CN116891835A - 11 beta-hydroxylation recombinant filamentous fungi for efficiently synthesizing hydrocortisone and application thereof - Google Patents

11 beta-hydroxylation recombinant filamentous fungi for efficiently synthesizing hydrocortisone and application thereof Download PDF

Info

Publication number
CN116891835A
CN116891835A CN202310000666.6A CN202310000666A CN116891835A CN 116891835 A CN116891835 A CN 116891835A CN 202310000666 A CN202310000666 A CN 202310000666A CN 116891835 A CN116891835 A CN 116891835A
Authority
CN
China
Prior art keywords
beta
hydrocortisone
mutant
recombinant
aspergillus ochraceus
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310000666.6A
Other languages
Chinese (zh)
Inventor
刘晓光
杨滨瑞
路福平
毛淑红
李金红
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin University of Science and Technology
Original Assignee
Tianjin University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin University of Science and Technology filed Critical Tianjin University of Science and Technology
Priority to CN202310000666.6A priority Critical patent/CN116891835A/en
Publication of CN116891835A publication Critical patent/CN116891835A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P33/00—Preparation of steroids
    • C12P33/06—Hydroxylating
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/11—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (1.14.11)
    • C12Y114/11035—1-Deoxypentalenic acid 11beta-hydroxylase (1.14.11.35)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C12R2001/85—Saccharomyces
    • C12R2001/865—Saccharomyces cerevisiae

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides 11 beta-hydroxylation recombinant filamentous fungi for efficiently synthesizing hydrocortisone and application thereof, belonging to the technical fields of genetic engineering and enzyme engineering; the invention overexpresses C11β -hydroxylase CYP5103B6 mutant T291Y/M365A/A372F derived from Curvularia lunata in Aspergillus ochraceus strain lacking 11 alpha-hydroxylase CYP68J5, and the obtained Aspergillus ochraceus recombinant strain can efficiently convert substrate 11-deoxycortisol to generate hydrocortisone. The amino acid sequence of the mutant is shown as SEQ ID NO: 4. The feeding amount of the substrate 11-deoxycortisol is 3g/L, the conversion is carried out for 72 hours, and the yield of the product hydrocortisone reaches 78%. The invention provides valuable industrial strains and technical methods for researching and developing the process for producing hydrocortisone by using high-efficiency C11β -hydroxylated 11-deoxycortisol.

Description

11 beta-hydroxylation recombinant filamentous fungi for efficiently synthesizing hydrocortisone and application thereof
Technical field:
the invention applies genetic engineering and enzyme engineering technology, and utilizes means such as gene knockout, enzyme molecular transformation, protoplast mediated transformation and the like to construct the steroid 11 beta-hydroxylation recombinant aspergillus ochraceus for efficiently synthesizing hydrocortisone and application.
The background technology is as follows:
the steroid compounds are compounds taking cyclopentane polyhydrophenanthrene as a mother nucleus, and the physiological pharmacological activity of the steroid hormone drugs depends on the introduction of functional groups at specific sites of a framework. Because the synthesis process of the chemical synthesis method is complex, the industrial common microbial transformation method is used for synthesizing the steroid compound with the key functional group introduced.
Hydrocortisone (HC) has the functions of strong anti-inflammatory, immunosuppression, shock resistance and the like, and is also an important intermediate for synthesizing the advanced glucocorticoid medicine. The industrial use of the hydroxylation reaction of Curvularia lunata (Curvularia lunata) to convert the C11 beta-position of 11-deoxycortisol (RS) produces hydrocortisone with anti-inflammatory activity. The 11 beta-hydroxylation technology based on the filamentous fungus Curvularia lunata in the industry still has the bottlenecks of low feeding amount, poor hydroxylation specificity, low conversion rate, low yield and the like. The invention provides a C11 beta-hydroxylase CYP5103B6 mutant with high hydroxylation specificity constructed by a genetic engineering method and corresponding genetic engineering recombinant bacteria. In the process of producing steroid hormone medicines, 11-position hydroxylation reaction occupies an important position and is one of key technologies of microbial transformation reaction. Hydroxyl can be introduced into the carbon 11 position of the steroid nucleus through microbial transformation to generate a product with stronger pharmacological activity, and aspergillus ochraceus (Aspergillus ochraceus) is widely used in industrial production due to higher hydroxylation activity.
The genetic transformation method of the filamentous fungi is key to the genetic engineering of the fungi and the basic research of important functional genetics. Protoplast transformation is the earliest method used for transformation of filamentous fungi and is basically as follows; a. constructing a shuttle plasmid between escherichia coli (Escherichia coli JM 109) and fungi, and selecting a proper enzyme cutting site to insert an exogenous gene; b. preparing protoplast; c. under the action of proper PEG and CaCl2, the protoplast is induced to inhale exogenous DNA; d. transformants are selected by nutritional complementation or antibiotic selection; e. transformants were identified by PCR, colony hybridization, and Southern blot techniques. However, since the transformation process is complicated, the influence factors are numerous, and it is difficult to prepare protoplasts with good quality. Therefore, the invention optimizes some key factors for preparing protoplasm, such as enzyme liquid components and proportion, osmotic pressure stabilizer and bacterial age. And simultaneously, the regeneration culture medium and the like are optimized.
AMA1 sequences were isolated from a genomic library of Aspergillus nidulans (Aspergillus nidulans) which increased the frequency of transformation and produced phenotypically unstable transformants in filamentous fungi. These properties proved to be the result of extrachromosomal replication of the AMA 1-carrying plasmid. The literature reports efficient transformation of plasmid vectors containing AMA1 sequences and autonomous replication in filamentous fungi. Transformation efficiency is related to the length of AMA1 fragments used to construct the different autonomously replicating plasmids. One of the two palindromic inverted repeats of AMA1 (the 2.2kb SalI-HindIII fragment) is sufficient to confer autonomous replication and high transformation efficiency. Deletion of the 0.6kb central fragment located between inverted repeats does not affect the ability of the plasmid to autonomously replicate or transform efficiency, but alters mitotic stability and plasmid copy number. Deletion of any fragment of the 2.2kb repeat will result in loss of autonomous replication capacity and reduce transformation efficiency. The recombinant plasmid of the invention is constructed on a plasmid vector containing AMA1 through protoplast mediated transformation.
The invention firstly carries out site-directed mutagenesis on a C11 beta-hydroxylase gene CYP5103B6 identified in a laboratory in the earlier stage from Curvularia lunata (Curvularia lunata), converts 11-deoxycortisol (RS) by saccharomyces cerevisiae (Saccharomyces cerevisiae INVSc 1) and screens to obtain a C11 beta-hydroxylase CYP5103B6 mutant T291Y/M365A/A372F with strong hydroxylation activity and obviously improved specificity, but has the problem of low feeding amount and needs to replace host bacteria. Aspergillus ochraceus (Aspergillus ochraceus TCCC 41060) is widely used in industrial production due to its high hydroxylation activity, but the conversion efficiency is still to be improved, such as low at higher substrate dosage. In order to improve the conversion efficiency of aspergillus ochraceus, two aspects are generally considered: optimizing fermentation conditions and performing genetic modification of the strain. The prior transformation is to improve the efficiency of the Aspergillus ochraceus steroid conversion process, and the industrial steroid production conversion efficiency is not improved from the aspect of changing the genetic characteristics of strains. The invention uses a protoplast-mediated transformation method to over-express the C11β -hydroxylase CYP5103B6 mutant T291Y/M365A/A372F of the Curvularia lunata in the Aspergillus ochraceus strain lacking 11 α -hydroxylase CYP68J5, and the obtained Aspergillus ochraceus recombinant strain can efficiently transform a substrate 11-deoxycortisol (RS) to generate Hydrocortisone (HC).
The invention comprises the following steps:
the invention constructs a steroid 11 beta-hydroxylase mutant T291Y/M365A/A372F recombinant aspergillus ochraceus for efficiently converting 11-deoxycortisol (RS) into Hydrocortisone (HC) and a steroid conversion process.
The technical route of the invention is as follows: based on C11 beta-hydroxylase CYP5103B6 identified from Curvularia lunata in the early stage of a laboratory, site-directed mutagenesis is carried out on the recombinant Saccharomyces cerevisiae plasmid pYES2-CYP5103B6, and the recombinant Saccharomyces cerevisiae Sc-11 beta rm291/365/372 with remarkably improved hydroxylation specificity is obtained. The problem of low feed amount still exists, and the host bacteria need to be replaced. The result of laboratory early gene directional knockout reveals that CYP68J5 is the only gene involved in the hydroxylation of Aspergillus ochraceus C11 alpha-steroid, a promoter of the Aspergillus ochraceus 11 alpha-hydroxylase gene CYP68J5 is used as a homology arm of a knockout vector, a knockout vector plasmid pCSN44-G418-11 beta m291/365/372 is constructed in vitro, and the expression of the mutant is driven by a promoter of an ORF upstream 1.2kb sequence of the Aspergillus ochraceus 11 alpha-hydroxylase gene CYP68J 5. Homologous recombination of 11 beta m291/365/372 gene with G418 screening mark and mutation is carried out on a plasmid vector which can autonomously replicate in aspergillus ochraceus and contains AMA1, and the recombinant aspergillus ochraceus is utilized for fermenting and converting RS to produce HC. Provides valuable industrial strains and technical methods for researching and developing the process for producing hydrocortisone by using high-efficiency C11β -hydroxylated 11-deoxycortisol.
The CYP5103B6 gene is derived from Curvularia lunata (Curvularia lunata);
the nucleotide sequence of the undetermined mutation is shown as SEQ ID NO:1, the corresponding amino acid sequence is shown as SEQ ID NO: 2.
The nucleotide sequence of the mutant T291Y/M365A/A372F is shown as SEQ ID NO:3, the corresponding amino acid sequence is shown as SEQ ID NO:4, the above sequence falls within the scope of the present invention.
The recombinant expression vector, recombinant expression plasmid or host cell constructed by using the gene fragment CYP5103B6 for encoding the C11 beta-hydroxylase also belongs to the protection scope of the invention, and the amplification primer sequence used and the amino acid site related to the site-directed mutation of the gene fragment CYP5103B6 also belong to the protection scope of the invention.
The steroid hydroxylase coded by the mutant gene CYP5103B6 obtained by the site-directed mutagenesis technology comprises but is not limited to host cell expression of Saccharomyces cerevisiae, aspergillus ochraceus and the like.
The beneficial effects are that:
the feeding amount of the steroid substrate RS is 3g/L, the conversion is carried out for 72 hours, and the yield of the product HC is 78%. The invention provides a novel heterologous expression system based on mutant T291Y/M365A/A372F and a steroid transformation process, and provides valuable industrial strains and technical methods for researching and developing a high-efficiency C11 beta-hydroxylation RS HC production process.
Description of the drawings:
FIG. 1 shows a C11 beta-hydroxylation reaction of the C11 beta-hydroxylase CYP5103B6 to 11-deoxycortisol (RS) to Hydrocortisone (HC);
FIG. 2 is a schematic diagram of pYES 2-11. Beta. M291/365/372 recombinant Saccharomyces cerevisiae expression plasmid;
FIG. 3 TLC analysis of the conversion of RS to HC for recombinant Saccharomyces cerevisiae Sc-11. Beta. M291/365/372;
FIG. 4 HPLC analysis of the RS-converted synthetic HC for recombinant Saccharomyces cerevisiae Sc-11 βm291/365/372;
FIG. 5 is a schematic diagram of the expression cassette of C11 beta-hydroxylase mutant T291Y/M365A/A372F, whose expression is driven by the 1.2kb sequence promoter upstream of the ORF of the A.ochraceus 11 alpha-hydroxylase gene CYP68J 5;
FIG. 6 is a schematic diagram of recombinant expression plasmid pCSN 44-G418-11. Beta. M291/365/372;
FIG. 7 is a schematic diagram of recombinant expression plasmid pAMA 1-G418-11. Beta. M291/365/372;
FIG. 8 is a colony of recombinant Aspergillus ochraceus transformants;
FIG. 9 is a PCR-validated agarose gel electrophoresis of recombinant Aspergillus ochraceus transformants;
FIG. 10 shows the HC yield of the recombinant Aspergillus ochraceus Ao-11. Beta. M291/365/372 at 3g/LRS dose.
The specific embodiment is as follows:
the process according to the invention is described below by way of specific embodiments. The experimental methods in the following examples are conventional methods unless otherwise specified. The embodiments should be considered as illustrative, and not limiting, the scope of the invention being limited only by the claims. The test materials used in the examples described below, unless otherwise specified, were purchased from conventional biochemical reagent stores.
Example 1: construction and functional evaluation of mutant T291Y/M365A/A372F of mutant C11 beta hydroxylase
1.1 construction of mutant T291Y/M365A/A372F
The plasmid pYES2-CYP5103B6 is used as a template, and a PCR site-directed mutagenesis method is used, and primers are synthesized by Beijing Hua big gene company.
mu.L of the PCR product was used to verify the size of the band by agarose gel electrophoresis, and the size of the band was 7.3kb. The PCR product was digested with Dpn I enzyme for 3 hours (enzyme deactivation at 70℃for 20 min) and recovered using a small amount of DNA purification kit. The recovered product is transferred into JM109 to be competent, the transformant is selected in an LB test tube, the plasmid is extracted after shaking for 8-12h by a shaking table 200r at 37 ℃, the plasmid is verified to be 1.5kb and 5.8kb by double enzyme digestion of BamHI enzyme and EcoRI enzyme, and the mutant plasmid pYES2-11 beta m291/365/372 is obtained, and the construction schematic diagram of the expression vector is shown in figure 2.
1.2 evaluation of the transformation of the Sc-11. Beta. M291/365/372 substrate of recombinant Saccharomyces cerevisiae
Transferring the mutant T291Y/M365A/A372F plasmid into Saccharomyces cerevisiae by using a lithium acetate transformation method, performing primary screening on transformants by using uracil auxotroph SC medium, and performing steroid transformation fermentation experiments after regenerating by YPD medium.
The feeding amount of the substrate RS is 1g/L, the recombinant saccharomyces cerevisiae mutant T291Y/M365A/A372F is subjected to RS steroid conversion experiments, sampling is carried out after shaking culture is carried out for 72 hours at 30 ℃, supernatant is extracted by ethyl acetate, qualitative analysis is carried out on the product by thin layer chromatography, and the analysis on the product by an ultraviolet analyzer shows that the by-product of the mutant T291Y/M365A/A372F is obviously reduced compared with the wild type gene. The transformation results are shown in FIG. 3
Extracting the mutant fermentation conversion product, taking 100 mu L of supernatant, drying, adding 200 mu L of mobile phase liquid which is uniformly mixed by ultrasonic, uniformly mixing to prepare a liquid phase sample, performing HPLC (high performance liquid chromatography) detection, and performing HPLC detection, wherein the detection result is shown in figure 4.
Liquid phase conditions: mobile phase a: mobile phase B = acetonitrile: water=65%: 35%; temperature: 25 ℃; flow rate: 1.0mL/min; sample injection amount: 10. Mu.L; detection wavelength: 241nm; sample introduction time: for 10min;
from the analysis of the liquid phase results, it can be seen that: the specificity of the C11 beta-mutant T291Y/M365A/A372F recombinant saccharomyces cerevisiae on the C11 beta-hydroxylation of a substrate RS is obviously improved, compared with the 11 beta-gene wild type before mutation, the absorption peak area at RT= 6.832 is obviously reduced or even eliminated, and the HC yield is improved by 26.5 percent.
Example 2: construction of recombinant plasmid pAMA 1-G418-C11. Beta. M291/365/372
2.1 construction of recombinant plasmid pCSN 44-G418-11. Beta. M291/365/372
2.1.1 obtaining of vector backbone pCSN44-G418
The PCR amplification is carried out according to a primer designed for inverse PCR of a skeleton of CYP68J5 part removed by the recombinant plasmid pCSN44-G418-CYP68J5 constructed in the earlier stage of a laboratory, and the primer is synthesized by Beijing Hua big gene company.
Primer name primer base sequence
Inverse P-A-F GAATTCGATAATGAGCTGTCAGCTTG
Inverse P-A-R GACTAGTGTCGAACACGAAGTCCTG
PCR reaction system
PCR reaction conditions:
2.1.2 obtaining of the insert 11. Beta. M291/365/372
The recombinant plasmid pYES2-11 beta m291/365/372 is used as a template to amplify the target fragment 11 beta m291/365/372, and the 5' -end of the forward and reverse PCR primer is introduced with a 20bp linearization vector skeleton pCSN 44-G418-end homologous sequence, so that the 5' -end and the 3' -end of the inserted fragment PCR product respectively have completely identical sequences corresponding to the two ends of the linearization vector. Primers were synthesized by Beijing Hua big Gene company.
Primer name primer base sequence
HR-F GACAGCTCATTATCGAATTCTCGGATCCTACGTAATGGACC
HR-R CTTCGTGTTCGACACTAGTCGCAGAATTCTCAAACAACAACTC
PCR reaction conditions:
the PCR product was confirmed to be correct by 1.0% agarose gel electrophoresis
2.1.3 construction of recombinant plasmid pCSN 44-G418-11. Beta. M291/365/372
Recombination reaction system (recommended preparation on ice, each component needs to be mixed evenly before use)
In vitro recombination reaction: and (3) placing the prepared recombination reaction system on a metal bath at 50 ℃ for reaction for 20min. Cooling on ice for 5min.
Recombinant product transformation and validation: the recombinant product is transferred into JM109 to be competent in large intestine, the transformant is picked up in an LB test tube, the plasmid is extracted after shaking for 8-12h in a shaking table 200r at 37 ℃, and two bands of 1.8kb and 6.4kb are confirmed by enzyme digestion verification of SacI and NcoI, so that the recombinant plasmid pCSN44-G418-11 beta m291/365/372 is successfully constructed, and the vector construction is shown in figure 6. 2.2 construction of recombinant plasmid pAMA 1-G418-11. Beta. M291/365/372
2.2.1 construction of vector backbone containing AMA1 sequences
The recombinant plasmid pAMA1 constructed in the earlier stage of the laboratory is digested with Mlu I single cleavage site to linearize, and the recombinant plasmid pAMA1 is dephosphorylated with Taq polymerase to blunt ends to prevent self-religation;
and (3) enzyme cutting system:
the reaction was carried out in a water bath at 37℃for 3 hours, and a 10kb band was detected by electrophoresis on 1.0% agarose gel.
2.2.2 construction of the fragment of interest
The 20bp homology arms at two ends of Mlu I enzyme cutting site of plasmid pAMA1 carrier and the forward and reverse PCR primer row PCR amplification of target fragment G418-11 beta m291/365/372 are designed, and the primers are synthesized by Beijing Hua big gene company.
Primer name primer base sequence
HR-11βm-F GACGGCCAGTGCCAAGCTTACCGGCCGGTGTAAATAACG
HR-11βm-R GAACATATACTGGGCCCGGGTCGATACCGTCGACAGAAG
PCR reaction conditions:
the PCR product was confirmed to be correct by 1.0% agarose gel electrophoresis
2.2.3 construction of the recombinant plasmid pAMA 1-G418-11. Beta. M291/365/372
Recombination reaction system (recommended preparation on ice, each component needs to be mixed evenly before use)
In vitro recombination reaction: and (3) placing the prepared recombination reaction system on a metal bath at 50 ℃ for reaction for 20min. Cooling on ice for 5min.
Recombinant product transformation and validation: the recombinant product is transformed into JM109 to be competent in large intestine, the transformant is picked up in an LB test tube, the plasmid is extracted after shaking for 8-12h by a shaking table 200r at 37 ℃, two bands of 5.2kb and 10kb are confirmed after enzyme digestion verification by Not I and Bgl I, the successful construction of the recombinant plasmid pAMA1-G418-11 beta m291/365/372 is proved, and the construction of the expression vector is shown in figure 7.
EXAMPLE 3 construction and functional evaluation of C11 beta-hydroxylase mutant T291Y/M365A/A372F recombinant Aspergillus ochraceus
3.1 cultivation of Aspergillus ochraceus and preparation of spore suspension
Inoculating aspergillus ochraceus spores to PDA slant culture medium, and culturing for 3-5 days at constant temperature in a 28 ℃ incubator. After the spores are ripe, a part of PDA inclined plane growing with Aspergillus ochraceus spores is put into 4 ℃ for storage for standby. The other part is washed by sterile water to remove conidium, the count of a blood cell counting plate is carried out, and the spore suspension is regulated to a certain concentration by sterile water for standby.
3.2 preparation of Aspergillus ochraceus protoplast
Taking 2% concentration as 10 6 A single/mL Aspergillus ochraceus spore suspension was inoculated into 50mL YPD liquid medium, and the spores were shaken on a shaking table at 28℃for 20h until they began to lyse as small rice grains. The composition of the lysate is as follows: 5mL system (1M sorbitol, 3.5% cellulase, 3.5% snailase and 2% muramidase)
3.3 collection of Aspergillus ochraceus protoplasts
When enough Aspergillus ochraceus protoplast is released, the mycelium which is not completely cracked is removed by filtering with 4 layers of gauze, and a mixed solution of protoplast is obtained. Centrifuging at 4deg.C, 3000rpm for 10min by a high-speed low-temperature centrifuge;
gently remove supernatant, gently resuspend with 10mL of prepared STC solution, 4 ℃,4000rpm,10min;
gently decanting the supernatant, re-suspending 2 times with 10mL of 0.6M KCl-STC buffer, 4 ℃,5000rpm, and centrifuging for 10min;
gently pipetting the supernatant, adding 100 μLSTC buffer, adjusting the protoplast concentration with 0.6M KCl-STC buffer to > 10% of the collected Aspergillus ochraceus protoplast concentration by microscopic examination of the plate under an optical microscope 8 Split charging and preserving 100 mu L of each/mL
3.4 determination of minimal inhibitory concentration of geneticin G418 on directed knockout of CYP68J5 A.ochraceus
Washing Aspergillus ochraceus spores cultured for 6d with sterile water from PDA slant, filtering with 6 layers of gauze, scattering with sterilized glass beads, counting with a blood cell counting plate, and diluting with sterile water to 10 7 And each mL. 100. Mu.L of the spore suspension was applied to PDA plates containing G418 geneticin sulfate (at concentrations of 100, 200, 300. Mu.g/mL, respectively). The cells were incubated at 28℃for 5d, and the results were observed. Each concentration was repeated three times.
The experimental results show that: g418 has a large influence on the growth of Aspergillus ochraceus, and within a certain range, the mortality of Aspergillus ochraceus increases with the increase of hygromycin B concentration. When the concentration is 100 mug/mL, the bacterial growth is slow; when the concentration is 200 mug/mL, the growth of the thalli is obviously inhibited; at a concentration of 300. Mu.g/mL, aspergillus ochraceus is completely incapable of growing, so that the minimum inhibitory concentration of G418 on Aspergillus ochraceus was finally determined to be 300. Mu.g/mL.
3.5 transformation of recombinant Aspergillus ochraceus protoplasts
Adding 3-5 mug recombinant plasmid pAMA1-G418-11 beta m291/365/372 into protoplast with concentration higher than 108 per mL, and ice-bathing for 30min;
adding 1.5mL 60% PEG4000-STC buffer solution, shaking at the same time, and standing at room temperature for 15min;
5mL of TB3 solution is added, and the mixture is placed at 28 ℃ for 100rpm and 18 to 20 hours, and then the multi-core cell wall is regenerated; observing cell walls regenerated by protoplasts by a common optical microscope, and distinguishing the cell walls formed by hyphae; centrifuging at 4000rpm for 8-10min by a low-temperature high-speed centrifuge;
removing supernatant, plating on a PDA screening plate with G418 concentration of 0.1mg/mL, and taking PDA non-antibody culture medium as a control;
after 5-7d, the transformant grows out and the passage is verified.
3.6 verification of recombinant Aspergillus ochraceus Positive transformants
The colony of the transformant is shown in FIG. 8, 5 normal phenotype transformants are randomly picked, and the genome DNA thereof is extracted for PCR verification, and the primer design is as follows:
primer name primer base sequence
G-F GCAGACAGGAACGAGGAC test
G-R GCATTGCAGATGAGCTGTATC test
PCR reaction system:
PCR reaction conditions:
as a result, as shown in FIG. 9, 4 target bands of 1.2kb containing the selection marker G418 were amplified, and the false positivity of the transformant was low, which proved that the protoplast transformation method was a very effective method for transgenesis of Aspergillus ochraceus.
3.7 evaluation of fermentation transformation of recombinant Aspergillus ochraceus Ao-11. Beta. M291/365/372
The feeding amount of the substrate RS is 1g/L, the recombinant Aspergillus ochraceus of the C11 beta-hydroxylase mutant T291Y/M365A/A372F is subjected to RS steroid conversion experiments, the spore suspension is subjected to shaking table oscillation at 30 ℃ for 24 hours, the substrate is fed, the fermentation conversion is carried out for 72 hours, the sample is taken, and the supernatant is extracted by ethyl acetate. Qualitative analysis of the product by thin layer chromatography revealed that mutant 291Y/M365A/A372F was significantly less by-product than the wild type gene; HPLC high performance liquid chromatography detection analysis shows that compared with the HC yield of 59.7% of the C11 beta gene wild type, the HC yield of the recombinant Aspergillus ochraceus mutant T291Y/M365A/A372F can reach 77.2%.
Example 4 Process set up for converting recombinant Aspergillus ochraceus Ao-11. Beta. M291/365/372 to RS for HC production
4.1 Effect of substrate solvents on steroid conversion
In order to improve the conversion efficiency of the substrate, the conversion rate of the substrate RS in solvents such as acetone, methanol, ethanol, chloroform, etc. was studied in consideration of the solubility of the substrate RS. Methanol is selected as a substrate solvent from the viewpoints of comprehensive polarity, conversion rate of RS, HC yield, economic cost and safety.
4.2 Effect of substrate concentration on steroid conversion
The steroid conversion capability of the recombinant strain under different feeding concentrations is studied, and the conversion rate of the recombinant strain under substrate concentrations of 1g/L, 1.5g/L, 2g/L, 2.5g/L, 3g/L, 3.5g/L and 4g/L for 72 hours is studied. The recombinant strain has obviously higher conversion rate than the wild strain when the substrate concentration is 3g/L, so that the RS feeding concentration of 3g/L is selected.
4.3 Effect of the inoculum size of the cells on steroid conversion
Collection 10 7 Each mL of the recombinant Aspergillus ochraceus spore suspension is inoculated into 250mL shake flasks with YPD medium liquid loading amount of 50mL according to the inoculum size of 0.5%, 1%, 1.5%, 2% and 2.5% for fermentation conversion. When the inoculation amount is more than 1%, the concentration of the thallus of aspergillus ochraceus is too large, and the mycelium is too large and sticky to rotate. Thus, an inoculum size of 1% was selected.
4.4 Effect of Tween80 at different concentrations on steroid conversion
Tween80 is a very widely used surfactant, which is widely used to increase the solubility of steroid substrates. To study the effect of Tween80 on RS conversion, the invention studies the conversion rate of the recombinant Aspergillus ochraceus Ao-11 beta m291/365/372 for 72h substrate RS under different concentrations of Tween 80. The feeding concentration of RS is 3g/L, and Tween80 with different concentrations is respectively fed: 0g/L, 0.5g/L, 1.0g/L, 1.5g/L, 2.0g/L. Sampling detection is carried out after each 12h of conversion, and Tween80 with the concentration of 1.5g/L is finally selected for fermentation conversion.
4.5 Effect of Aspergillus ochraceus recombinant bacterium transfer algebra on steroid transformation
The recombinant plasmid of the C11β -hydroxylase mutant is constructed on a plasmid containing an AMA1 sequence and a G418 selection marker, so that the stability of Aspergillus ochraceus is greatly improved, and the genetic stability of the strain is a very important aspect for investigating the characteristics of industrial strains. The stability of the hydroxylation activity of the recombinant strain in the process of transferring 30 generations of non-resistance inclined planes is researched, a substrate fermentation experiment is carried out on each 5-generation strain, and the conversion condition is 3g/L substrate concentration; 1.5g/L Tween80 was transformed for 72h. The strain can maintain the initial hydroxylation capacity, and the recombinant engineering bacteria have excellent genetic stability.
4.6 analysis of steroid conversion of recombinant Aspergillus ochraceus Ao-11. Beta. M291/365/372 at 3g/L substrate dosage
According to the optimization of the conditions, the method establishes that the concentration of RS is dissolved to 3g/L by taking methanol as a substrate solvent, 10 7 Under the process conditions that the inoculation amount of the recombinant aspergillus ochraceus spore suspension is 1% and the concentration of tween80 is 1.5g/L, the recombinant aspergillus ochraceus Ao-11 beta m291/365/372 is used for converting RS, sampling is carried out at 48 hours, 72 hours and 96 hours, the yield of the product HC obtained after fermentation conversion for 72 hours reaches 78%, and the statistical result is shown in figure 10.
The Aspergillus ochraceus has high hydroxylation activity and is widely used in industrial production, and the invention can over-express the C11 beta-hydroxylase CYP5103B6 mutant T291Y/M365A/A372F derived from the Curvularia lunata in the Aspergillus ochraceus strain lacking 11 alpha-hydroxylase CYP68J5, so that the obtained Aspergillus ochraceus recombinant strain can efficiently convert the substrate 11-deoxycortisol to generate hydrocortisone. The feeding amount of 11-deoxycortisol is 3g/L, the conversion is carried out for 72 hours, and the yield of the product hydrocortisone is 78%. The invention provides valuable industrial strains and technical methods for researching and developing the efficient C11 beta-hydroxylation 11-deoxycortisol to produce hydrocortisone.
The above examples merely illustrate several embodiments of the present invention, but are not intended to limit the present invention. It should be noted that modifications to the embodiments described above may be made by any person skilled in the art without departing from the spirit and scope of the present invention. Accordingly, the scope of the invention should be determined by the following claims.

Claims (4)

  1. C11β -hydroxylase mutant T291Y/M365A/a372F characterized in that the amino acid sequence of said mutant is as set forth in SEQ ID NO:2, mutating on the basis of the sequence shown in 2; namely, the 291 th, 365 th and 372 nd amino acids of the mutant T291Y/M365A/A372F are mutated together.
  2. 2. The expression of the mutant according to claim 1 is driven by a 1.2kb sequence promoter upstream of the ORF of the A.ochraceus 11. Alpha. -hydroxylase gene CYP68J 5.
  3. 3. Recombinant plasmid transformed by aspergillus ochraceus protoplast is constructed for expression in a vector containing the AMA1 sequence.
  4. 4. The use of a c11β -hydroxylase mutant T291Y/M365A/a372F as defined in claim 1 for industrial conversion of 11-deoxycortisol to hydrocortisone; the method is characterized in that the hydroxylation specificity is improved and byproducts are obviously reduced when the C11 beta-hydroxylase mutant T291Y/M365A/A372F converts steroid 11-deoxycortisol to hydrocortisone.
CN202310000666.6A 2023-01-03 2023-01-03 11 beta-hydroxylation recombinant filamentous fungi for efficiently synthesizing hydrocortisone and application thereof Pending CN116891835A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310000666.6A CN116891835A (en) 2023-01-03 2023-01-03 11 beta-hydroxylation recombinant filamentous fungi for efficiently synthesizing hydrocortisone and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310000666.6A CN116891835A (en) 2023-01-03 2023-01-03 11 beta-hydroxylation recombinant filamentous fungi for efficiently synthesizing hydrocortisone and application thereof

Publications (1)

Publication Number Publication Date
CN116891835A true CN116891835A (en) 2023-10-17

Family

ID=88313896

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310000666.6A Pending CN116891835A (en) 2023-01-03 2023-01-03 11 beta-hydroxylation recombinant filamentous fungi for efficiently synthesizing hydrocortisone and application thereof

Country Status (1)

Country Link
CN (1) CN116891835A (en)

Similar Documents

Publication Publication Date Title
CN109536525B (en) A kind of Dunaliella salina chloroplast homologous recombination empty carrier and its application
US9982269B2 (en) Mortierella alpine uracil auxotroph with URA5 gene knocked out through homologous recombination, and construction method thereof
US10612007B2 (en) Method for increasing citric acid production by Aspergillus niger fermentation
CN109161559A (en) A kind of building and application of efficient streptomyces gene group simplified system
CN105200078A (en) Aspergillus niger gene knockout method
CN112280700A (en) Acetic acid and formic acid resistant fermentation strain and construction method thereof
CN116891835A (en) 11 beta-hydroxylation recombinant filamentous fungi for efficiently synthesizing hydrocortisone and application thereof
US20210309982A1 (en) Materials and methods for creating strains of saccharomyces cerevisiae that exhibit an increased ability to ferment oligosaccharides into ethanol
CN110684795A (en) Construction method of monascus purpureus comp50904_ c4 gene overexpression strain
CN110628788A (en) Construction method of monascus purpureus comp51725_ c0 gene overexpression strain
JPWO2020045472A1 (en) Trichoderma Riesay mutant strain and method for producing protein using it
CN113846111B (en) Construction method and application of monascus purpureus comp53355_c10 gene overexpression strain
CN112359043B (en) CRISPR/Cas9 vector applicable to phomopsis FS508 and construction method and application thereof
CN114525215A (en) Recombinant strain for producing terpenoid, construction method thereof, method for producing terpenoid through fermentation and application of recombinant strain
CN109370969B (en) Application of recombinant Klebsiella in preparation of 1, 3-propylene glycol
CN109161565B (en) Method for producing ethanol by using whey
CN113122461A (en) Single cell protein producing strain and its application
CN114507684B (en) Method for inhibiting target gene expression in Mediterranean salt-rich bacteria
CN108611283B (en) Method for obtaining thermophilic fungus positive transformant
CN114854607B (en) High-temperature-resistant saccharomyces cerevisiae, fermenting agent, application of high-temperature-resistant saccharomyces cerevisiae and fermenting agent, and ethanol production method
CN109370972A (en) A kind of acetobacter engineering bacteria and its application
CN117327594A (en) Construction of recombinant aspergillus ochraceus strain for efficiently preparing 14 alpha-hydroxy progesterone
CN114645009B (en) Fructokinase-disabled cyanobacteria and its use for secretion and production of fructose
CN109536397B (en) Genetic engineering saccharomyces cerevisiae and preparation method and application thereof
CN113025642B (en) Construct for recombinant expression of saccharifying enzyme and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication