CN116970555A - Myocardial fibroblast HCFC-MYOG and application thereof - Google Patents

Abstract

The invention discloses a myocardial fibroblast HCFC-MYOG and application thereof, belonging to the technical field of biological medicine. The cells were deposited at the Cantonese microorganism strain collection, accession number GDMCC NO:63588. the invention shows that the transcription factor gene MYOG can be utilized to improve the tolerance of myocardial fibroblasts (HCFC) to hypoxia and oxidative damage.

Description

Myocardial fibroblast HCFC-MYOG and application thereof

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to a myocardial fibroblast HCFC-MYOG and application thereof.

Background

Myocardial fibroblasts (cardiac fibroblast, CF), cardiomyocytes, endothelial cells and vascular smooth muscle cells are the main components of the heart. Studies show that the proportion of adult myocardial fibroblasts in the heart is about 20%, CF provides a complete reticular support system for the heart cell population by synthesizing and secreting extracellular matrix components such as collagen, fibronectin and the like, and plays an important role in maintaining the heart structure, function, biochemistry and electromechanical signal transduction. CF is also a key effector cell for cardiac fibrosis, and is involved in the pathological processes of various common cardiovascular diseases such as ischemic cardiomyopathy, dilated cardiomyopathy, hypertrophic cardiomyopathy, and diabetic cardiomyopathy.

Myocardial infarction (myocardial infarction, MI) is the acute occlusion of the coronary arteries, thereby causing irreversible necrosis of the myocardial tissue cells that occlude the respective blood supply area of the vessel. Cardiomyocytes, as terminally differentiated cells, fail to repair themselves after necrosis from ischemic and hypoxic injury, instead undergo fibrosis to form scar tissue, followed by cardiac remodeling and progressive cardiac insufficiency. Modern drug therapy is also very limited in preventing ventricular remodeling and heart failure, and a new therapeutic strategy is provided for preventing ventricular remodeling and congestive heart failure progression after myocardial infarction by using a cardiac cell reconstruction technology for replacing or regenerating myocardial cells through cell transplantation. Recent studies have shown that stem cell therapy, while promoting cardiac revascularization, is at risk of tumorigenesis. Inducing stem cells to differentiate into cells of the myocardial lineage in vitro and then re-transplanting into heart tissue may be a better option to circumvent this risk. It has been confirmed that injection of human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CM) into the myocardial infarction area of mice can significantly improve cardiac function in myocardial infarction mice, and transplantation of cell sheets co-cultured with hiPSC-CM and endothelial cells into myocardial infarction areas of myocardial infarction rats can also improve cardiac function, but low cell viability in heart tissue transplanted into cells is a constant problem in cell therapy, and has become one of the bottlenecks impeding clinical transformation applications of stem cells.

The transcription factor gene MYOG encodes Myogenin (Myogenin) protein, and is one of members of the gene family of Myogenic Regulatory Factors (MRFs). The family of MRFs transcription factors (including Myod, myf5, mrf4 and MYOG) play a key role in each stage of skeletal myogenesis. All members of this family together contain a conserved helix-loop-helix (bHLH) motif that can bind to the E-box of the downstream gene, thereby activating expression of the downstream muscle-specific gene. Studies have shown that MYOG plays a key role in the process of muscle differentiation by controlling, initiating the fusion of myoblasts and the formation of muscle fibers. The company reports that over-expression of MYOG gene can inhibit myocardial cell apoptosis induced by angiotensin II in the early stage, and the relation between MYOG gene and myocardial fibroblasts has not been reported yet.

Disclosure of Invention

The invention constructs a myocardial fibroblast HCFC-MYOG by over-expressing MYOG gene in human myocardial fibroblasts (HCFC), and the cells are preserved in the microorganism strain collection of Guangdong province at 2023 and 6 months and 27 days, and the preservation number is GDMCC NO:63588, the preservation address is 5 buildings of Guangzhou Md.A. No. 100 college, no. 59.

The construction method of the myocardial fibroblast HCFC-MYOG comprises the following steps:

1. constructing a pCW-MYOG vector;

2. packaging the lentivirus;

3. transfecting HCFC cells and screening;

5. inducing MYOG gene expression with doxycycline hydrochloride (Dox) at a concentration of 2 μg/mL;

6. identifying HCFC-MYOG cell strains by qPCR, western blot and immunofluorescence;

7. by H ₂ O ₂ 、CoCl ₂ The cells were treated and flow cytometry examined apoptosis and the proportion of cell death.

The invention shows that the transcription factor gene MYOG can be utilized to improve the tolerance of myocardial fibroblasts (HCFC) to hypoxia and oxidative damage.

Drawings

FIG. 1 is a technical flow chart for obtaining myocardial fibroblast HCFC-MYOG;

FIG. 2 is a graph showing the expression levels of MYOG mRNA in qPCR-detected HCFC and HCFC-MYOG;

FIG. 3 is a graph showing Western blot detection of MYOG protein expression levels in HCFC and HCFC-MYOG;

FIG. 4 is a graph of immunofluorescence identification of MYOG positive cells in HCFC and HCFC-MYOG, with a scale of 50 microns;

FIG. 5 shows simulated reactive oxygen species (H) ₂ O ₂ ) And hypoxia injury (CoCl) ₂ ) Under the condition, the ratio of apoptosis and the ratio of death of HCFC-MYOG cell amount HCFC are shown in the formula of p<0.001; ns, no statistical difference;

FIG. 6 is H ₂ O ₂ 、CoCl ₂ Apoptosis ratio map of HCFC-MYOG co-cultured cardiomyocytes under conditions.

Detailed Description

The present invention will be further described with reference to the accompanying drawings for a clear and intuitive understanding to those skilled in the art.

Example 1: obtaining cell lines of myocardial fibroblast HCFC-MYOG

The technical scheme for obtaining the myocardial fibroblast HCFC-MYOG is shown in figure 1.

1.1 construction of lentiviral expression vectors: the MYOG cDNA and a puromycin resistance gene were subcloned into the pCW-Cas9-Blast vector (Addgene, 83481) using conventional molecular cloning methods, replacing the Cas9 and Blast genes in the original vector.

1.2 lentiviral packaging

1.2.1 HEK293T cells were seeded in 6 well plates, cultured with D10 broth (DMEM broth+10% foetal calf serum) and transfected when cell confluence reached 70% -80%.

1.2.2 the original culture broth was discarded 1h before transfection and 2 mL/well of pre-warmed serum-free OptiMEM broth was added.

1.2.3 transfection with Lipofectamine 2000 reagent was performed as described in the product instructions. HEK293T cells were co-transfected with pCW-MYOG (20. Mu.g), pVSVg (10. Mu.g) (Addgene), psPAX2 (15. Mu.g) (Addgene).

1.2.4 after 6h, the broth was replaced with D10 broth (DMEM broth+10% foetal calf serum+1% BSA).

1.2.5 after further culturing for about 60 hours, the culture broth was centrifuged at 3000rpm at 4℃for 10 minutes to remove cell debris.

1.2.6 the supernatant was filtered through a 0.45 μm low protein binding filter (Millipore Steriflip HV/PVDF) to remove cell debris.

1.2.7 virus-containing cultures were centrifuged at 10000g for 4h at 4℃with 10% sucrose buffer (50 mM Tris-HCl, pH 7.4, 100mM NaCl,0.5mM EDTA) in a volume ratio of 4:1. Carefully discard the supernatant, drain the tube on absorbent paper for 3min, add 1 XPBS for resuspension and preserve at-80 ℃.

1.3 transfection of HCFC cells

1.3.1HCFC culture: HCFCs were inoculated on plates coated with 0.15% gelatin (Sigma, V900863) and then cultured with dmem+10% fbs. The medium was changed every two days. HCFCs are passaged every 2-3 days or when cell culture reaches 80-90% confluence. The cells were collected by centrifugation after washing 1 XDPBS (Gibco, 14040133) 1 times and then digested with 0.05% trypsin at room temperature, and the primary culture supernatant was discarded, resuspended in fresh medium and plated on a 0.15% gelatin-coated plate. The passage ratio was 1:3-1:6.

1.3.2 transfection: and (3) carrying out transfection when the confluence of HCFC cells reaches 70% -80%. The multiplicity of infection (MOI) is about 0.3 to 0.5. 24h after transfection, the culture broth was replaced with fresh DMEM+10% FBS (containing doxycycline hydrochloride (Dox) at a final concentration of 2. Mu.g/mL). After 2 days, the culture medium was replaced with DMEM+10% FBS (containing Dox 2. Mu.g/mL+puromycin (puromycin) (InvivoGen) 2. Mu.g/mL) for screening. After 2-3 days of screening, about 30% conversion efficiency was obtained. And (3) selecting single clone, inoculating the single clone into different dishes, and culturing to obtain a cell strain of the myocardial fibroblast HCFC-MYOG.

Example 2: dox-induced MYOG gene high expression

2.1 induction: MYOG expression was induced by adding Dox (Sigma, D9891) to the culture broth (DMEM+10% FBS) at a final concentration of 2. Mu.g/mL.

2.2qPCR detection of MYOG mRNA expression levels:

2.2.1 total RNA extraction: total RNA was extracted from cells using UNIQ-10Column Trizol Total RNA Isolation Kit (Sangon Biotech, B511321-0100).

2.2.2 reverse transcription: RNA was reverse transcribed using reverse transcription kit iScript Reverse Transcription Supermix (Bio-Rad, 1708841).

2.2.3 according to SsoAdvance ^TM UniversalGreen Supermix (Bio-Rad, 1725271) using the Picoreal Real-Time PCR System (Thermo Fisher) System, primers were designed to detect MYOG expression levels in HCFC, HCFC-MYOG cells using beta-actin as an internal reference. The primer sequences were as follows:

MYOG-RT-F:GCCCAAGGTGGAGATCCT；

MYOG-RT-R:GGTCAGCCGTGAGCAGAT；

β-actin-RT-F:TTGCCGACAGGATGCAGAAGGA；

β-actin-RT-R:AGGTGGACAGCGAGGCCAGGAT.

2.3Western blot detection of MYOG protein expression level:

2.3.1 sample preparation: after cell confluency >80%, the stock culture was discarded, washed once with pre-chilled PBS, and cells (containing protease inhibitor (B14001) and phosphatase inhibitor (B15001)) were lysed by adding RIPA lysate (Solarbio, R0010), and the lysate was centrifuged at 12,000Xg at 4℃for 15min at-80℃for further use.

2.3.2 determination of total protein concentration: total protein concentration was determined according to the instructions of the modified Bradford protein concentration determination kit (Industry, C503041).

2.3.3 Polyacrylamide gel electrophoresis: 10 μg protein sample was added to a spot well of a pre-fabricated gel (Soy Bao, PG 01010-S), voltage 80V, and run for 60min.

2.3.4 electric transfer and ponceau staining: polyvinylidene fluoride membrane (PVDF, merck-Millipore, ISEQ 00010) was used, constant current was 50mA, membrane transfer was carried out for 60min, developed for 1min with ponceau dye solution, and rinsed with distilled water.

2.3.5 antigen-antibody reaction and color development: the ponceau-dyed film was immersed in 5% nonfat dry milk for 1h and washed several times with 1 XTBST. Myogenin antibody (abcam, ab124800, 1:200) was added and incubated overnight at 4 ℃. After washing the membrane, horseradish peroxidase-labeled secondary antibodies (abcam, ab186696, 1:5000) were added, incubated for 1h at room temperature, and washed several times. The membrane was placed in a chromogenic solution and incubated for 5min at room temperature. The color is developed by an autoradiography method.

2.4 immunofluorescence identification of MYOG positive cells:

2.4.1 cell culture: HCFC, HCFC-MYOG was cultured with culture broth (DMEM+10% FBS+Dox (2. Mu.g/mL)) to a cell confluence >80%.

2.4.2 fixing and permeabilizing: the stock culture was discarded, washed once with PBS, fixed with 4% PFA at room temperature for 20min, washed 3 times with PBS, and permeabilized with 0.25% Triton X-100 at room temperature for 20min.

2.4.3 blocking: 10% goat serum was incubated at 37℃for 1h.

2.4.4 immunostaining: primary antibodies (Myogenin, abcam, ab124800, 1:200) were added and incubated overnight at 4 ℃. Washing 3 times with 0.1% Triton X-100, adding secondary antibody (gold anti-Rabbit IgG/Alexa Fluor488, bios, BS-0295G-AF 488), and incubating at 37℃for 1h.0.1% Triton X-100 was washed 3 times, incubated with Hoechst 33342 in the dark for 10min, and washed once with PBS. The images were observed and photographed with a fluorescence microscope.

2.5 results and analysis:

2.5.1 detection of MYOG Gene expression levels by qPCR the results of FIG. 2 show that the MYOG gene expression level in HCFC-MYOG cells is 12976 times that of the control (HCFC). The level of MYOG protein expression was detected by Western blot, as shown in FIG. 3, almost no MYOG protein was detected in the control group (HCFC), whereas the HCFC-MYOG group showed the correct size of MYOG protein band. As shown in FIG. 4, immunofluorescence results showed that HCFC did not express MYOG protein, and that over 90% of HCFC-MYOG cells expressed MYOG protein. In conclusion, we succeeded in constructing HCFC cell lines that induce high expression of MYOG genes.

Example 3: overexpression of the MYOG gene increases tolerance of HCFC cells to hypoxia and oxidative damage

3.1 cell culture: HCFC and HCFC-MYOG are according to 2X 10 ⁵ cells/well were seeded in 6-well plates with DMEM+10% FBS (containing hydrochloric acid at a final concentration of 2. Mu.g/mLTetracycline (Dox)).

3.2 drug treatment: after 24H inoculation, the addition of H was started ₂ O ₂ 、CoCl ₂ Induce apoptosis. H ₂ O ₂ The concentration was 1mM and the treatment time was 4 hours. CoCl ₂ The concentration was 1. Mu.M and the treatment time was 24 hours. Each set was set with 3 replicates. The blank medium was DMEM+10% FBS (containing doxycycline hydrochloride (Dox) at a final concentration of 2. Mu.g/mL).

3.3 apoptosis and death ratio detection: apoptosis ratio after drug treatment was measured using APC Annexin V apoptosis detection kit (Biolegend, 640920), labeled with 7-AAD cell death activity staining reagent (Biolegend, 420403), and flow cytometry measured cell death ratio.

3.3 results and analysis: as shown in FIG. 5, H ₂ O ₂ 、CoCl ₂ Respectively simulating active oxygen and hypoxia injury, and adding H into HCFC-MYOG cells ₂ O ₂ 、CoCl ₂ The post-apoptotic and death rates were significantly lower than the control (HCFC), indicating that overexpression of the MYOG gene increased the tolerance of HCFC cells to hypoxia and oxidative damage.

Example 4: co-cultivation of HCFC-MYOG with hiPSC-CM can reduce CoCl ₂ 、H ₂ O ₂ Increased apoptosis of cardiac muscle cells

4.1 preparation of experimental materials: HCFC and HCFC-MYOG are according to 2X 10 ⁵ cells/well were seeded in 6-well plates, incubated with DMEM+10% FBS (containing doxycycline hydrochloride (Dox) at a final concentration of 2. Mu.g/mL) to a confluence of about 80%, treated with mitomycin (mitomycin, 20. Mu.g/mL) for 5h, after which incubation with DMEM+10% FBS (containing doxycycline hydrochloride (Dox) at a final concentration of 2. Mu.g/mL) was continued, labeled HCFC-Mito-C and HCFC-MYOG-Mito-C. iPSC-CM-EGFP was cultured with RPMI 1640+3% KOSR.

4.2 Co-cultivation: according to HCFC/HCFC-MYOG: hiPSC-CM-egfp=5:5 co-cultures were performed under culture condition (3), while a control group was set with only hiPSC-CM-EGFP, and the total number of cells in each group was the same. The specific method comprises the following steps: CM group: 2.5X10 of 12-well plate per well ⁵ The individual hiPSCs-CM-EGFPs; cm+hcfc group: 1.25X10 per well of 12-well plate ⁵ iPSC-CM-EGFP and 1.25×10 ⁵ HCFC-Mito-C; CM+HCFC-MYOG group: 1.25X10 per well of 12-well plate ⁵ iPSC-CM-EGFP and 1.25X10 ⁵ The HCFC-MYOG-Mito-C was repeated 3 times per group. Cells were changed every 2-3 days.

4.3 drug treatment: after 4 days of co-cultivation, different drug treatments were added. Wherein CoCl ₂ The concentration was 1mM and the treatment time was 24 hours. H ₂ O ₂ The concentration was 1mM and the treatment time was 4h. Each group was provided with 3-4 biological replicates. The control group had no drug treatment.

4.4 apoptosis ratio detection: apoptosis ratio after drug treatment was measured using APC Annexin V apoptosis detection kit (Biolegend, 640920).

4.5 results and analysis: as shown in FIG. 6, CM co-cultured with HCFC-MYOG in H ₂ O ₂ 、CoCl ₂ The apoptosis ratio under the treated or normal culture conditions is obviously lower than that of the HCFC co-culture or CM single culture, which proves that the co-culture of HCFC-MYOG and myocardial cells can obviously reduce the cell growth rate from H ₂ O ₂ 、CoCl ₂ Induced oxidative and anoxic damage.

The previous description of the embodiments is provided to facilitate a person of ordinary skill in the art in order to make and use the present invention. It will be apparent to those skilled in the art that various modifications can be readily made to these embodiments and the generic principles described herein may be applied to other embodiments without the use of the inventive faculty. Therefore, the present invention is not limited to the embodiments described herein, and those skilled in the art, based on the present disclosure, should make improvements and modifications within the scope of the present invention.

Claims (8)

1. Myocardial fibroblast HCFC-MYOG deposited at 2023, 6 and 27 with the collection of microorganisms and cell cultures, cantonese province, under the accession number GDMCC NO:63588.

2. use of the cardiomyocyte HCFC-MYOG of claim 1 in the preparation of a cardiomyocyte protectant.

3. The use of claim 2, wherein the factor of cardiomyocyte death comprises hypoxia or oxidative damage.

4. Use of the myocardial fibroblast HCFC-MYOG of claim 1 in the manufacture of a medicament for treating myocardial infarction.

5. The use according to claim 4, wherein the medicament is an injectable agent.

6. A medicine for treating myocardial infarction, which is characterized by comprising myocardial fibroblast HCFC-MYOG and a component for inducing the expression of MYOG genes.

7. A protective agent for myocardial cells under anoxic or oxidative damage conditions, which is characterized by comprising myocardial fibroblast HCFC-MYOG and a component for inducing MYOG gene expression.

8. The protectant of claim 7, wherein the component that induces expression of a MYOG gene is doxycycline hydrochloride.