab), pembrolizumab (Pembrolizumab), cimiput Li Shan antibody (Cemiplimab).
In another preferred embodiment, the PD-L1 antibody comprises Avibritumomab (Avelumab) or Abilizumab (Atezolizumab).
In another preferred embodiment, the anti-CTLA-4 antibody includes Ipilimumab (Ipilimumab).
In another preferred embodiment, the anti-CGRP antibody comprises freudenreichii (Fremanezumab), gambirizumab (Galcanezumab), and erlenumab (ereumbab).
In another preferred embodiment, the anti-HER 2 antibody comprises Trastuzumab (Trastuzumab) or Pertuzumab (Pertuzumab).
In another preferred embodiment, the anti-EGFR antibody comprises Cetuximab (Cetuximab), panitumumab (Panitumumab), and Cetuximab (Necitumumab).
In another preferred example, the antibody against a pro-inflammatory cytokine and its receptor include Sha Lilu human mab (Sarilumab), stetuximab (Siltuximab), toximab (Tocilizumab), kanagamab (Canakinumab), golimumab (Golimumab), cetuzumab (Certolizumab), adalimumab (Adalimumab), infliximab (Infliximab), dalizumab (Daclizumab), basiliximab (Basiliximab).
In another preferred embodiment, the plurality of tumor cell immune antigens includes MAGE antigen, HER2, erbB2, mucin antigen, and estrogen receptor.
In another preferred embodiment, the gene of interest comprises an RNAi component.
In another preferred embodiment, the RNAi component comprises siRNA, shRNA, snRNA, microRNA, a ribozyme, an antisense oligonucleotide, and an antisense polynucleotide, or a combination thereof.
In an eighth aspect of the invention, there is provided the use of an AAV capsid protein mutant according to the first aspect of the invention or a mutant AAV vector according to the third aspect of the invention in the preparation of a medicament selected from the group consisting of:
(i) A pharmaceutical composition for treating liver-related diseases;
(ii) Other pharmaceutical compositions for systemic treatment; and/or
(iii) Vaccine composition for immunization and epidemic prevention.
In another preferred embodiment, the mutant AAV vector is an AAV viral particle.
In another preferred embodiment, the genetically engineered cell is a eukaryotic cell.
In another preferred embodiment, the genetically engineered cell is selected from the group consisting of: 293T cells, HEK293 cells, sf9 cells, or BHK cells.
In another preferred embodiment, the genetically engineered cell further comprises:
(iii) A third nucleic acid construct, said third nucleic acid construct being a helper plasmid, which has the function of helper virus packaging to form a viral particle.
In another preferred embodiment, the helper plasmid is derived from adenovirus (Ad), herpes Simplex Virus (HSV), or other helper plasmid with helper functions.
In another preferred embodiment, the first nucleic acid construct may further comprise an exogenous reporter gene.
In another preferred embodiment, the exogenous reporter gene is selected from the group consisting of: green fluorescent protein, beta-galactosidase, alkaline phosphatase, luciferase, and chloramphenicol acetyl transferase, or a combination thereof.
In another preferred embodiment, the first nucleic acid construct, the second nucleic acid construct and/or the third nucleic acid construct may be temporarily present in the genetically engineered cell or may be stably integrated into the genome of the genetically engineered cell.
In another preferred embodiment, the AAV viral particles according to the second aspect of the invention are packaged inside said genetically engineered cell.
In another preferred embodiment, the genetically engineered cell comprises:
(i) The nucleotide coding sequence of the AAV5 capsid mutant is shown as SEQ ID NO. 1 or the degenerate sequence thereof;
(ii) Optionally the nucleotide coding sequence of AAV Rep proteins;
(iii) Recombinant viral gene nucleic acid sequences;
(iv) A nucleotide sequence having an auxiliary function to support AAV replication.
In another preferred embodiment, the liver-related disease comprises: α1 antitrypsin deficiency liver disease, hepatolenticular degeneration, gaucher's disease, sphingomyelin deposition disease, hemophilia, and the like.
In another preferred embodiment, the pharmaceutical composition for systemic treatment refers to a drug for tumor targeted therapy.
In another preferred embodiment, when the agent is a pharmaceutical composition for treating a liver-related disorder, the AAV capsid protein mutant is encapsulated in, or the AAV viral particle comprises a nucleic acid encoding a native protein for therapeutic (e.g., medical or veterinary) use, the native protein selected from the group consisting of: alpha 1 antitrypsin, ATP7B protein, glucocerebrosidase, sphingomyelinase, FVIII protein, FIX protein.
In a ninth aspect of the present invention, there is provided a pharmaceutical composition comprising the following components:
(i) A mutant AAV vector (AAV viral particle) according to the third aspect of the invention; and
(ii) Pharmaceutically acceptable excipients or carriers.
In another preferred embodiment, the dosage form of the pharmaceutical composition is selected from the group consisting of: injection, lyophilized preparation, or a combination thereof.
In another preferred embodiment, the injection is selected from the group consisting of: intraperitoneal injections, intravenous injections, subcutaneous injections, or combinations thereof.
In another preferred embodiment, said component (i) comprises 0.1 to 99.9wt%, preferably 10 to 80wt%, more preferably 30 to 60wt%, based on the total weight of the pharmaceutical composition.
In another preferred embodiment, the pharmaceutical composition is in a liquid dosage form.
In another preferred embodiment, the pharmaceutical composition is an injection.
In another preferred embodiment, the dosage form of the pharmaceutical composition includes, but is not limited to: intraperitoneal injections, intravenous injections, or combinations thereof.
In another preferred embodiment, the pharmaceutically acceptable carrier includes, but is not limited to: solvents, dispersion media, coatings, antibacterial or antifungal agents, isotonic and absorption delaying agents, and the like.
In another preferred embodiment, the pharmaceutically acceptable carrier comprises saline, including but not limited to: buffered saline, physiological saline, phosphate buffer, citrate buffer, acetate buffer, bicarbonate buffer, sucrose solution, saline solution, polysorbate solution, or a combination thereof.
In another preferred example, the pharmaceutically acceptable carrier may further comprise additives including, but not limited to: stabilizers, preservatives, transfection promoters that facilitate cellular uptake, or a combination thereof.
In another preferred embodiment, the stabilizer includes, but is not limited to: sodium glutamate, glycine, EDTA, albumin (e.g., human serum albumin), or combinations thereof.
In another preferred embodiment, the preservative includes, but is not limited to: 2-phenoxyethanol, sodium benzoate, potassium sorbate, methylparaben, phenol, thimerosal, antibiotics, or combinations thereof.
In another preferred embodiment, the transfection facilitating agent comprises calcium ions.
In another preferred embodiment, the pharmaceutical composition may be administered alone or in combination with other drugs for treating liver-related diseases in the use of treating liver-related diseases.
In a tenth aspect of the present invention, there is provided a method for preventing and/or treating liver-related diseases, comprising the steps of: administering to a subject in need thereof an effective amount of a mutant AAV vector according to the third aspect of the invention, or a pharmaceutical composition according to the ninth aspect of the invention.
In another preferred embodiment, the administering comprises in vivo injection.
In another preferred embodiment, the in vivo injection method includes, but is not limited to: intraperitoneal injection, intravenous injection, or a combination thereof.
In another preferred embodiment, the subject comprises a human or non-human mammal.
In another preferred embodiment, the non-human mammal includes, but is not limited to: non-human primates, sheep, dogs, cats, horses, cattle, chickens, rats, mice, and the like.
It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.
Drawings
FIG. 1 shows the construction scheme of AAV5 mutant plasmid library.
FIG. 2 shows a screening procedure for AAV5 mutant virus libraries.
Figure 3 shows the ratio of viral titer to total AAV protein for the four serotypes AAV5, AAV8, AAV9, AAVF3, i.e. the filled-in rate (filled-in to empty-shell ratio) of packaged virus.
FIG. 4 shows fluorescence plots of two serotypes of AAV5, AAVF3 carrying GFP reporter gene infection Huh7 cells; scale bar 100 μm.
Fig. 5 shows quantification of cell density of Huh7 positive cells infected with four serotypes of AAV5, AAVF3 carrying GFP reporter gene (n=5; p < 0.001, p < 0.01, p < 0.05).
FIG. 6 shows fluorescence plots of two serotypes of AAV5, AAVF3 carrying GFP reporter gene infection of HepG2 cells; scale bar 100 μm.
Fig. 7 shows quantification of cell density of HepG2 positive cells infected with four serotypes of AAV5, AAVF3 carrying GFP reporter gene (n=5; p < 0.001, p < 0.01, p < 0.05).
FIG. 8 shows GFP immunofluorescence of liver of mice with intravenous injection of AAV5, AAV9, AAVF3 carrying GFP reporter gene.
Fig. 9 shows GFP positive cell density quantification of liver of mice injected intravenously with AAV5, AAV9, AAVF3 carrying GFP reporter gene (n=5; p < 0.001, p < 0.01, p < 0.05).
Figure 10 shows the neutralizing antibody titer profiles of both serotypes AAV9, AAVF3 in non-human primates.
Fig. 11 shows the neutralizing antibody positive rate of AAV9, AAVF3 in non-human primates (×p < 0.001; ×p < 0.01; ×p < 0.05).
Detailed Description
Through extensive and intensive studies, the inventors of the present invention have developed an AAV mutant that is highly effective in liver transduction for the first time through a large number of screening. Specifically, the present inventors obtained a short peptide with liver targeting by screening through a random peptide display method, and inserted the short peptide into a specific site region of AAV, and obtained a mutant AAV vector (e.g., a mutant AAV5 vector obtained based on AAV5 vector engineering) that efficiently and specifically targets the infected liver and has low immunogenicity. The liver-targeted AAV has great application potential in the field of gene therapy of liver diseases. The present invention has been completed on the basis of this finding.
Terminology
In order that the invention may be more readily understood, certain technical and scientific terms are defined below. Unless defined otherwise herein, all other technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Before describing the present invention, it is to be understood that this invention is not limited to the particular methodology and experimental conditions described, as such methods and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, as the scope of the present invention will be limited only by the appended claims.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. As used herein, when used in reference to a specifically recited value, the term "about" means that the value can vary no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values therebetween (e.g., 99.1, 99.2, 99.3, 99.4, etc.).
As used herein, the term "treatment" refers to administration of a therapeutic agent, either internal or external, to a patient, comprising the AAV viral capsids provided herein and pharmaceutical compositions composed thereof. The patient has one or more symptoms of the disease, and the therapeutic agent is known to have a therapeutic effect on these symptoms. Typically, the patient is administered an amount of the therapeutic agent (therapeutically effective amount) effective to alleviate one or more symptoms of the disease.
As used herein, the term "optional" or "optionally" means that the subsequently described event or circumstance may, but need not, occur. For example, "the nucleotide coding sequence of an optional AAV Rep protein" means that the nucleotide coding sequence of an AAV Rep protein can be selected from AAV2, AAV5, AAV8, AAV9, and the like.
As used herein, the term "comprising" or "including" can be open, semi-closed, and closed. In other words, the term also includes "consisting essentially of …" or "consisting of …".
"vector" refers to a macromolecule or series of macromolecules that encapsulate a polynucleotide that facilitates delivery of the polynucleotide to a target cell in vitro or in vivo. The classification of vectors includes, but is not limited to, plasmids, viral vectors, liposomes and other gene delivery vectors. Polynucleotides to be delivered are sometimes referred to as "transgenes," including but not limited to coding sequences for certain proteins or synthetic polypeptides that can enhance, inhibit, attenuate, protect, trigger or prevent certain biological and physiological processes, or coding sequences of interest in vaccine development (e.g., polynucleotides expressing proteins, polypeptides or peptides suitable for eliciting an immune response in a mammal), coding sequences for RNAi components (e.g., shRNA, siRNA, antisense oligonucleotides), or selectable markers.
"transduction," "transfection," "transformation," or the terms as used herein refer to the process of delivering an exogenous nucleotide sequence to a host cell, transcribing and translating to produce a polypeptide product, including the introduction of an exogenous polynucleotide into a host cell using a recombinant virus.
"Gene transfer" refers to the introduction of an exogenous polynucleotide into a cell for gene transfer, and may include targeting, binding, uptake, transport, replicon integration, and expression.
"Gene expression" or "expression" refers to the process by which a gene is transcribed, translated, and post-translationally modified to produce an RNA or protein product of the gene.
"infection" refers to the delivery of polynucleotides into cells and the production of RNA and protein products thereof by the polynucleotide components contained in viruses and viral particles. This may also mean that this is a viral replication process in the host cell.
"Polynucleotide" refers to polymeric forms of nucleotides of any length, including Deoxynucleotides (DNA), ribonucleotides (RNA), hybrid sequences and the like. Polynucleotides may include modified nucleotides, such as methylated or capped nucleotides or nucleotide analogs. The term polynucleotide as used herein refers to single-and double-stranded molecules that are interchangeable. Unless otherwise indicated, polynucleotides in any of the embodiments described herein include a double stranded form and two complementary single strands that are known or predicted to constitute the double stranded form.
"polypeptide" refers to a polymer of at least 20 amino acids linked by peptide bonds. The terms "polypeptide" and "protein" are synonymously referred to herein as polymers consisting of more than 20 amino acids. The term also includes synthetic amino acid polymers.
The term "inverted terminal repeat" encompasses any AAV viral terminal repeat or synthetic sequence that constitutes a hairpin structure and mediates viral replication, packaging, and integration as a cis structure. ITRs herein include, but are not limited to: terminal repeats of type 1-11 AAV, avian AAV, bovine AAV, canine AAV, equine AAV, and ovine AAV. In addition, AAV terminal repeats need not be native, so long as they are available for replication, packaging, and integration of AAV.
The term "tumor" refers to a large number of multicellular organisms and blood vessels produced by cells having tumorigenic properties (referred to as "tumor cells"). These cells often have overactive proliferative and inhibitory differentiation capacity, resulting in their dramatic overgrowth and spread throughout the body (distant metastasis). Such diseases caused by this phenomenon are called "cancers", and are manifested, for example, as leukemia, lymphoma, liver cancer, kidney cancer, prostate cancer, breast cancer, kidney cancer, lung cancer, thyroid cancer, colorectal cancer, cervical cancer, melanoma, glioblastoma, or others.
The term "mosaic" of AAV capsid nucleic acid coding sequences or capsid proteins refers to the artificial design and engineering of AAV capsid sequences by DNA shuffling, random peptide display, error-prone PCR, and point mutation methods.
"targeting" herein refers to preferential entry of the virus into some cell or tissue, followed by further expression of sequences carried by the viral genome or recombinant transgene in the cell. It is known to those skilled in the art that transcription of heterologous nucleic acid sequences from the viral genome cannot begin without cis-and trans-acting factors (e.g., inducible promoters or other regulatory nucleic acid sequences).
Conservative amino acid substitutions are known in the art. In some embodiments, the potential substituted amino acids are within one or more of the following groups: glycine, alanine; and valine, isoleucine, leucine and proline; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine lysine, arginine and histidine; and/or phenylalanine, tryptophan and tyrosine; methionine and cysteine. Furthermore, the invention provides non-conservative amino acid substitutions that allow amino acid substitutions from different groups.
"recombinant" in relation to a polynucleotide means that the polynucleotide is a synthetic product that differs from the native polynucleotide by multiple cloning steps. The recombinant virus is a viral particle comprising recombinant polynucleotides.
Liver-targeting short peptides
As used herein, the terms "liver-targeting short peptide of the present invention", "liver-targeting peptide of the present invention", "short peptide of the present invention" are used interchangeably and refer to a short peptide having the sequence shown in SEQ ID No. 3, i.e. TRGSQARPNT (Thr-Arg-Gly-Ser-gin-Ala-Arg-Pro-Asn-Thr) (SEQ ID No. 3).
It will be appreciated that the term also includes variants of the SEQ ID NO:3 sequence having the same or substantially the same liver targeting function. Typically, these variants include (but are not limited to): deletions, insertions and/or substitutions of one or more (typically 1, 2, 3, preferably 1-2, more preferably 1) amino acids, and addition of one or more (typically 10 or less, preferably 6 or less, more preferably 3 or less) amino acids at the C-terminus and/or N-terminus. For example, in the art, substitution with amino acids having similar or similar properties typically does not alter the function of the polypeptide. As another example, the addition of one or more amino acids at the C-terminus and/or N-terminus generally does not alter the function of the polypeptide.
In the context of the present invention, a variant of a short peptide of the invention means that up to 4, preferably up to 3, more preferably up to 2, most preferably 1 amino acid is replaced by an amino acid of similar or similar nature compared to the amino acid sequence of SEQ ID NO. 3, to form a polypeptide. These conservatively variant polypeptides are preferably generated by amino acid substitutions according to Table A.
Table A
The invention also provides polynucleotides encoding the liver targeting peptides of the invention. The polynucleotides of the invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand. Coding region sequences encoding mature polypeptides include degenerate variants.
As used herein, for a liver targeting peptide of the present invention, a "degenerate variant" refers to a nucleic acid sequence capable of encoding the liver targeting peptide shown in SEQ ID NO. 3, but which differs from the coding region sequence shown in SEQ ID NO. 5.
The term "polynucleotide encoding a polypeptide" may include polynucleotides encoding the polypeptide, or may include additional coding and/or non-coding sequences.
Liver-targeted mutant AAV capsid proteins and capsid
As used herein, the terms "mutant AAV capsid proteins of the invention," "liver-targeted capsid proteins of the invention," and "capsid proteins of the invention" are used interchangeably, all refer to mutant AAV capsid proteins with higher liver targeting formed by insertion of the liver-targeting peptides of the invention.
As used herein, the terms "mutant AAV capsid of the invention", "liver-targeted capsid of the invention", and "capsid of the invention" are used interchangeably to refer to mutant AAV capsids with high liver-targeting formed by assembly of mutant AAV capsid proteins of the invention.
The present invention provides an adeno-associated virus 5 (AAV 5) capsid mutant, said AAV5 capsid mutant having a property selected from the group consisting of: (a) specifically targeting liver cells; (b) High transduction rate of liver cells, which means: the AAV5 capsid mutant has a transduction rate in liver cells that is 2-4 times (preferably up to 4 times) that of other AAV capsids; and (c) low immunogenicity, which means: the AAV5 capsid mutants produce neutralizing antibody titers of 1:4 (preferably 1:2, more preferably 1:1) in the immune response.
In one embodiment of the invention, a novel AAV capsid (i.e., AAVF3, amino acid sequence shown in SEQ ID NO: 2) obtained by the modification of 10 amino acid oligopeptide TRGSQARPNT (SEQ ID NO: 3) after N573 of the amino acid sequence of wild-type AAV5 capsid protein is shown in SEQ ID NO:4, whereby the AAV viral particles formed by the capsid protein packaging viral genome have a stronger capacity to infect mouse hepatoma cell lines HepG2 and Huh7 and deliver genes as compared to AAV5 and also exhibit liver tissue affinity infectivity superior to wild-type AAV9 in mice.
Wild type AAV5 capsid amino acid sequence (SEQ ID NO: 4):
MSFVDHPPDWLEEVGEGLREFLGLEAGPPKPKPNQQHQDQARGLVLPGYNYLGPGNGLDRGEPVNRADEVAREHDISYNEQLEAGDNPYLKYNHADAEFQEKLADDTSFGGNLGKAVFQAKKRVLEPFGLVEEGAKTAPTGKRIDDHFPKRKKARTEEDSKPSTSSDAEAGPSGSQQLQIPAQPASSLGADTMSAGGGGPLGDNNQGADGVGNASGDWHCDSTWMGDRVVTKSTRTWVLPSYNNHQYREIKSGSVDGSNANAYFGYSTPWGYFDFNRFHSHWSPRDWQRLINNYWGFRPRSLRVKIFNIQVKEVTVQDSTTTIANNLTSTVQVFTDDDYQLPYVVGNGTEGCLPAFPPQVFTLPQYGYATLNRDNTENPTERSSFFCLEYFPSKMLRTGNNFEFTYNFEEVPFHSSFAPSQNLFKLANPLVDQYLYRFVSTNNTGGVQFNKNLAGRYANTYKNWFPGPMGRTQGWNLGSGVNRASVSAFATTNRMELEGASYQVPPQPNGMTNNLQGSNTYALENTMIFNSQPANPGTTATYLEGNMLITSESETQPVNRVAYNVGGQMATNNQSSTTAPATGTYNLQEIVPGSVWMERDVYLQGPIWAKIPETGAHFHPSPAMGGFGLKHPPPMMLIKNTPVPGNITSFSDVPVSSFITQYSTGQVTVEMEWELKKENSKRWNPEIQYTNNYNDPQFVDFAPDSTGEYRTTRPIGTRYLTRPL
preferred AAV5 mutant capsid amino acid sequences of the invention (SEQ ID NO: 2):
MSFVDHPPDWLEEVGEGLREFLGLEAGPPKPKPNQQHQDQARGLVLPGYNYLGPGNGLDRGEPVNRADEVAREHDISYNEQLEAGDNPYLKYNHADAEFQEKLADDTSFGGNLGKAVFQAKKRVLEPFGLVEEGAKTAPTGKRIDDHFPKRKKARTEEDSKPSTSSDAEAGPSGSQQLQIPAQPASSLGADTMSAGGGGPLGDNNQGADGVGNASGDWHCDSTWMGDRVVTKSTRTWVLPSYNNHQYREIKSGSVDGSNANAYFGYSTPWGYFDFNRFHSHWSPRDWQRLINNYWGFRPRSLRVKIFNIQVKEVTVQDSTTTIANNLTSTVQVFTDDDYQLPYVVGNGTEGCLPAFPPQVFTLPQYGYATLNRDNTENPTERSSFFCLEYFPSKMLRTGNNFEFTYNFEEVPFHSSFAPSQNLFKLANPLVDQYLYRFVSTNNTGGVQFNKNLAGRYANTYKNWFPGPMGRTQGWNLGSGVNRASVSAFATTNRMELEGASYQVPPQPNGMTNNLQGSNTYALENTMIFNSQPANPGTTATYLEGNMLITSESETQPVNRVAYNVGGQMATNNTRGSQARPNTSSTTAPATGTYNLQEIVPGSVWMERDVYLQGPIWAKIPETGAHFHPSPAMGGFGLKHPPPMMLIKNTPVPGNITSFSDVPVSSFITQYSTGQVTVEMEWELKKENSKRWNPEIQYTNNYNDPQFVDFAPDSTGEYRTTRPIGTRYLTRPL
it is to be understood that the amino acid sequence of AAV5 mutant capsid proteins having a certain homology (preferably, a sequence shown in SEQ ID NO: 2) with the sequence of the present invention or the gene sequence thereof is also included in the scope of the present invention, as long as the sequence can be easily isolated from other species (especially mammals) by a person skilled in the art after reading the information provided in accordance with the present invention.
The polynucleotide encoding the AAV capsid mutants of the invention may be in DNA form or in RNA form. The DNA forms include: DNA, genomic DNA or synthetic DNA, which may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand.
The coding region sequence encoding the liver-targeted mutant AAV capsid proteins of the invention may be identical to or degenerate as shown in SEQ ID NO. 1.
ATGTCTTTTGTTGATCACCCTCCAGATTGGTTGGAAGAAGTTGGTGAAGGTCTTCGCGAGTTTTTGGGCCTTGAAGCGGGCCCACCGAAACCAAAACCCAATCAGCAGCATCAAGATCAAGCCCGTGGTCTTGTGCTGCCTGGTTATAACTATCTCGGACCCGGAAACGGTCTCGATCGAGGAGAGCCTGTCAACAGGGCAGACGAGGTCGCGCGAGAGCACGACATCTCGTACAACGAGCAGCTTGAGGCGGGAGACAACCCCTACCTCAAGTACAACCACGCGGACGCCGAGTTTCAGGAGAAGCTCGCCGACGACACATCCTTCGGGGGAAACCTCGGAAAGGCAGTCTTTCAGGCCAAGAAAAGGGTTCTCGAACCTTTTGGCCTGGTTGAAGAGGGTGCTAAGACGGCCCCTACCGGAAAGCGGATAGACGACCACTTTCCAAAAAGAAAGAAGGCTCGGACCGAAGAGGACTCCAAGCCTTCCACCTCGTCAGACGCCGAAGCTGGACCCAGCGGATCCCAGCAGCTGCAAATCCCAGCCCAACCAGCCTCAAGTTTGGGAGCTGATACAATGTCTGCGGGAGGTGGCGGCCCATTGGGCGACAATAACCAAGGTGCCGATGGAGTGGGCAATGCCTCGGGAGATTGGCATTGCGATTCCACGTGGATGGGGGACAGAGTCGTCACCAAGTCCACCCGAACCTGGGTGCTGCCCAGCTACAACAACCACCAGTACCGAGAGATCAAAAGCGGCTCCGTCGACGGAAGCAACGCCAACGCCTACTTTGGATACAGCACCCCCTGGGGGTACTTTGACTTTAACCGCTTCCACAGCCACTGGAGCCCCCGAGACTGGCAAAGACTCATCAACAACTACTGGGGCTTCAGACCCCGGTCCCTCAGAGTCAAAATCTTCAACATTCAAGTCAAAGAGGTCACGGTGCAGGACTCCACCACCACCATCGCCAACAACCTCACCTCCACCGTCCAAGTGTTTACGGACGACGACTACCAGCTGCCCTACGTCGTCGGCAACGGGACCGAGGGATGCCTGCCGGCCTTCCCTCCGCAGGTCTTTACGCTGCCGCAGTACGGTTACGCGACGCTGAACCGCGACAACACAGAAAATCCCACCGAGAGGAGCAGCTTCTTCTGCCTAGAGTACTTTCCCAGCAAGATGCTGAGAACGGGCAACAACTTTGAGTTTACCTACAACTTTGAGGAGGTGCCCTTCCACTCCAGCTTCGCTCCCAGTCAGAACCTCTTCAAGCTGGCCAACCCGCTGGTGGACCAGTACTTGTACCGCTTCGTGAGCACAAATAACACTGGCGGAGTCCAGTTCAACAAGAACCTGGCCGGGAGATACGCCAACACCTACAAAAACTGGTTCCCGGGGCCCATGGGCCGAACCCAGGGCTGGAACCTGGGCTCCGGGGTCAACCGCGCCAGTGTCAGCGCCTTCGCCACGACCAATAGGATGGAGCTCGAGGGCGCGAGTTACCAGGTGCCCCCGCAGCCGAACGGCATGACCAACAACCTCCAGGGCAGCAACACCTATGCCCTGGAGAACACTATGATCTTCAACAGCCAGCCGGCGAACCCGGGCACCACCGCCACGTACCTCGAGGGCAACATGCTCATCACCAGCGAGAGCGAGACGCAGCCGGTGAACCGCGTGGCGTACAACGTCGGCGGGCAGATGGCCACCAACAAC ACT CGC GGC AGT CAA GCT AGA CCT AAC ACCCAGAGCTCCACCACTGCCCCCGCGACCGGCACGTACAACCTCCAGGAAATCGTGCCCGGCAGCGTGTGGATGGAGAGGGACGTGTACCTCCAAGGACCCATCTGGGCCAAGATCCCAGAGACGGGGGCGCACTTTCACCCCTCTCCGGCCATGGGCGGATTCGGACTCAAACACCCACCGCCCATGATGCTCATCAAGAACACGCCTGTGCCCGGAAATATCACCAGCTTCTCGGACGTGCCCGTCAGCAGCTTCATCACCCAGTACAGCACCGGGCAGGTCACCGTGGAGATGGAGTGGGAGCTCAAGAAGGAAAACTCCAAGAGGTGGAACCCAGAGATCCAGTACACAAACAACTACAACGACCCCCAGTTTGTGGACTTTGCCCCGGACAGCACCGGGGAATACAGAACCACCAGACCTATCGGAACCCGATACCTTACCCGACCCCTTTAA (SEQ ID NO:1, underlined is the coding sequence for the liver targeting peptide)
Polynucleotides encoding AAV capsid mutants of the invention include: coding sequences encoding only AAV capsid mutants of the invention; the coding sequence and various additional coding sequences of the AAV capsid mutants of the present invention; the coding sequences (and optionally additional coding sequences) and non-coding sequences of the AAV capsid mutants of the invention.
The term "polynucleotide encoding an AAV capsid mutant of the invention" may include polynucleotides encoding such AAV capsid mutants of the invention, as well as polynucleotides further comprising additional coding and/or non-coding sequences. The invention also relates to variants of the above polynucleotides which encode fragments, analogs and derivatives of the polyglycosides or polypeptides having the same amino acid sequence as the invention. Variants of the polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. Such nucleotide variants include substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the AAV capsid mutant of the invention encoded thereby.
The invention also relates to polynucleotides which hybridize to the sequences described above and which have at least 50%, preferably at least 70%, more preferably at least 80% identity between the two sequences. The present invention relates in particular to polynucleotides which hybridize under stringent conditions to the polynucleotides of the invention. In the present invention, "stringent conditions" means: (1) Hybridization and elution at lower ionic strength and higher temperature, e.g., 0.2 XSSC, 0.1% SDS,60 ℃; or (2) adding denaturant such as 50% (v/v) citalopram, 0.1% calf serum/0.1% Ficoll,42 deg.C, etc. during hybridization; or (3) hybridization only occurs when the identity between the two sequences is at least 90% or more, more preferably 95% or more.
The full-length nucleotide sequence encoding the AAV capsid mutants of the invention, or fragments thereof, may be obtained generally by PCR amplification, recombinant methods, or synthetic methods. For the PCR amplification method, primers can be designed according to the nucleotide sequences disclosed in the present invention, particularly the open reading frame sequences, and amplified to obtain the relevant sequences using a commercially available DNA library or a cDNA library prepared according to a conventional method known to those skilled in the art as a template. When the sequence is longer, it is often necessary to perform two or more PCR amplifications, and then splice the amplified fragments together in the correct order. Once the relevant sequences are obtained, recombinant methods can be used to obtain the relevant sequences in large quantities. It is usually cloned into a vector, transferred into a cell, and then isolated from the proliferated host cell by a conventional method to obtain the relevant sequence.
Furthermore, the sequences concerned, in particular fragments of short length, can also be synthesized by artificial synthesis. In general, fragments of very long sequences are obtained by first synthesizing a plurality of small fragments and then ligating them. Currently, DNA sequences encoding AAV capsid mutants (or fragments or derivatives thereof) of the present invention have been obtained entirely by chemical synthesis. The DNA sequence can then be introduced into a variety of existing DNA molecules (or vectors, for example) and cells known in the art. In addition, mutations can be introduced into the fusion protein sequences of the invention by chemical synthesis.
The invention also includes polypeptides or proteins having the same or similar function that have 50% or more (preferably 60% or more, 70% or more, 80% or more, more preferably 90% or more, more preferably 95% or more, most preferably 98% or more, such as 99%) homology to the sequence shown in SEQ ID NO. 2 of the invention.
The term "same or similar functions" mainly means: "specifically targeted liver cells, high transduction of liver cells, and low immunogenicity".
The AAV capsid mutant proteins of the present invention can be recombinant polypeptides, natural polypeptides, synthetic polypeptides. The fusion proteins of the invention may be naturally purified products, or chemically synthesized products, or produced from prokaryotic or eukaryotic hosts (e.g., bacterial, yeast, plant, insect, and mammalian cells) using recombinant techniques. The AAV capsid mutant proteins of the invention may be glycosylated or may be non-glycosylated depending on the host used in the recombinant production protocol. The AAV capsid mutant protein sequences of the invention may also or alternatively comprise an initiating methionine residue.
The invention also includes other polypeptide fragments and analogs having the activity of the AAV capsid mutants of the invention. As used herein, the terms "fragment" and "analog" refer to polypeptides that retain substantially the same biological function or activity of the AAV capsid mutant proteins of the present invention.
The polypeptide fragment, derivative or analogue of the invention may be: (i) Polypeptides having one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, which may or may not be encoded by the genetic code; or (ii) a polypeptide having a substituent in one or more amino acid residues; or (iii) a polypeptide formed by fusion of the mature polypeptide with another compound, such as a compound that increases the half-life of the polypeptide, e.g., polyethylene glycol; or (iv) a polypeptide (such as a leader or secretory sequence or a sequence for purifying the polypeptide or a proprotein sequence, or a fusion protein) formed by fusing an additional amino acid sequence to the polypeptide sequence. Such fragments, derivatives and analogs are within the purview of one skilled in the art in view of the definitions herein.
The invention also includes analogs of the claimed proteins. These analogs may differ from the native SEQ ID NO. 2 by differences in amino acid sequence, by differences in modified forms that do not affect the sequence, or by both. Analogs of these proteins include natural or induced genetic variants. Induced variants can be obtained by various techniques, such as random mutagenesis by irradiation or exposure to mutagens, by site-directed mutagenesis or other known techniques of molecular biology. Analogs also include analogs having residues other than the natural L-amino acid (e.g., D-amino acids), as well as analogs having non-naturally occurring or synthetic amino acids (e.g., beta, gamma-amino acids). It is to be understood that the proteins of the present invention are not limited to the representative proteins listed above.
Modified (typically without altering the primary structure) forms include: chemically derivatized forms of proteins such as ethylated or carboxylated in vivo or in vitro. Modifications also include glycosylation, such as those that are glycosylation modified during protein synthesis and processing. Such modification may be accomplished by exposing the protein to an enzyme that performs glycosylation (e.g., mammalian glycosylase or deglycosylase). Modified forms also include sequences having phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, phosphothreonine).
Liver-targeted mutant AAV vectors
As used herein, the term "adeno-associated virus (AAV)" refers to a single stranded DNA virus having a genome size of about 4.7kb and flanked by inverted terminal repeats (Inverted terminal repeat, ITR). It includes natural AAV (type 1-13 AAV, avian AAV, bovine AAV, canine AAV, equine AAV, and ovine AAV), and other engineered AAV either known or later discovered or invented. Genomic sequences and ITR sequences of AAV of different serotypes, rep and Cap proteins are known in the art. These sequences may be found in the literature or in public databases, such as GenBank (R) libraries, e.g., genBank (R) accession nos. NC002077, NC001401, NC001729, NC001863, NC001829, NC001862, NC000883, NC001701, NC001510, AF063497, U89790, AF043303, AF028705, AF028704, J02275, JO1901, J02275, XO1457, AF288061, AHO09962, AY028226, AY028223, NC001358, NC001540, AF513851, AF513852, AY530579, AY631965, AY631966.
Adeno-associated virus (AAV) is a class of tiny, non-enveloped, non-pathogenic viruses with an icosahedral structure. Adeno-associated virus particles between about 20-26nm in diameter contain a linear single stranded DNA genome of about 4.70 kb. AAV viral capsids generally consist of 3 capsid proteins VP1, VP2 and VP 3. AAV cannot replicate independently in normal cells, but only with the aid of helper viruses such as adenovirus or herpes virus and has a virulent infection.
According to the global epidemiological analysis of adeno-associated virus clinical trials, 40-80% of human serum is positive for AAV neutralizing antibodies, and antibodies to the capsids of the organism may exist, which may reduce transduction efficiency. This suggests that wild type AAV capsids cannot serve as ideal gene therapy vectors. To avoid the human preexisting immune response, scientists have focused on isolating AAV capsids from other vertebrate species or engineering on the basis of the structure of wild-type AAV to reduce neutralizing antibodies and achieve targeted therapies with high transduction efficiency.
In the present invention, the liver targeting peptide of the present invention is inserted into a specific region of an AAV vector, and a mutant AAV vector having low immunogenicity and capable of efficiently and specifically targeting the infected liver can be formed.
In the present invention, the liver targeting peptide suitable for insertion into the present invention is between positions 560-590, preferably between positions 565-585, more preferably between positions 570-578, such as between positions 573-574, in the Cap sequence, wherein the position of the amino acid sequence is based on the amino acid sequence of the Cap protein of AAV 5.
In a preferred embodiment, the invention provides a mutant AAV5 vector obtained based on AAV5 vector engineering.
Preferably, the liver-targeted oligopeptide sequence TRGSQARPNT of the present invention shown in SEQ ID No. 3 is inserted after amino acid position N573 and before position 574 of the cap sequence of AAV5, thereby obtaining a liver-targeted mutant AAV vector. Experimental results show that compared with AAV5 vectors before modification, the mutant AAVF3 vector has stronger liver infection efficiency and lower neutralizing antibody reactivity, and can be used for treating liver-related diseases.
The mutant AAV vectors (e.g., AAV5 mutants) of the invention have high transduction efficiency and low neutralizing antibody levels for liver cells and thus can be administered to subjects such as humans, thereby treating liver-related diseases. Furthermore, the AAV5 mutant vectors of the invention can be preferentially used to treat subjects (e.g., humans) not infected with AAV 5.
AAVF3 provided by the present invention also shows lower neutralizing antibody levels in non-human primates compared to wild-type, reflecting that AAVF3 of the present invention is less susceptible to immune system suppression inactivation when it enters the body of a non-primate than the wild-type, is less potentially side-effects and adverse reactions, and is potentially suitable for a wider range of animal hosts or patients.
In some embodiments, the engineered AAV capsids can be loaded with heterologous nucleic acids for gene delivery into target cells. Thus, these engineered serotypes can be used to deliver nucleic acids to cells and express product proteins in vitro or in vivo.
Pharmaceutical compositions and methods of treatment
As used herein, the term "pharmaceutical composition" refers to a composition comprising an AAV5 capsid mutant of the present invention or a host cell expressing said AAV5 capsid mutant and a pharmaceutically acceptable carrier, which functions to treat a liver-related disease.
In one embodiment, the pharmaceutical composition of the invention comprises AAVF3 as the capsid of the viral particle and a corresponding pharmaceutically acceptable carrier.
In particular embodiments, the heterologous polynucleotide delivered by the engineered AAV capsid encodes a polypeptide that serves as a reporter to indicate a cell that was successfully infected with AAV. These reporter proteins include, but are not limited to, green fluorescent protein, beta-galactosidase, alkaline phosphatase, luciferase, and chloramphenicol acetyl transferase.
In some cases, the nucleic acid delivered includes a nucleic acid encoding a native protein for therapeutic (e.g., medical or veterinary) use, either codon optimized or non-codon optimized. Such proteins include, but are not limited to, alpha 1 antitrypsin deficiency liver disease, hepatolenticular degeneration, gaucher's disease, sphingomyelin deposition disease, hemophilia, and the like.
The invention can also be applied to the delivery of antibodies or antigen genes into a organism, and plays roles of immunization epidemic prevention (vaccine) and monoclonal antibody targeting specific molecules for cell therapy. Antigen antibodies that can be packaged into the viral genome include, but are not limited to, VEGF antibodies (e.g., bevacizumab, ranibizumab, and Brolucizumab), anti-scleroprotein antibodies (e.g., romosozumab, blosozumab) and anti-RANKL antibodies (e.g., denosumab), anti-complement component C5 antibodies (e.g., ravulizumab, eculizumab), anti-PD-1 antibodies (e.g., nivolumab, pembrolizumab, cemiplimab) and PD-L1 antibodies (e.g., avelumab, atezolizumab), anti-CTLA-4 antibodies (e.g., ipilimumab), anti-CGRP antibodies (e.g., fremanezumab, galcanezumab, erenumab), anti-HER 2 antibodies (e.g., trastuzumab, pertuzumab) and anti-EGFR antibodies (e.g., cetuximab, panitumumab, necitumumab), antibodies against pro-inflammatory cytokines and their receptors (e.g., sarilumab, siltuximab, tocilizumab, canakinumab, golimumab, certolizumab, adalimumab, infliximab, daclizumab, basiliximab), spike proteins of coronaviruses 2019 (cov 2019) or Severe Acute Respiratory Syndrome (SARS), envelope proteins of hepatitis a, b, C, and Human Immunodeficiency Virus (HIV), various tumor cell immune antigens (e.g., MAGE antigen, HER2, mucin antigen, and estrogen receptor).
The recombinant viral gene nucleic acid sequences delivered by AAV serotypes disclosed in the present invention may include RNAi components (e.g., siRNA, shRNA, snRNA, microRNA, ribozymes, antisense oligonucleotides, and antisense polynucleotides) that knock down any endogenous genes that are activated in an aberrant manner or exogenous genes that invade the host cell. RNAi-related functions, principles and methods of operation are well known to those skilled in the art. RNAi components typically have 60-100% identity in sequence to their target genes and result in at least a 30% (i.e., 30-100% and any number therein) decrease in the expression of the corresponding protein product.
As used herein, the term "pharmaceutically acceptable carrier" refers to any and all pharmaceutical carriers, such as solvents, dispersion media, coatings, antibacterial or antifungal agents, isotonic and absorption delaying agents, and the like. These vectors can aid in the storage of the viral particles and administration to a subject. The pharmaceutically acceptable carrier may include any suitable component, such as, but not limited to, saline. Illustrative examples of saline include, but are not limited to, buffered saline, physiological saline, phosphate buffer, citrate buffer, acetate buffer, bicarbonate buffer, sucrose solution, saline solution, and polysorbate solution.
In certain embodiments, the pharmaceutical composition may further comprise additives including, but not limited to, stabilizers, preservatives, transfection facilitating agents that facilitate cellular uptake. Suitable stabilizers include, but are not limited to, sodium glutamate, glycine, EDTA, and albumin (e.g., human serum albumin). Suitable preservatives include, but are not limited to, 2-phenoxyethanol, sodium benzoate, potassium sorbate, methylparaben, phenol, thimerosal, and antibiotics. Suitable transfection facilitating agents include, but are not limited to, calcium ions.
In particular embodiments, the invention further provides methods of preventing and/or treating liver-related diseases, including, but not limited to, administering to a subject an effective dose of AAV viral particles via intraperitoneal injection, intravenous injection, or the like. The above methods are selected based on the pathogenesis of liver related diseases and may be used in combination with each other.
Other drugs for treating liver-related diseases may also be included in the pharmaceutical compositions of the present invention, or in combination with other drugs for treating liver-related diseases.
In other embodiments, the invention also provides a method of immunization and a method of targeted treatment of a tumor, each comprising administering to a subject in need thereof an effective amount of an AAV viral particle comprising an AAV5 capsid mutant of the invention or a pharmaceutical composition of the invention.
As used herein, the terms "subject" and "subject" are used interchangeably and include any human or non-human mammal, such as a non-human primate, sheep, dog, cat, horse, cow, chicken, rat, mouse, and the like.
As used herein, the term "effective amount" or "effective dose" refers to an amount that is functional or active in and acceptable to a human and/or animal. Which refers to an amount of therapeutic agent that treats, relieves or prevents a disease or condition of interest, or that exhibits a detectable therapeutic or prophylactic effect. Therapeutic effects also include a reduction in physiological symptoms. The precise effective amount for a subject will depend on the size and health of the subject, the nature and extent of the disorder, and the therapeutic agent and/or combination of therapeutic agents selected for administration. Thus, it is not useful to pre-specify an accurate effective amount. However, for a given situation, routine experimentation may be used to determine the effective amount.
The effective amount of the present invention may vary depending on the mode of administration and the severity of the condition to be treated, etc. The selection of the preferred effective amount can be determined by one of ordinary skill in the art based on a variety of factors (e.g., by clinical trials). Such factors include, but are not limited to: pharmacokinetic parameters of the drug such as drug tissue distribution, bioavailability, metabolism, half-life, etc.; the severity of the disease to be treated in the patient, the weight of the patient, the immune status of the patient, the route of administration, etc. For example, separate doses may be administered several times per day, or the dose may be proportionally reduced, as dictated by the urgent need for the treatment of the condition.
The main advantages of the invention include:
1) The AAV5 mutant AAVF3 modified by the invention has stable liver affinity and lower neutralizing antibody level, and can be used as a new AAV serotype for treating liver related diseases.
2) The liver efficiency of AAVF3 infected mice is obviously higher than that of AAV9, and in clinical application, AAVF3 can be selected for treatment of patients with higher in vivo neutralizing antibody prevalence rate, so that the clinical application of AAV to treat diseases is expanded.
3) Viral AAVF3 packaging efficiency (filled rate) and yield were no lower or even higher than wild-type (e.g. AAV8, 9).
The invention will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental procedure, which does not address the specific conditions in the examples below, is generally followed by routine conditions, such as, for example, sambrook et al, molecular cloning: conditions described in the laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989) or as recommended by the manufacturer. Percentages and parts are weight percentages and parts unless otherwise indicated.
EXAMPLE 1 construction of random peptide display library and screening of liver high affinity mutants
The present invention demonstrates capsid engineering methods via AAV random peptides based on a single serotype backbone. As shown in FIG. 1, 30nt nucleotides encoding an oligopeptide fragment of 10 amino acids were randomly inserted into the AAV5 cap gene at a nucleotide position corresponding to amino acid 573, and a random AAV5 plasmid library was constructed by rational design and synthesis.
As shown in fig. 2, AAV5 mutant plasmid library, ad5 helper (helper) plasmid, were co-transfected into HEK293 cells under Polyethylenimine (PEI) conditions. After 48 hours of transfection, cells were lysed to give a virus starting stock. HEK293 cell lysates containing randomly mutated AAV were added to Huh7 hepatoma cells together with adenovirus 5 (Ad 5) for culture (co-infection), and the cell lysates were harvested and Huh7 cells were repeatedly infected 4-5 times. To screen for AAV5 mutants targeting liver cells, huh7 cells were co-infected with Ad5 (moi=25 pfu/cell) from the AAV5 chimeric library, and after 48h cell lysates were harvested for the next round of infection.
Four to five times of repeatedly infecting Huh7 cells in this way, extracting virus DNA from the virus collected in each infection period, sequencing the random insertion region of cap genes, and analyzing the occurrence frequency of each mutant.
The highest frequency of occurrence of the mutant obtained by analysis proves that the mutant has higher transduction efficiency in Huh 7. The screening and analysis results show that AAV5 mutant AAVF3 inserted with oligopeptide fragment TRGSQARPNT has higher transduction efficiency.
Example 2 determination and comparison of AAV viral titers
AAV titers affect its ability to infect cells. Thus, in this example, fluorescence quantitative PCR and silver staining assays were performed on the packaging efficiency of the four serotypes AAV5, AAV8, AAV9 and AAVF3, and the filled-in rates (AAV viral titers/AAV total protein amounts) of the four serotypes were compared. The method comprises the following steps:
the recombinant adeno-associated virus AAVF3 of the Green Fluorescent Protein (GFP) of the packaging reporter gene is prepared by adopting a three-plasmid cotransfection method. GFP plasmid, AAVF3 capsid plasmid and helper packaging plasmid phelper were co-transfected into HEK293 cells under Polyethylenimine (PEI) conditions. After 48 hours, the cells were lysed by freezing to give a virus lysate, followed by treatment with 50U/ml Benzonase for 30 minutes at 37℃and further centrifugation to give a virus supernatant. The virus supernatant was added to 10%, 20%, 40%, 50% iodixanol gradient solution and centrifuged at 80000g density gradient at 4℃for 2 hours to obtain AAVF3 virus stock. AAV5, AAV8 and AAV9 viral stocks were prepared under conditions consistent with AAVF3.
2.2 results
Fluorescent quantitative PCR was used to detect the reporter GFP genomic titres of AAV5, AAV8, AAV9 and AAVF3 under the same packaging conditions. Analysis showed that AAV5 genome titres were 6.31X10 12 vg/ml AAV8 genome titre 6.94X10 12 vg/ml AAV9 genome titre 6.75X10 12 vg/ml AAVF3 genome titre 7.05X10 12 vg/ml。
The coat protein titers of the four AAV-GFP were measured using silver staining. The analysis results showed that AAV5 capsid titres were 1.63×10 13 vp/ml AAV8 capsid titre 1.24X10 13 vp/ml AAV9 capsid titre 1.18X10 13 vp/ml AAV F3 capsid titre 1.25X10 13 vp/ml。
The results of the titer ratio of AAV genome to its coat protein, i.e. the filled rate (filled to empty) of packaged virus, are shown in fig. 3. The results showed that the real heart rates of AAV5, AAV8, AAV9 and AAVF3 were 38.71%, 55.97%, 57.20% and 56.53%.
The comparison shows that the AAVF3 has higher solid rate than AAV5, and has comparable packaging efficiency with AAV8 and AAV9, which shows that the AAVF3 obtained by screening has higher and stable virus packaging efficiency.
Example 3 comparison of in vitro liver cancer cell infection efficiency of AAV virus
HepG2 and Huh7 are liver cancer cell lines commonly used in vitro liver disease studies. In this example, AAVF3 and AAV5 were packaged simultaneously with GFP reporter at moi=5x10 4 The efficiency of infection was compared between the vg/cell infection HepG2 and Huh7, and the expression of GFP fluorescent protein was observed after 48 hours.
The results are shown in fig. 4 and 6. The results indicate that AAVF3 has a stronger fluorescent expression relative to wild-type AAV 5.
Meanwhile, GFP positive cells infected with HepG2 and Huh7 cells by two AAV serotypes were quantified in this example. As shown in fig. 5 and 7, the ratio of GFP positive cells of AAV5 and AAVF3 infected HepG2 cells to total cells was 1.01% and 3.71%, respectively, the ratio of GFP positive cells of AAV5 and AAVF3 infected Huh7 cells to total cells was 0.97% and 7.05%, respectively, and the ability of AAVF3 to infect HepG2 and Huh7 hepatoma cells was significantly higher than wild-type AAV5.
AAV5 infection is known in the art to be inefficient in the liver. Therefore, the AAVF3 obtained by the novel screening is used as an engineered AAV5 mutant, and the infection capacity of liver cancer cells is obviously higher than that of AAV5, so that the novel AAVF3 shows an unexpectedly excellent engineering effect on the aspect of liver cell infection efficiency.
Example 4 liver infection efficiency of AAV in mice
In this example, the high liver infection efficiency of AAVF3 was further verified on mice. Experiments were performed with AAV5, AAV9 and AAVF3, in which the reporter Green Fluorescent Protein (GFP) was packaged in example 2.
AAV5-GFP, AAV9-GFP and AAVF3-GFP were combined at 2X10 13 The dose of vg/kg was given to C57BL/6 mice (n=5) by tail vein injection, and the liver infection efficiency in vivo was observed. The mouse liver was dissected 4 weeks after virus injection and stained for frozen sections and immunofluorescence of GFP.
The expression results of GFP in the liver are shown in FIG. 8. The results showed that AAVF3 showed significantly higher green fluorescence expression in the mouse liver than AAV5 and AAV9.
Meanwhile, the present inventors quantified liver transduction efficiency, and counted GFP-positive cells and total cells in immunofluorescence, and as shown in fig. 9, the proportion of GFP-positive cells of AAV5, AAV9 and AAVF 3-infected livers was 24.16%, 77.37% and 90.89%, respectively, and the efficiency of AAVF3 transduction of livers was significantly higher than AAV5 and AAV9.
A commonly used liver disease treatment vector in the art is AAV9, a natural serotype. The AAVF3 screened by the method has the capability of infecting the liver of mice obviously superior to AAV9, the AAVF3 has lower kidney infection efficiency than AAV9, and the capability of infecting the heart is equivalent to AAV9. This suggests that AAVF3 can be used as an alternative vector for AAV9 in clinical applications of gene therapy.
Example 5 detection of neutralizing antibodies in non-human primate
Although AAV is not pathogenic to humans, pre-existing neutralizing antibodies in humans inhibit AAV-mediated expression of foreign genes. It is generally believed that neutralizing antibody titer values are greater than 1:4 is positive to the neutralizing antibody, and is less than or equal to 1:4 to be negative; only neutralizing antibody titers were equal to or less than 1:4, this serotype can be used to treat the disease.
In this example, AAV9 and AAVF3 were packaged separately with a gaussian luciferase reporter Gluc (Gaussia luciferase) for detection of neutralizing antibody titers in 31 monkey sera.
The results are shown in fig. 10 and 11. The result shows that the titer of the neutralizing antibody of AAVF3 is lower than that of wild AAV9, which indicates that the mutant AAVF3 has lower neutralizing antibody prevalence than AAV9, and the patient with higher AAV9 neutralizing antibody in vivo can be treated by adopting the serotype AAVF3, so that the clinical application of AAV in treating diseases is expanded.
Discussion of the invention
AAV vectors are one of the most safe and effective vectors for gene therapy. In the case of hemophilia, clinical trials have been underway for hemophilia a or hemophilia B. Hemophilia a is a rare disease caused by coagulation dysfunction due to a deficiency of factor viii (fviii) in humans. A medicine Valoctocogene Roxaparvovec developed by BioMarin and using AAV9 as a vector is used for treating hemophilia A, and AAV5 is used for delivering exogenous normal FVIII genes to be infused into a patient to express FVIII so as to maintain the blood coagulation factors of the patient at normal level and reduce annual bleeding rate.
However, follow-up data from clinical trials of Valoctocogene Roxaparvovec drug showed a sustained decrease in the effect of the drug in maintaining normal levels of fviii. The reduction in protein levels of fviii is likely caused by an immune response of the AAV vector capsid, suggesting a limitation in the use of wild-type adeno-associated viruses in the field of gene therapy.
An effective strategy is to modify the capsid protein structure of AAV vectors to generate specific vectors that can be targeted efficiently, reduce the expression and toxic side effects of non-target tissues, and increase the effective expression of target genes.
Studies have shown that the capsid protein structure of adeno-associated viral vectors affects tissue tropism and immunogenicity. In 1999, girod et al first tried to successfully alter the natural targeting of adeno-associated viral vectors by inserting polypeptides into the capsid proteins of the adeno-associated virus, confirming that altering the capsid protein structure of adeno-associated virus can alter its corresponding function, that AAV targeting can be altered by introducing polypeptides into the viral coat protein, and that AAV can be redirected to receptors of other cell types. Therefore, the AAV capsid protein is directionally evolved by utilizing a genetic engineering means, and then forward selection is carried out to screen proper mutants, so that the AAV capsid protein has become one of powerful means for constructing novel recombinant adeno-associated virus vectors with high tissue targeting and high transduction efficiency.
The invention provides an adeno-associated virus mutant capable of efficiently transducing liver, which aims to solve the problem that the current AAV gene therapy lacks tissue high efficiency and low neutralizing antibody epidemic rate serotypes. The inventor modifies wild AAV5 through random peptide display, inserts specific liver targeting peptide (namely 10 amino acid oligopeptide sequence TRGSQARPNT) of the invention after 573 rd amino acid of cap sequence of AAV5, and screens to obtain mutant AAVF3 vector with remarkably improved liver infection efficiency and low neutralizing antibody prevalence rate.
In the examples, AAVF3 infects liver cancer cell lines and mouse liver tissue with significantly higher efficiency than AAV5, AAV9, and the prevalence of neutralizing antibodies in non-human primates is significantly lower than wild-type AAV9. Therefore, the adeno-associated virus mutant has great application potential in the field of gene therapy.
All documents mentioned in this disclosure are incorporated by reference in this disclosure as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the application as defined in the appended claims.
Sequence listing
<110> university of Industy of Huadong
<120> liver-specific adeno-associated virus serotypes and uses
<130> P2022-0854
<160> 5
<170> PatentIn version 3.5
<210> 1
<211> 2205
<212> DNA
<213> Artificial sequence (artificial sequence)
<220>
<221> misc_feature
<223> liver-targeting AAV capsid protein mutants
<400> 1
atgtcttttg ttgatcaccc tccagattgg ttggaagaag ttggtgaagg tcttcgcgag 60
tttttgggcc ttgaagcggg cccaccgaaa ccaaaaccca atcagcagca tcaagatcaa 120
gcccgtggtc ttgtgctgcc tggttataac tatctcggac ccggaaacgg tctcgatcga 180
ggagagcctg tcaacagggc agacgaggtc gcgcgagagc acgacatctc gtacaacgag 240
cagcttgagg cgggagacaa cccctacctc aagtacaacc acgcggacgc cgagtttcag 300
gagaagctcg ccgacgacac atccttcggg ggaaacctcg gaaaggcagt ctttcaggcc 360
aagaaaaggg ttctcgaacc ttttggcctg gttgaagagg gtgctaagac ggcccctacc 420
ggaaagcgga tagacgacca ctttccaaaa agaaagaagg ctcggaccga agaggactcc 480
aagccttcca cctcgtcaga cgccgaagct ggacccagcg gatcccagca gctgcaaatc 540
ccagcccaac cagcctcaag tttgggagct gatacaatgt ctgcgggagg tggcggccca 600
ttgggcgaca ataaccaagg tgccgatgga gtgggcaatg cctcgggaga ttggcattgc 660
gattccacgt ggatggggga cagagtcgtc accaagtcca cccgaacctg ggtgctgccc 720
agctacaaca accaccagta ccgagagatc aaaagcggct ccgtcgacgg aagcaacgcc 780
aacgcctact ttggatacag caccccctgg gggtactttg actttaaccg cttccacagc 840
cactggagcc cccgagactg gcaaagactc atcaacaact actggggctt cagaccccgg 900
tccctcagag tcaaaatctt caacattcaa gtcaaagagg tcacggtgca ggactccacc 960
accaccatcg ccaacaacct cacctccacc gtccaagtgt ttacggacga cgactaccag 1020
ctgccctacg tcgtcggcaa cgggaccgag ggatgcctgc cggccttccc tccgcaggtc 1080
tttacgctgc cgcagtacgg ttacgcgacg ctgaaccgcg acaacacaga aaatcccacc 1140
gagaggagca gcttcttctg cctagagtac tttcccagca agatgctgag aacgggcaac 1200
aactttgagt ttacctacaa ctttgaggag gtgcccttcc actccagctt cgctcccagt 1260
cagaacctct tcaagctggc caacccgctg gtggaccagt acttgtaccg cttcgtgagc 1320
acaaataaca ctggcggagt ccagttcaac aagaacctgg ccgggagata cgccaacacc 1380
tacaaaaact ggttcccggg gcccatgggc cgaacccagg gctggaacct gggctccggg 1440
gtcaaccgcg ccagtgtcag cgccttcgcc acgaccaata ggatggagct cgagggcgcg 1500
agttaccagg tgcccccgca gccgaacggc atgaccaaca acctccaggg cagcaacacc 1560
tatgccctgg agaacactat gatcttcaac agccagccgg cgaacccggg caccaccgcc 1620
acgtacctcg agggcaacat gctcatcacc agcgagagcg agacgcagcc ggtgaaccgc 1680
gtggcgtaca acgtcggcgg gcagatggcc accaacaaca ctcgcggcag tcaagctaga 1740
cctaacaccc agagctccac cactgccccc gcgaccggca cgtacaacct ccaggaaatc 1800
gtgcccggca gcgtgtggat ggagagggac gtgtacctcc aaggacccat ctgggccaag 1860
atcccagaga cgggggcgca ctttcacccc tctccggcca tgggcggatt cggactcaaa 1920
cacccaccgc ccatgatgct catcaagaac acgcctgtgc ccggaaatat caccagcttc 1980
tcggacgtgc ccgtcagcag cttcatcacc cagtacagca ccgggcaggt caccgtggag 2040
atggagtggg agctcaagaa ggaaaactcc aagaggtgga acccagagat ccagtacaca 2100
aacaactaca acgaccccca gtttgtggac tttgccccgg acagcaccgg ggaatacaga 2160
accaccagac ctatcggaac ccgatacctt acccgacccc tttaa 2205
<210> 2
<211> 733
<212> PRT
<213> Artificial sequence (artificial sequence)
<220>
<221> MISC_FEATURE
<222> (1)..(733)
<400> 2
Met Ser Phe Val Asp His Pro Pro Asp Trp Leu Glu Glu Val Gly Glu
1 5 10 15
Gly Leu Arg Glu Phe Leu Gly Leu Glu Ala Gly Pro Pro Lys Pro Lys
20 25 30
Pro Asn Gln Gln His Gln Asp Gln Ala Arg Gly Leu Val Leu Pro Gly
35 40 45
Tyr Asn Tyr Leu Gly Pro Gly Asn Gly Leu Asp Arg Gly Glu Pro Val
50 55 60
Asn Arg Ala Asp Glu Val Ala Arg Glu His Asp Ile Ser Tyr Asn Glu
65 70 75 80
Gln Leu Glu Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala Asp
85 90 95
Ala Glu Phe Gln Glu Lys Leu Ala Asp Asp Thr Ser Phe Gly Gly Asn
100 105 110
Leu Gly Lys Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro Phe
115 120 125
Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Thr Gly Lys Arg Ile
130 135 140
Asp Asp His Phe Pro Lys Arg Lys Lys Ala Arg Thr Glu Glu Asp Ser
145 150 155 160
Lys Pro Ser Thr Ser Ser Asp Ala Glu Ala Gly Pro Ser Gly Ser Gln
165 170 175
Gln Leu Gln Ile Pro Ala Gln Pro Ala Ser Ser Leu Gly Ala Asp Thr
180 185 190
Met Ser Ala Gly Gly Gly Gly Pro Leu Gly Asp Asn Asn Gln Gly Ala
195 200 205
Asp Gly Val Gly Asn Ala Ser Gly Asp Trp His Cys Asp Ser Thr Trp
210 215 220
Met Gly Asp Arg Val Val Thr Lys Ser Thr Arg Thr Trp Val Leu Pro
225 230 235 240
Ser Tyr Asn Asn His Gln Tyr Arg Glu Ile Lys Ser Gly Ser Val Asp
245 250 255
Gly Ser Asn Ala Asn Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr
260 265 270
Phe Asp Phe Asn Arg Phe His Ser His Trp Ser Pro Arg Asp Trp Gln
275 280 285
Arg Leu Ile Asn Asn Tyr Trp Gly Phe Arg Pro Arg Ser Leu Arg Val
290 295 300
Lys Ile Phe Asn Ile Gln Val Lys Glu Val Thr Val Gln Asp Ser Thr
305 310 315 320
Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp
325 330 335
Asp Asp Tyr Gln Leu Pro Tyr Val Val Gly Asn Gly Thr Glu Gly Cys
340 345 350
Leu Pro Ala Phe Pro Pro Gln Val Phe Thr Leu Pro Gln Tyr Gly Tyr
355 360 365
Ala Thr Leu Asn Arg Asp Asn Thr Glu Asn Pro Thr Glu Arg Ser Ser
370 375 380
Phe Phe Cys Leu Glu Tyr Phe Pro Ser Lys Met Leu Arg Thr Gly Asn
385 390 395 400
Asn Phe Glu Phe Thr Tyr Asn Phe Glu Glu Val Pro Phe His Ser Ser
405 410 415
Phe Ala Pro Ser Gln Asn Leu Phe Lys Leu Ala Asn Pro Leu Val Asp
420 425 430
Gln Tyr Leu Tyr Arg Phe Val Ser Thr Asn Asn Thr Gly Gly Val Gln
435 440 445
Phe Asn Lys Asn Leu Ala Gly Arg Tyr Ala Asn Thr Tyr Lys Asn Trp
450 455 460
Phe Pro Gly Pro Met Gly Arg Thr Gln Gly Trp Asn Leu Gly Ser Gly
465 470 475 480
Val Asn Arg Ala Ser Val Ser Ala Phe Ala Thr Thr Asn Arg Met Glu
485 490 495
Leu Glu Gly Ala Ser Tyr Gln Val Pro Pro Gln Pro Asn Gly Met Thr
500 505 510
Asn Asn Leu Gln Gly Ser Asn Thr Tyr Ala Leu Glu Asn Thr Met Ile
515 520 525
Phe Asn Ser Gln Pro Ala Asn Pro Gly Thr Thr Ala Thr Tyr Leu Glu
530 535 540
Gly Asn Met Leu Ile Thr Ser Glu Ser Glu Thr Gln Pro Val Asn Arg
545 550 555 560
Val Ala Tyr Asn Val Gly Gly Gln Met Ala Thr Asn Asn Thr Arg Gly
565 570 575
Ser Gln Ala Arg Pro Asn Thr Ser Ser Thr Thr Ala Pro Ala Thr Gly
580 585 590
Thr Tyr Asn Leu Gln Glu Ile Val Pro Gly Ser Val Trp Met Glu Arg
595 600 605
Asp Val Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro Glu Thr Gly
610 615 620
Ala His Phe His Pro Ser Pro Ala Met Gly Gly Phe Gly Leu Lys His
625 630 635 640
Pro Pro Pro Met Met Leu Ile Lys Asn Thr Pro Val Pro Gly Asn Ile
645 650 655
Thr Ser Phe Ser Asp Val Pro Val Ser Ser Phe Ile Thr Gln Tyr Ser
660 665 670
Thr Gly Gln Val Thr Val Glu Met Glu Trp Glu Leu Lys Lys Glu Asn
675 680 685
Ser Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Asn Asn Tyr Asn Asp
690 695 700
Pro Gln Phe Val Asp Phe Ala Pro Asp Ser Thr Gly Glu Tyr Arg Thr
705 710 715 720
Thr Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Pro Leu
725 730
<210> 3
<211> 10
<212> PRT
<213> Artificial sequence (artificial sequence)
<220>
<221> misc_feature
<223> liver targeting short peptide element
<400> 3
Thr Arg Gly Ser Gln Ala Arg Pro Asn Thr
1 5 10
<210> 4
<211> 724
<212> PRT
<213> adeno-associated virus 5 (adeno-associated virus 5)
<400> 4
Met Ser Phe Val Asp His Pro Pro Asp Trp Leu Glu Glu Val Gly Glu
1 5 10 15
Gly Leu Arg Glu Phe Leu Gly Leu Glu Ala Gly Pro Pro Lys Pro Lys
20 25 30
Pro Asn Gln Gln His Gln Asp Gln Ala Arg Gly Leu Val Leu Pro Gly
35 40 45
Tyr Asn Tyr Leu Gly Pro Gly Asn Gly Leu Asp Arg Gly Glu Pro Val
50 55 60
Asn Arg Ala Asp Glu Val Ala Arg Glu His Asp Ile Ser Tyr Asn Glu
65 70 75 80
Gln Leu Glu Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala Asp
85 90 95
Ala Glu Phe Gln Glu Lys Leu Ala Asp Asp Thr Ser Phe Gly Gly Asn
100 105 110
Leu Gly Lys Ala Val Phe Gln Ala Lys Lys Arg Val Leu Glu Pro Phe
115 120 125
Gly Leu Val Glu Glu Gly Ala Lys Thr Ala Pro Thr Gly Lys Arg Ile
130 135 140
Asp Asp His Phe Pro Lys Arg Lys Lys Ala Arg Thr Glu Glu Asp Ser
145 150 155 160
Lys Pro Ser Thr Ser Ser Asp Ala Glu Ala Gly Pro Ser Gly Ser Gln
165 170 175
Gln Leu Gln Ile Pro Ala Gln Pro Ala Ser Ser Leu Gly Ala Asp Thr
180 185 190
Met Ser Ala Gly Gly Gly Gly Pro Leu Gly Asp Asn Asn Gln Gly Ala
195 200 205
Asp Gly Val Gly Asn Ala Ser Gly Asp Trp His Cys Asp Ser Thr Trp
210 215 220
Met Gly Asp Arg Val Val Thr Lys Ser Thr Arg Thr Trp Val Leu Pro
225 230 235 240
Ser Tyr Asn Asn His Gln Tyr Arg Glu Ile Lys Ser Gly Ser Val Asp
245 250 255
Gly Ser Asn Ala Asn Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr
260 265 270
Phe Asp Phe Asn Arg Phe His Ser His Trp Ser Pro Arg Asp Trp Gln
275 280 285
Arg Leu Ile Asn Asn Tyr Trp Gly Phe Arg Pro Arg Ser Leu Arg Val
290 295 300
Lys Ile Phe Asn Ile Gln Val Lys Glu Val Thr Val Gln Asp Ser Thr
305 310 315 320
Thr Thr Ile Ala Asn Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp
325 330 335
Asp Asp Tyr Gln Leu Pro Tyr Val Val Gly Asn Gly Thr Glu Gly Cys
340 345 350
Leu Pro Ala Phe Pro Pro Gln Val Phe Thr Leu Pro Gln Tyr Gly Tyr
355 360 365
Ala Thr Leu Asn Arg Asp Asn Thr Glu Asn Pro Thr Glu Arg Ser Ser
370 375 380
Phe Phe Cys Leu Glu Tyr Phe Pro Ser Lys Met Leu Arg Thr Gly Asn
385 390 395 400
Asn Phe Glu Phe Thr Tyr Asn Phe Glu Glu Val Pro Phe His Ser Ser
405 410 415
Phe Ala Pro Ser Gln Asn Leu Phe Lys Leu Ala Asn Pro Leu Val Asp
420 425 430
Gln Tyr Leu Tyr Arg Phe Val Ser Thr Asn Asn Thr Gly Gly Val Gln
435 440 445
Phe Asn Lys Asn Leu Ala Gly Arg Tyr Ala Asn Thr Tyr Lys Asn Trp
450 455 460
Phe Pro Gly Pro Met Gly Arg Thr Gln Gly Trp Asn Leu Gly Ser Gly
465 470 475 480
Val Asn Arg Ala Ser Val Ser Ala Phe Ala Thr Thr Asn Arg Met Glu
485 490 495
Leu Glu Gly Ala Ser Tyr Gln Val Pro Pro Gln Pro Asn Gly Met Thr
500 505 510
Asn Asn Leu Gln Gly Ser Asn Thr Tyr Ala Leu Glu Asn Thr Met Ile
515 520 525
Phe Asn Ser Gln Pro Ala Asn Pro Gly Thr Thr Ala Thr Tyr Leu Glu
530 535 540
Gly Asn Met Leu Ile Thr Ser Glu Ser Glu Thr Gln Pro Val Asn Arg
545 550 555 560
Val Ala Tyr Asn Val Gly Gly Gln Met Ala Thr Asn Asn Gln Ser Ser
565 570 575
Thr Thr Ala Pro Ala Thr Gly Thr Tyr Asn Leu Gln Glu Ile Val Pro
580 585 590
Gly Ser Val Trp Met Glu Arg Asp Val Tyr Leu Gln Gly Pro Ile Trp
595 600 605
Ala Lys Ile Pro Glu Thr Gly Ala His Phe His Pro Ser Pro Ala Met
610 615 620
Gly Gly Phe Gly Leu Lys His Pro Pro Pro Met Met Leu Ile Lys Asn
625 630 635 640
Thr Pro Val Pro Gly Asn Ile Thr Ser Phe Ser Asp Val Pro Val Ser
645 650 655
Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Thr Val Glu Met Glu
660 665 670
Trp Glu Leu Lys Lys Glu Asn Ser Lys Arg Trp Asn Pro Glu Ile Gln
675 680 685
Tyr Thr Asn Asn Tyr Asn Asp Pro Gln Phe Val Asp Phe Ala Pro Asp
690 695 700
Ser Thr Gly Glu Tyr Arg Thr Thr Arg Pro Ile Gly Thr Arg Tyr Leu
705 710 715 720
Thr Arg Pro Leu
<210> 5
<211> 30
<212> DNA
<213> Artificial sequence (artificial sequence)
<220>
<221> misc_feature
<223> coding sequences for liver-targeting short peptide elements
<400> 5
actcgcggca gtcaagctag acctaacacc 30

Claims (10)

1. A liver targeting adeno-associated virus (AAV) capsid protein mutant, wherein the liver targeting AAV capsid protein mutant inserts a liver targeting short peptide element in the amino acid sequence of the original AAV capsid protein, wherein the liver targeting short peptide element has the sequence shown in SEQ ID No. 3;
and, the AAV capsid protein mutants have increased liver targeting as compared to a protoaav capsid protein not inserted with the liver targeting short peptide element.
2. The capsid protein mutant of claim 1, wherein said AAV capsid proteins comprise capsid proteins selected from the group consisting of: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10.
3. The capsid protein mutant of claim 1, wherein said AAV capsid protein mutant further has one or more properties selected from the group consisting of:
(a) Specifically targeting liver cells;
(b) High transduction efficiency of liver cells is that: the transduction rate of the AAV capsid mutant in liver cells is 2-4 times of that of other AAV capsids; and
(c) Low immunogenicity, which means: the AAV capsid mutants produce neutralizing antibody titers of less than or equal to 1:4 in the immune response.
4. A mutant AAV capsid comprising the capsid protein mutant of claim 1.
5. A mutant AAV vector comprising the capsid mutant of claim 1 or comprising the mutant AAV capsid of claim 4.
6. The liver targeting oligopeptide is characterized in that the sequence of the oligopeptide is shown as SEQ ID NO. 3.
7. A polynucleotide encoding the liver-targeting adeno-associated virus capsid protein mutant of claim 1, or the liver-targeting oligopeptide of claim 6.
8. An expression vector comprising the polynucleotide of claim 7.
9. A host cell comprising the expression vector or genome of claim 8 having integrated therein the polynucleotide of claim 7.
10. A pharmaceutical composition, characterized in that it comprises the following components:
(i) The mutant AAV vector (or AAV viral particle) of claim 5; and
(ii) Pharmaceutically acceptable excipients or carriers.
CN202210476844.8A 2022-04-30 2022-04-30 Liver-specific adeno-associated virus serotypes and uses thereof Pending CN117003833A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210476844.8A CN117003833A (en) 2022-04-30 2022-04-30 Liver-specific adeno-associated virus serotypes and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210476844.8A CN117003833A (en) 2022-04-30 2022-04-30 Liver-specific adeno-associated virus serotypes and uses thereof

Publications (1)

Publication Number Publication Date
CN117003833A true CN117003833A (en) 2023-11-07

Family

ID=88562432

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210476844.8A Pending CN117003833A (en) 2022-04-30 2022-04-30 Liver-specific adeno-associated virus serotypes and uses thereof

Country Status (1)

Country Link
CN (1) CN117003833A (en)

Similar Documents

Publication Publication Date Title
AU2019200949B2 (en) High-transduction-efficiency raav vectors, compositions, and methods of use
US11434260B2 (en) High-transduction-efficiency rAAV vectors, compositions, and methods of use
KR102649543B1 (en) Capsid-modified, raav3 vector compositions and uses in gene therapy of human liver cancer
US9611302B2 (en) High-transduction-efficiency RAAV vectors, compositions, and methods of use
EP2848253A1 (en) Modified factor VIII and factor IX genes and vectors for gene therapy
WO2022222869A1 (en) Recombinant adeno-associated virus and application thereof
CN113121651A (en) Novel low neutralizing antibody adeno-associated virus capsid protein
WO2021113634A1 (en) Transgene cassettes designed to express a human mecp2 gene
US20240091383A1 (en) Synergistic effect of smn1 and mir-23a in treating spinal muscular atrophy
CN114276419B (en) Novel adeno-associated virus capsid protein with high affinity for muscle and application thereof
CN117003833A (en) Liver-specific adeno-associated virus serotypes and uses thereof
CN115160410A (en) Novel muscle high-efficiency affinity adeno-associated virus serotype and related application
CN114686448A (en) Purified adeno-associated virus with liver specific targeting and application thereof
OA21075A (en) Codon-optimized nucleic acid that encodes SMN1 protein, and use thereof
KR20240049295A (en) AQP1 gene therapy to prevent radiation-induced salivary dysfunction
OA21365A (en) Synergistic effect of SMN1 and MIR-23A in treating spinal muscular atrophy.
CN114591921A (en) Purification method and eluent of adeno-associated virus
CN115927401A (en) Nucleic acid encoding NADH ubiquinone oxidoreductase subunit 4 and uses thereof
CA3219795A1 (en) Recombinant tert-encoding viral genomes and vectors
CN117940147A (en) AQP1 gene therapy for preventing radiation-induced hyposalivation
CN115710585A (en) Nucleic acid encoding ND4 and use thereof
JPWO2021084133A5 (en)

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination