CN116875721B

CN116875721B - Application of cfDNA of cryptococcus in diagnosis of cryptococcus infection

Info

Publication number: CN116875721B
Application number: CN202211648118.6A
Authority: CN
Inventors: 李征途; 叶枫; 王熙栋; 李少强; 邱晔; 占扬清; 王彦
Original assignee: Guangzhou Institute Of Respiratory Health; First Affiliated Hospital of Guangzhou Medical University
Current assignee: Guangzhou Institute Of Respiratory Health; First Affiliated Hospital of Guangzhou Medical University
Priority date: 2022-12-21
Filing date: 2022-12-21
Publication date: 2024-03-19
Anticipated expiration: 2042-12-21
Also published as: CN116875721A

Abstract

The invention relates to application of cfDNA of cryptococcus in diagnosing cryptococcus infection, and relates to the technical fields of biotechnology and medicine. Use of a cfDNA sequence of cryptococcus selected from the following regions cnag_09001-09012cytochrome c oxidase subunit II for the development and/or preparation of a product for diagnosing cryptococcus infection. The cfDNA sequence of the region is used as a target sequence, has the advantages of stable expression and good repeatability, can be used for diagnosing cryptococcosis, and has high sensitivity to non-disseminated cryptococcosis.

Description

Application of cfDNA of cryptococcus in diagnosis of cryptococcus infection

Technical Field

The invention relates to the technical field of biotechnology and medicine, in particular to application of cfDNA of cryptococcus in diagnosing cryptococcus infection.

Background

In a retrospective analysis of our country, more than 60% of cases are detected in adults with normal immune systems. Another, less good, phenomenon is that studies have shown that lower respiratory tract fungus colonization is also achieved in healthy individuals. The onset of the disease is often associated with influenza, tuberculosis and severe pneumonia, and because the secrecy and the progress speed of the onset of the disease are often difficult for a clinician to make a correct judgment in a short time, invasive mycosis in the ICU is the disease with the highest misdiagnosis rate, and the prognosis of a patient is seriously influenced. Cryptococcosis alone is probably not the greatest difficulty, however invasive features determine its high spread in the body, approaching 70% of cryptococcosis patients presenting with symptoms of cryptococcosis meningitis. The spectrum of fungal diseases found in critically ill patients and immunocompetent patients is expanding, the mortality rate of cryptococcosis pneumoconiosis can reach 55%, and the status of clinical diagnosis is also becoming more important.

cfDNA (cell free DNA) refers to partially degraded endogenous DNA of the body, which is dissociated outside the cells, mainly in blood, urine or other body fluids. Absolute quantification of cfDNA concentration is a novel biomarker, and has great application value in molecular biological detection. In the past research, cfDNA has been proved to have the effects of early and definite diagnosis and disease monitoring on autoimmune diseases, tumors and the like. However, since cfDNA is a degraded DNA fragment found in the blood of patients, on the one hand, extraction of cfDNA from whole blood and post-detection remains a significant challenge. On the other hand, detection using conventional detection methods such as ELISA or multi-well plate sandwich immunoassays requires large amounts of samples and expensive reagents, which require manipulation by specialized laboratory personnel. Therefore, the application of cfDNA in the field of medical diagnosis is limited.

Disclosure of Invention

In view of the above problems, the present invention provides an application of cfDNA of cryptococcus in diagnosing cryptococcus infection, which can be used for diagnosing cryptococcus disease, and has high sensitivity to non-disseminated cryptococcus disease.

In order to achieve the above object, the present invention provides the use of a cfDNA sequence of cryptococcus in the development and/or preparation of a product for diagnosing cryptococcus infection, said cfDNA sequence being selected from the following regions: cnag_09001-09012cytochrome coxidase subunit II.

The cfDNA sequence of the region is used as a target sequence, has the advantages of stable expression and good repeatability, and can be used for diagnosing cryptococcosis. cfDNA sequences are selected from the following regions: cnag_09001-09012cytochrome c oxidase subunit II (Cryptococcus neoformans var. Grupii H99).

In one embodiment, the cfDNA sequence is selected from: SEQ ID NO:1-7.

The present inventors found in the research that, in the current PCR scheme for detecting cryptococcus in human body, there is a major disadvantage that the length of the nucleic acid sequence of the detection sample is required to be more than 500bp, so that the tissue specimen or BALF (bronchoalveolar lavage fluid) specimen is selected as the biological sample for detection in the conventional detection, but the wound of the person to be detected is larger, however, if the wound of the person to be detected is to be reduced, the peripheral blood is required to be the biological sample, but the exogenous nucleic acid sequence with the nucleic acid fragment length being so complete cannot exist in the blood, and the current PCR scheme is difficult to obtain the accurate cryptococcus diagnosis result for the blood specimen. Thus, current PCR methods can only detect patients with disseminated cryptococcosis with eubacteremia that are more severe. The inventors performed primer capture design on the sequence shown in CNAG_09001-09012cytochrome c oxidase subunit II (Cryptococcus neoformans var. Grubii H99) to obtain the sequence shown in SEQ ID NO:1-7, the length of the sequences is about 100-130bp, the sequences are short nucleic acid sequence fragments, the sequences are widely applied to the blood circulation of human bodies, the detection sensitivity is high, the sampling is relatively noninvasive, the diseases in the human bodies can be reflected in the early stage of cryptococcus infection, and the sequences have great value as target sequences for early diagnosis. Meanwhile, cfDNA is generated after cryptococcus infection of a host, and has a wide application prospect in the aspects of identifying cryptococcus infection and colonization/pollution.

In one embodiment, the cfDNA sequence is selected from: SEQ ID NO: 1. SEQ ID NO:7.

the invention also provides an amplification primer set for amplifying the cfDNA sequence of the cryptococcus.

In one embodiment, the amplification primer set includes a forward amplification primer, a reverse amplification primer, and a signal reporting probe.

In one embodiment, the forward amplification primer in the PCR amplification reagent is selected from the group consisting of: SEQ ID NO:8-11; the reverse amplification primer in the PCR amplification reagent is selected from the group consisting of: SEQ ID NO:12-15.

In one embodiment, the forward amplification primer in the PCR amplification reagent is selected from the group consisting of: SEQ ID NO: 8. SEQ ID NO:11.

in one embodiment, the reverse amplification primer in the PCR amplification reagent is selected from the group consisting of: SEQ ID NO: 12. SEQ ID NO:15.

in one embodiment, the sequence of the signal reporting probe is selected from the group consisting of: SEQ ID NO: 16. SEQ ID NO:17.

the invention also provides a kit for diagnosing cryptococcus infection, which comprises the amplification primer group, and a diagnosis result is obtained by detecting the cryptococcus cfDNA in peripheral blood of a host.

The inventors found that the sequence fragment of cfDNA was small during the course of the study, and it was difficult to determine the specific fragment thereof by conventional means, whereas pcfda (plasma cell-free DNA) was a later classified population in cfDNA, with sensitivity of cfDNA detection and specificity against different pathogens. Although the existing cfDNA detection means is more backward, the specimen consumption is large, the purity of the effective components is low, the process flow is complicated and expensive, and the method is not suitable for large-scale clinical detection. However, in earlier studies, it was found that a manual single purification test of PcfDNA could benefit up to 31.9% of suspected fungal infected persons. Therefore, the inventor selects peripheral blood as a biological sample for extracting cfDNA, determines the nucleic acid fragments and abundance of cryptococcus entering the peripheral blood after being attacked by immune cells in a human body by a second generation sequencing method, obtains a specific cfDNA sequence as a target sequence, designs a forward amplification primer, a reverse amplification primer and a signal reporting probe corresponding to the specific cfDNA sequence, and forms a kit for diagnosing cryptococcus infection.

In one embodiment, the cryptococcosis infection is non-disseminated cryptococcosis.

Compared with the prior art, the invention has the following beneficial effects:

use of a cfDNA sequence of cryptococcus according to the invention selected from cnag_09001-09012cytochrome c oxidase subunit II for the development and/or preparation of a product for diagnosing cryptococcus infection. The cfDNA sequence of the region is used as a target sequence, has the advantages of stable expression and good repeatability, can be used for diagnosing cryptococcosis, and has high sensitivity for diagnosing non-disseminated cryptococcosis.

Drawings

FIG. 1 is a flow chart of the screening of example 1 to yield CNAG_09001-09012cytochrome c oxidase subunit II (Cryptococcus neoformans var. Grupii H99);

FIG. 2 is a graph showing the fragment abundance obtained by sequencing Cryptococcus cfDNA after in vitro mock infection in example 1, wherein series 1 is 3×10 ⁷ High concentration cryptococcus intervention/ml human immune cells, series 2 is 3 x 10 ⁶ Medium concentration Cryptococcus intervention in human immune cells/ml, series 3 is 3 x 10 ⁵ Low concentration cryptococcus per ml intervenes in human immune cells;

FIG. 3 is a graph of fragment abundance results obtained by sequencing Cryptococcus cfDNA after in vitro mock infection in example 1;

FIG. 4 is a graph showing the results of analysis of amplification efficiencies of the amplification primer set No. 1, the amplification primer set No. 2, the positive control set, and the negative control set in the experimental example;

FIG. 5 is a graph showing the results of amplification efficiency of the amplification primer set No. 1 in experimental example;

FIG. 6 is a graph showing the results of amplification efficiency of the amplification primer set No. 2 in experimental example.

Detailed Description

In order that the invention may be readily understood, a more complete description of the invention will be rendered by reference to the appended drawings. Preferred embodiments of the present invention are shown in the drawings. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

Reagents, materials, equipment sources:

Cell-Free DNA Kit II magnetic bead method extracts cfDNA Kit; aamp DNAMicrobiome Kit host-derived nucleic acid eluting kit; an IlluminaNextSeq 2000 sequencer; />Ultra ^TM II DNA Library Prep Kit for/>Human immune cell mixtures, cryptococcus H99 strain (ATCC); bunnyTube ^TM cfDNA nucleic acid sample preservation tube; bunnyTube ^TM cfDNA preservation solution; takara qPCR reagent; mx3005P real-time PCR system.

The reagents, materials and equipment used in the examples are all commercially available sources unless otherwise specified; the experimental methods are all routine experimental methods in the field unless specified.

Example 1

Screening to obtain the functional localization of cryptococcus mitochondrial genes 09000-09012.

The flow of screening to obtain cryptococcus mitochondrial genes 09000-09012 is shown in figure 1, and the specific operation is as follows:

1. and establishing a cryptococcus infection model of the in vitro immune cells.

1. Materials: human immune cell mixture, cryptococcus H99 strain (ATCC), PRMI1640 medium (GIBCO), tertiary australian foetal calf serum (GIBCO).

2. The experimental method comprises the following steps: immune cells are extracted from whole blood of healthy people, and the total concentration of the cells reaches 3 x 10 ⁶ Per ml, adding Cryptococcus H99 cells at 3.multidot.10, respectively ⁷ High concentration cryptococcus per ml, 3 x 10 ⁶ Medium concentration cryptococcus, 3 x 10 per ml ⁵ Low concentration of cryptococcus per ml intervenes in human immunocytes, and supernatant samples were taken after 2,4,6,8, 10 hours of co-culture, respectively.

2. Sample collection and purification.

1. Materials: the cfDNA preservation solution comprises a cfDNA preservation solution,Cell-Free DNAKit II magnetic bead method extracts cfDNA kit, aamp DNAMicrobiome Kit host source nucleic acid eluting kit.

2. The experimental method comprises the following steps:

(1) Extracting cfDNA from the supernatant cfDNA of the co-culture product by using a magnetic bead method, purifying the cfDNA by using a cfDNA purifying kit, and eluting host-derived nucleic acid fragments in the cfDNA by using a host-derived nucleic acid eluting kit.

(2) Purified cfDNA was stored in cfDNA preservation solution at 2-8 ℃ and transported to standardized and approved second generation sequencing platform laboratories, microposity, inc, all samples were stored at 2-8 ℃ for 3 days to complete sequencing work.

3. Sequencing of cfDNA.

1. Materials:Ultra ^TM II DNALibrary Prep Kit for />IlluminaNextSeq 2000 sequencer.

2. The experimental method comprises the following steps:

(1) Constructing a cDNA library: usingUltra ^TM II DNALibrary Prep Kit forDNA library was constructed by fragmenting, end repair, adaptor ligation and PCR amplification. Quality detection, including DNA concentration detection, agarose gel electrophoresis and fragment length detection, is used for completing library construction.

(2) Sequencing: qualified libraries were pooled and sequenced using Illumina platform to prepare and sequence DNA Nanospheres (DNBs).

4. Sequencing data analysis.

1. Analytical methods.

(1) The raw sequencing sequences (Sequenced Reads) or raw Reads obtained by sequencing contain low quality Reads with adaptors. In order to ensure the quality of information analysis, the raw reads must be filtered to obtain clean reads, and subsequent analysis is based on the clean reads. The conditions for data processing are as follows: removing the reads pair with the adapter; when the content of N contained in the single-ended sequencing read exceeds 10% of the length proportion of the strip, the pair of paired reads needs to be removed; when the low quality (Q.ltoreq.5) bases contained in a single-ended sequencing read exceeds 50% of the length proportion of the strip, the pair of paired reads needs to be removed.

(2) And (3) genome index, comparing with the nucleic acid sequences of all species, obtaining the corresponding position of the cfDNA fragment corresponding to the cryptococcus gene by blast, removing repeated and fragmented nucleic acid fragments, finally screening out the cfDNA fragment with the first 500 cfDNA fragments of the expression quantity and the corresponding genome positions, and outputting a result.

2. And analyzing the result.

(1) The cryptococcus cfDNA sequence of TOP500 was obtained through restriction of the size of the cfDNA nucleic acid sequence (40-166 bp) and the de-hosting of endogenous fragments and bioinformatics analysisThe sequencing was performed in 2 steps, the 1 st step was performed by using high concentration cryptococcus, medium concentration cryptococcus and low concentration cryptococcus to intervene in human immune cells, and then the sequencing was performed, the results are shown in FIG. 2, wherein the series 1 is 3×10 ⁷ High concentration cryptococcus intervention/ml human immune cells, series 2 is 3 x 10 ⁶ Medium concentration Cryptococcus intervention in human immune cells/ml, series 3 is 3 x 10 ⁵ Low concentration Cryptococcus per ml intervenes in human immune cells. The human immune cells were intervened with cryptococcus mesogenic at 2 nd time, then sequenced, the sequencing result of 1 st time was rechecked, and the sequencing result of 2 nd time is shown in fig. 3. Some of the nucleic acid fragments found in the cryptococcus gene in the two sequencing were higher in abundance and potential for cfDNA primer production are shown in fig. 2 and 3.

(2) Through analysis of the abundance of the gene, the locked cryptococcus mitochondrial gene 09000-09012, i.e., cnag_09001-09012cytochrome c oxidase subunit II (Cryptococcus neoformans var. Grubii H99), which appears at the red frame of fig. 2 and the red frame of fig. 3 and is predominantly in the repeated sequencing, is stable in expression in sequencing, and it is seen that the above locked cryptococcus mitochondrial gene 09000-09012 is present regardless of the concentration of cryptococcus intervention and is located in the conserved sequence of the cryptococcus mitochondrial gene.

5. And (5) designing PCR primers.

The capture design of the primer is carried out according to the cfDNA fragment with high expression in CNAG_09001-09012 obtained by the early sequencing. The specific design principle is as follows:

the primer length is designed to be 15-30 base;

the GC content of the primer is between 40 and 60 percent, and the Tm value is close to 72 ℃;

the 3 '-end of the primer avoids the 3 rd position of a codon, the 3' -end of the primer is preferably T, and bases are randomly distributed;

the primer itself should not have a complementary sequence between the primers;

the delta G values at different positions can be separated by Oligo6 software, and the delta G values at the 5 'end and the middle of the primer are higher than the delta G value at the 3' end;

the single strand of the amplified product cannot form a secondary structure;

and (3) carrying out gene chip screening on the generated primer group to finally obtain the primer sequence shown as SEQ ID NO:1-7, the target sequence shown in SEQ id no:8-11, and the forward amplification primer set forth in SEQ ID NO:12-15, a reverse amplification primer set forth in SEQ ID NO:16-17, and in particular, the following table, wherein the primer sequences having high compliance with the above screening principle are selected, preferably a forward amplification primer No. 1, a reverse amplification primer No. 1, a signal reporting probe No. 1, a forward amplification primer No. 2, a reverse amplification primer No. 2, a signal reporting probe No. 2 are obtained. And then, screening the primer in the sequencing to obtain the primer with high cfDNA abundance, and performing next actual verification.

TABLE 1 screening results for primer groups

The sequences shown in the numbers in the above table are specifically as follows:

CGAGGACGAACTATTGGTGTTACAGGAGCTCACATCATTACAACAGGATGTCTAATGACATCAGCAGCTCTATCTATTGTAGCTTTCTATGAAGTTGGTCTATCAGGATCACC(SEQ ID NO：1)CGAGGACGAACTATTGGTGTTACAGGAGCTCACATCATTACAACAGGATGTCTAATGACATCAGCAGCTCTATCTATTGTAGCTTTCTATGAAGTTGGTCTATCAGGATCAC(SEQ ID NO：2)

ACGAGGACGAACTATTGGTGTTACAGGAGCTCACATCATTACAACAGGATGTCTAATGACATCAGCAGCTCTATCTATTGTAGCTTTCTATGAAGTTGGTCTATCAGGATCAC(SEQ ID NO：3)

ACGAGGACGAACTATTGGTGTTACAGGAGCTCACATCATTACAACAGGATGTCTAATGACATCAGCAGCTCTATCTATTGTAGCTTTCTATGAAGTTGGTCTATCAGGATCACC(SEQ ID NO：4)

TACGAGGACGAACTATTGGTGTTACAGGAGCTCACATCATTACAACAGGATGTCTAATGACATCAGCAGCTCTATCTATTGTAGCTTTCTATGAAGTTGGTCTATCAGGATCAC(SEQ ID NO：5)

TACGAGGACGAACTATTGGTGTTACAGGAGCTCACATCATTACAACAGGATGTCTAATGACATCAGCAGCTCTATCTATTGTAGCTTTCTATGAAGTTGGTCTATCAGGATCACC(SEQ ID NO：6)

CAACACGCTGAAGAACCATTTGTAACAGTTGGGGCTATTGCAACTGCTGTATACTTTGGTTGGTTTGTAGTCCTACTACCAATTATTGGAATGCTAGAAAACACATCACTTGACGGTTCATCA(SEQ ID NO：7)

CGAGGACGAACTATTGGTGTTAC(SEQ ID NO：8)

ACGAGGACGAACTATTGGTGTTAC(SEQ ID NO：9)

TACGAGGACGAACTATTGGTGTTAC(SEQ ID NO：10)

CAACACGCTGAAGAACCATTTG(SEQ ID NO：11)

GGTGATCCTGATAGACCAACTTC(SEQ ID NO：12)GTGATCCTGATAGACCAACTTCATAG(SEQ ID NO：13)

GGTGATCCTGATAGACCAACTTCATAG(SEQ ID NO：14)

TGATGAACCGTCAAGTGATGTG(SEQ ID NO：15)

ACAGGATGTCTAATGACATCAGCAGC(SEQ ID NO：16)

AGTTGGGGCTATTGCAACTGCTGT(SEQ ID NO：17)

experimental example

The reliability of the cryptococcus cfDNA primer sequences obtained in example 1 was verified by qPCR.

1. Materials: qPCR reagent, comparative primer and probe, magnetic bead method cfDNA extraction and purification kit, 8 non-disseminated cryptococcus patient blood plasma. The method for obtaining the plasma comprises the following steps: blood was collected from the external elbow vein of 8 non-disseminated cryptococcosis patients, collected using EDTA anticoagulant tubes, and centrifuged within 24 hours to obtain patient plasma.

2. Experimental methods.

1. cfDNA extraction: the specific method for extracting cfDNA in the biological sample is operated according to the operating instructions of the cfDNA extraction and purification kit by the magnetic bead method.

2. And (5) PCR amplification.

The qPCR amplification primer sequence pairs and signal reporting probes corresponding to the target sequences (SEQ ID NO:1, SEQ ID NO: 7) obtained by the screening in example 1 were compared with the qPCR primers of the comparative example for diagnosis of non-disseminated cryptococcosis in the prior art.

The target sequence of the comparative example is shown in SEQ ID NO: 21.

TABLE 1 primer related information

The target sequences of the comparative examples are specifically shown below:

AGAACCATTGTGTGATACCTCTTTCTTGTACTTTGCCTTTGCTCTCCAAAACCAGTCGCGCCAAACTCCGATAAACACCAGAGGTTTGTGGC(SEQ ID NO：21)

amplification systems and conditions are shown in the following table.

TABLE 2 PCR amplification reaction System and conditions

Reaction system	μL
		PCR Mix	10
Primer F(5/10p)	0.2
		Primer R(5/10p)	0.2
Probe Taq	0.2
		ROXⅡ	0.2
DEPC water	7.2
		Stencil (ng/mu L)	2
Totalizing	20

3. And (5) data analysis.

After the data is taken off the machine, analysis is carried out according to the data curve, and the amplification results of all the groups are compared, so that the amplification efficiency of the 2 groups of amplification primer groups obtained in the example 1 is higher than that of the amplification primer groups of the comparative example.

The analysis results are shown in FIGS. 4, 5 and 6, and the positive control group in FIG. 4 is the comparative example in Table 1, and the negative control group is venous blood plasma of healthy persons obtained in the same manner as in step one of the experimental examples.

4. Experimental results.

The amplification efficiency of the amplification primer group No. 1 is found to be strong in cfDNA extracted from 8 non-disseminated cryptococcus patients participating in the experiment, and the CT value is 29 (shown in FIG. 5); the amplification efficiency of the amplification primer group No. 2 is moderate, the CT value is 35 (shown in figure 6), and the result is superior to that of the existing non-disseminated cryptococcus detection scheme.

The technical features of the above-described embodiments may be arbitrarily combined, and all possible combinations of the technical features in the above-described embodiments are not described for brevity of description, however, as long as there is no contradiction between the combinations of the technical features, they should be considered as the scope of the description.

The above examples illustrate only a few embodiments of the invention, which are described in detail and are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.

Claims

1. Use of a cfDNA sequence of cryptococcus selected from the group consisting of: SEQ ID NO: 1. SEQ ID NO:7.

2. an amplification primer set for amplifying the cfDNA sequence of cryptococcus of claim 1; the amplification primer set comprises a forward amplification primer, a reverse amplification primer and a signal reporting probe;

the forward amplification primer in the PCR amplification reagent is selected from the group consisting of: SEQ ID NO: 8. SEQ ID NO:11;

the reverse amplification primer in the PCR amplification reagent is selected from the group consisting of: SEQ ID NO: 12. SEQ ID NO:15;

the sequence of the signal reporting probe is selected from the group consisting of: SEQ ID NO: 16. SEQ ID NO:17.

3. a kit for diagnosing cryptococcus infection, comprising the amplification primer set of claim 2, wherein the diagnosis result is obtained by detecting cryptococcus cfDNA in the peripheral blood of a host.