CN116875694A

CN116875694A - Oral squamous carcinoma biomarker and application thereof

Info

Publication number: CN116875694A
Application number: CN202310861811.XA
Authority: CN
Inventors: 许铭炎; 邓小玲; 张峻羚
Original assignee: Xiamen Medical College Affiliated Stomatological Hospital
Current assignee: Xiamen Medical College Affiliated Stomatological Hospital
Priority date: 2023-07-13
Filing date: 2023-07-13
Publication date: 2023-10-13

Abstract

The invention discloses an oral squamous cell carcinoma biomarker and application thereof, belonging to the technical field of medicines, wherein LncRNA RP11-426A6.5 is adopted as a biomarker, and the oral squamous cell carcinoma can be diagnosed and/or prognosis by a reagent for detecting the biomarker. The LncRNA RP11-426A6.5 gene expression inhibitor is used for preparing medicines for treating oral squamous cell carcinoma. Specifically, the LncRNA RP11-426A6.5 gene expression inhibitor can inhibit the EMT process by down-regulating the LncRNA RP11-426A6.5 gene expression and inhibiting the RP11-426A6.5/EZH2/p-STAT3 signaling pathway, thereby inhibiting the proliferation and/or migration and/or invasion and/or colony formation of oral squamous cell carcinoma.

Description

Oral squamous carcinoma biomarker and application thereof

Technical Field

The invention belongs to the technical field of medicines, and particularly relates to an oral squamous carcinoma biomarker and application thereof.

Background

Oral squamous cell carcinoma (Oral Squamous Cell carcinoma, OSCC) generally originates from precancerous lesions of the oral mucosa, such as oral leukoplakia and the like. Common treatment methods are surgery, chemotherapy, radiotherapy, immunotherapy, nutrition treatment and the like, however, the current treatment methods cannot fully meet the demands of patients, patients with OSCC are asymptomatic in early stage, most patients are diagnosed when oral squamous cell carcinoma further progresses, and the 5-year survival rate of most patients is only 50% or even lower than 10% when the diagnosis is made. Tumor infiltration, lymph node metastasis and high local recurrence rates are the leading causes of death in OSCC patients.

Long non-coding RNAs (LncRNAs) refer to RNA molecules with base sequences longer than 200nt and not coding proteins, and play a specific role in the process of oral squamous cell carcinoma (Oral Squamous Cell Carcinoma, OSCC). Enhancer 2 (Enhancer of Zeste Homolog, EZH 2), a human Zeste homolog, has been shown to have a pro-cancerous effect in oral squamous carcinoma cells. The head and neck squamous cell carcinoma tissue LncRNA is obtained through screening through differential expression analysis and comparison of the head and neck squamous cell carcinoma tissue LncRNA in a TCGA database and a GEO database, and LncRNA RP11-426A6.5 with high head and neck squamous cell carcinoma specificity and high correlation with EZH2 is obtained, but the occurrence and development functions of the LncRNA RP11-426A6.5 in oral squamous cell carcinoma are not reported.

Disclosure of Invention

The invention aims to provide an oral squamous carcinoma biomarker and application thereof, so as to overcome at least one defect in the prior art.

To achieve the purpose, the invention adopts the following technical scheme:

the invention provides application of a reagent for detecting a biomarker in preparation of a product for diagnosing and/or prognosing oral squamous carcinoma, wherein the biomarker comprises LncRNA RP11-426A6.5.

Preferably, the biomarker further comprises EZH2 and/or STAT3.

Preferably, the reagents comprise reagents for detecting the expression level of the biomarker by sequencing techniques, nucleic acid hybridization techniques, nucleic acid amplification techniques.

Preferably, the agent is selected from: probes specifically recognizing LncRNA RP 11-426A6.5; or a primer for specifically amplifying LncRNA RP 11-426A6.5.

The invention also provides application of the LncRNA RP11-426A6.5 gene expression inhibitor in preparing a medicament for treating oral squamous cell carcinoma.

Preferably, the use of an inhibitor of LncRNA RP11-426A6.5 gene expression for the preparation of a medicament for inhibiting proliferation and/or migration and/or invasion and/or colony formation of squamous carcinoma cells of the oral cavity.

Preferably, the LncRNA RP11-426A6.5 gene expression inhibitor inhibits the progression of EMT by down-regulating LncRNA RP11-426A6.5 gene expression, thereby inhibiting oral squamous cell carcinoma proliferation and/or migration and/or invasion and/or colony formation.

Preferably, the LncRNA RP11-426A6.5 gene expression inhibitor inhibits the progression of EMT by down-regulating LncRNA RP11-426A6.5 gene expression, down-regulating EZH2 gene expression, inhibiting STAT3 activation, and thereby inhibiting oral squamous carcinoma cell proliferation and/or migration and/or invasion and/or colony formation.

Preferably, the LncRNA RP11-426A6.5 gene expression inhibitor can inhibit the EMT process by down-regulating LncRNA RP11-426A6.5 gene expression and down-regulating STAT3 gene expression, thereby inhibiting proliferation and/or migration and/or invasion and/or colony formation of oral squamous carcinoma cells.

Preferably, the LncRNA RP11-426A6.5 gene expression inhibitor inhibits the progression of EMT by down-regulating LncRNA RP11-426A6.5 gene expression and inhibiting RP11-426A6.5/EZH2/p-STAT3 signaling pathway, thereby inhibiting oral squamous carcinoma cell proliferation and/or migration and/or invasion and/or colony formation.

The invention also provides a pharmaceutical composition for treating oral squamous cell carcinoma, which comprises an LncRNA RP11-426A6.5 gene expression inhibitor.

The beneficial effects of the invention are as follows:

the LncRNA RP11-426A6.5 is adopted as a biomarker, and oral squamous cell carcinoma can be diagnosed and/or prognosis by detecting the biomarker. The LncRNA RP11-426A6.5 gene expression inhibitor is used for preparing medicines for treating oral squamous cell carcinoma. Specifically, the LncRNA RP11-426A6.5 gene expression inhibitor can inhibit the EMT process by down-regulating the LncRNA RP11-426A6.5 gene expression and inhibiting the RP11-426A6.5/EZH2/p-STAT3 signaling pathway, thereby inhibiting the proliferation and/or migration and/or invasion and/or colony formation of oral squamous cell carcinoma.

Drawings

FIG. 1 is a graph of scratch experiments after knockdown of RP11-426A6.5 in SAS and HSC3 of the present invention.

FIG. 2 is a graph of migration (matrigel free) and invasion (matrigel with matrigel) of Transwell experiments following knockdown of RP11-426A6.5 in SAS and HSC3 of the present invention.

FIG. 3 is a graph of scratch experiments following overexpression of RP11-426A6.5 in SAS and HSC3 of the present invention.

FIG. 4 is a graph of migration (matrigel-free) and invasion (matrigel-loaded) of Transwell experiments following overexpression of RP11-426A6.5 in SAS and HSC3 of the present invention.

FIG. 5 is a graph of the quantitative analysis of protein bands of the scratch assay of the invention after overexpression of RP11-426A6.5 in SAS cells and knock-down of EZH2 expression.

FIG. 6 is a graph showing quantitative analysis of protein bands from a transfer experiment (without matrigel) and an invasion experiment (with matrigel) after overexpression of RP11-426A6.5 in SAS cells and knock-down of EZH2 expression in the present invention.

FIG. 7 is a graph of Western Blotting detection results after overexpression of RP11-426A6.5 in SAS and HSC3 according to the present invention.

FIG. 8 is a graph showing changes in EMT-related indicator proteins in SAS and HSC3 cells knocked down with EZH2 according to the present invention.

FIG. 9 is a graph showing the change in tumor volume after injection of LV-Vector or LV-RP11-426A6.5 virus solution, respectively, into nude mice according to the present invention.

FIG. 10 is a graph of tumor tissue obtained by weighing and dissecting nude mice after being subcutaneously injected with LV-Vector or LV-RP11-426A6.5 virus solution, respectively, and sacrificed in accordance with the present invention.

FIG. 11 is a schematic diagram of the mechanism by which RP11-426A6.5 promotes oral squamous cell carcinoma invasion and metastasis.

Detailed Description

The invention will now be further described with reference to the drawings and detailed description.

The use of the reagent for detecting a biomarker provided in this example in the preparation of a product for diagnosing and/or prognosing oral squamous cell carcinoma, the biomarker comprising LncRNA RP11-426A6.5.

Wherein the biomarker further comprises EZH2 and/or STAT3.

Wherein the reagent comprises a reagent for detecting the expression level of the biomarker by a sequencing technology, a nucleic acid hybridization technology and a nucleic acid amplification technology. Specifically, the reagent is selected from: probes specifically recognizing LncRNA RP 11-426A6.5; or a primer for specifically amplifying LncRNA RP11-426A6.5.

The embodiment also provides application of the LncRNA RP11-426A6.5 gene expression inhibitor in preparing a medicament for treating oral squamous cell carcinoma. In particular to the application of LncRNA RP11-426A6.5 gene expression inhibitor in preparing medicaments for inhibiting proliferation and/or migration and/or invasion and/or colony formation of oral squamous carcinoma cells. Wherein, the LncRNA RP11-426A6.5 gene expression inhibitor can inhibit the EMT process by down-regulating the LncRNA RP11-426A6.5 gene expression, thereby inhibiting the proliferation and/or migration and/or invasion and/or colony formation of oral squamous carcinoma cells. The LncRNA RP11-426A6.5 gene expression inhibitor can inhibit the EMT process by down-regulating the LncRNA RP11-426A6.5 gene expression, down-regulating the EZH2 gene expression and inhibiting STAT3 activation, thereby inhibiting proliferation and/or migration and/or invasion and/or colony formation of oral squamous cell carcinoma cells. The LncRNA RP11-426A6.5 gene expression inhibitor can inhibit the EMT process by down-regulating the LncRNA RP11-426A6.5 gene expression and down-regulating the STAT3 gene expression, thereby inhibiting the proliferation and/or migration and/or invasion and/or colony formation of oral squamous carcinoma cells. Inhibitors of LncRNA RP11-426A6.5 gene expression inhibit EMT progression by down-regulating LncRNA RP11-426A6.5 gene expression and inhibiting RP11-426A6.5/EZH2/p-STAT3 signaling pathway, thereby inhibiting oral squamous cell carcinoma proliferation and/or migration and/or invasion and/or colony formation.

The embodiment also provides a pharmaceutical composition for treating oral squamous cell carcinoma, wherein the pharmaceutical composition comprises LncRNA RP11-426A6.5 gene expression inhibitor.

The invention firstly screens LncRNA RP11-426A6.5 with obvious high expression of head and neck squamous cell carcinoma from TCGA and GEO databases, and confirms that high level RP11-426A6.5 is closely related to rapid growth, high wettability and strong invasive transfer capacity of oral squamous cell carcinoma in vivo and in vitro, and the process is related to activation of epithelial-mesenchymal transition (EMT). In addition, it was demonstrated that its target protein histone H3 methyltransferase EZH2 is capable of activating the transcription factor STAT3 signaling pathway in oral squamous carcinoma cell lines, regulating p-STAT3, while EZH2 can bind directly and promote STAT3 methylation in intracellular and OSCC tissues. Based on this mechanism, EZH2 can activate STAT3 in classical/non-classical forms in oral squamous cell carcinoma, and participate in RP11-426A6.5 to promote the oral squamous cell carcinoma migration invasion pathway. Here, i will discuss in detail the mechanism by which RP11-426A6.5/EZH2/p-STAT3 promotes oral squamous carcinoma invasive metastasis by stimulating EMT.

1. Material preparation

1.1 cell and tissue chip sources:

human oral squamous carcinoma cell line SAS and HSC3 were purchased from JRCB cell bank (Japanese Cancer Research Resources Bank, JRCB) japan, human oral leukoplakia cell DOK from european cell bank ECACC (European Collection of Authenticated Cell Cultures, ECACC), and human oral squamous carcinoma tissue chip from sienna biotechnology limited.

1.2 experimental animals:

the 4-5 week old, 16-18g weight, SPF grade male nude mice purchased from Experimental animal technology Co., ltd. In Beijing Vietnam university were all bred in the experimental animal center.

2. Experimental method

2.1 cell culture:

2.1.1 preparation of Medium and pancreatin:

1. preparation of the culture medium: the filter is cleaned and sterilized, then placed on an intercellular operating platform, F12 culture medium powder is poured into one liter of ultrapure water half an hour in advance, 2.438g/L of NaHCO3 is added for uniform mixing, and 10% of fetal bovine serum is added for culturing SAS cells after filtration. DMEM medium can be used for HSC3 cell culture, and can be used for DOK cell culture after hydrocortisone (5 μg/mL) and L-glutamine (2 mM) are added in a certain proportion. 2. Preparation of pancreatin: the filter is cleaned and sterilized, placed on an operation table, connected with a suction pump, poured into the filter by one liter of pancreatin (2.5 g pancreatin plus 0.2g EDTA) which is uniformly mixed in advance, and can be packaged for use after being filtered.

2.1.2 cell resuscitation:

1. the cells frozen at-80 ℃ or in liquid nitrogen are rapidly taken out and placed in a water bath kettle with the temperature of 37 ℃ which is set in advance, and gently shaken to accelerate melting. 2. After the frozen stock solution is completely dissolved, the solution is centrifuged at 800rpm for 3min. 3. The supernatant was rapidly removed, 1mL of the corresponding complete medium was added, gently swirled and mixed, dropped into a 6cm dish, and finally placed in a 5% CO2 incubator at 37℃for cultivation. And observing the cell state after the cells are completely adhered for 12-24 hours, and continuously culturing by replacing fresh culture medium.

2.1.3 passage of cells:

1. when the cell fusion rate reaches 90% -100%, a good living space and required nutrients are provided for cells, and the cells can be passaged. Taking a 6cm dish as an example, the specific steps are as follows: the original culture medium in the culture dish is completely absorbed, 600 mu LPBS or pancreatin is added to thoroughly remove the original complete culture medium, so as to eliminate the influence of serum on pancreatin. 2.1 mL pancreatin was added, and the dish was placed in an incubator and allowed to stand for 5-6 minutes. 3. The dish was gently shaken to see if the cells were detached from the dish, and the microscope-assisted determination was used, after which 1mL of complete medium was added to terminate digestion. 4. The mixture was added to a 4mL EP tube and placed in a centrifuge at 800rpm for centrifugation for 3min. 5. The supernatant was removed, 1mL of complete medium was added, the mixture was blown and mixed evenly, and the mixture was equally divided into two 6cm dishes, and the dishes were gently shaken and mixed evenly and then placed in an incubator for cultivation.

2.1.4 cell count:

1. a cell counter is prepared, a cell counting plate and a cover glass are taken, the cover glass is wiped by alcohol, and the cover glass is placed in the center of the counting plate for standby. Cells were digested following the procedure in "cell passage" and resuspended in 1mL medium to 4mL EP tubes. 2. And (3) taking 10-20 mu L of cell suspension, vertically dripping the cell suspension between the cover glass and the counting plate, uniformly covering the suspension on the counting plate, avoiding generating bubbles, and dripping a proper amount of PBS (phosphate buffered saline) around the cover glass to prevent the PBS from sliding. 3. The method is characterized in that the method can be used for counting under a microscope after standing for about 1 minute, and the total number of the cells in four big lattices is calculated according to the principle of 'counting up and down and counting left and right', wherein the formula is as follows: cell number (number/mL) = (total number of four large cells/4) ×104×dilution.

2.1.5 cell cryopreservation:

1. if the newly recovered cells are in a good growth state, the cells which are not treated temporarily can be frozen for preserving the cell activity and the seed preservation after being passaged for 3 to 5 generations. The cell fusion rate reached 90% -100% according to the "cell passage" procedure, and the well-conditioned cells were digested into 4mL EP tubes, and resuspended using 500 μl of complete medium. 2. Taking a corresponding number of freezing tubes and marking, and according to a complete culture medium: serum: DMSO = 5:4:1, mixing uniformly, adding the cell suspension into a freezing tube, and sealing by using a sealing film. 3. And (3) sequentially placing the freezing pipes into a refrigerator with the temperature of 4 ℃ for 10min and a refrigerator with the temperature of minus 20 ℃ for 2h, and finally placing the frozen pipes into a refrigerator with the temperature of minus 80 ℃ for short-term freezing, and transferring the frozen pipes into liquid nitrogen after 24 hours if long-term freezing is needed.

2.2 cell function experiments:

2.2.1 scratch experiments:

1. cells are plated in 12-well plates at a density suitable for transfection, infection, etc., and scored after a specific treatment to a cell density of 95% or more. 2. The wells were blotted off, PBS was added along the walls of the wells and the plates gently shaken and discarded to reduce the effect of floating cells on the experiment. 3. The yellow gun head is used for scribing the bottom of the vertical dish, the force is evenly applied, and the scribing is at the center position. 4. PBS was again added to the well plate along the dish wall and discarded after gentle shaking, and repeated three times to suck out the scraped cells as much as possible. 5. Serum-free medium is added, and if apoptosis is excessive, a low serum medium (containing 2% -2.5% serum) can be used and placed in an incubator. 6. Photographs were taken at specific time points using an inverted fluorescence microscope, time points (h) in common: 0. 6, 8, 16, 24, 36.

2.2.2transwell experiments:

1. preparation of Matrigel (challenge experiment): placing Matrigel glue stored in a refrigerator at-20 ℃ into a refrigerator at 4 ℃ to be melted 1-2h in advance, and using a precooled gun head to press Matrigel: serum-free medium = 1:30, adding a proper amount of matrigel into a Transwell chamber, covering the whole polycarbonate film, and standing for 1h at room temperature until the matrigel is formed. 2. Cells were digested according to the "cell passage" procedure and resuspended in 4mL EP tubes using serum-free medium, and appropriate amounts of cell suspension were selected according to the "cell count" procedure to ensure a SAS cell concentration of 1X 105 cells/100. Mu.L (migration), 2X 105 cells/100. Mu.L (invasion), HSC3 and DOK cells concentrations of 2X 105 cells/100. Mu.L (migration), 3X 105 cells/100. Mu.L (invasion) were added dropwise vertically to the Transwell upper chamber. 3. 500-700. Mu.L of complete medium was added to a 24-well plate and the upper chamber was gently placed into the plate with forceps. 4. Fixing and dyeing: after culturing for 24-36 hours, taking out the cell, wiping out the matrix gel with a cotton swab, then putting the cell into 4% paraformaldehyde for fixing for 15-20min, then using 0.1% crystal violet for dyeing for 3-5min, rinsing with PBS for three times, and putting the cell into a fume hood for natural drying. 5. Photographs were taken using an inverted fluorescence microscope.

2.2.3CCK-8 proliferation assay:

1. cell suspensions of corresponding concentrations were obtained according to the steps of "cell passage" and "cell count", SAS cell concentration was 1000 per well, HSC3 and DOK were 2000-3000 per well. 2. The cell suspension was added to a 96-well plate at 100. Mu.L/well, 5 multiplex wells, and PBS was added to the remaining wells around 100. Mu.L/well to prevent the cell suspension from evaporating too rapidly. 3. Culturing for 2-4h until the cells adhere to the wall. 4. 10 mu L of cck-8 reagent is added into each hole under the liquid surface, and the mixture is gently blown and mixed. 5. The 96-well plate was placed in an incubator for incubation for 1-2 hours, absorbance (wavelength 450nm, reference wavelength 620 nm) was measured using a microplate reader, and thereafter data was collected for 5 days at the same time for statistical analysis.

2.2.4 clone formation experiments:

1. corresponding cell suspensions were also obtained following the steps "cell passage" and "cell count", with SAS cell concentrations of 1000 per well and HSC3 and DOK of 2000-2500 per well. 2. The cell suspension was added to a 6-well plate and the whole medium was used to make up to 3mL. 3. Culturing in incubator for 10-15 days, and observing cell growth state under microscope. 4. After the individual cells formed macroscopic colonies, the 6-well plates were removed from the incubator, fixed with 4% paraformaldehyde (cell fixative), stained with 0.1% crystal violet and photographed on a white background plate.

2.3 real-time fluorescent quantitative RT-PCR (qRT-PCR):

2.3.1 total RNA extraction from cells:

1. taking a 6cm dish as an example: the culture medium in the dish was drained, rinsed three times with PBS, and the waste liquid was poured. In the case of animal tissue, the tissue is placed in a mortar and ground into a powder with liquid nitrogen. 2. Adding 1mL of RNA extraction reagent Trizol, completely covering the bottom of the dish and the tissue, standing on ice for 10-15min, and lightly blowing with a pipette to mix the cells and the tissue with the lysate. 3. Trizol cell suspension was collected into 1.5mL RNase-free EP tube, 1/5 volume of chloroform (200. Mu.L) was added, the tube was capped, and the mixture was allowed to stand on ice for 2-3min under vigorous shaking. 4. Centrifuge at 4℃and 12000g for 15min. 5. After centrifugation the liquid was divided into three layers, from top to bottom: colorless supernatant (RNA), protein, red organic phase, carefully aspirate supernatant into another EP tube. 6. 1/2 volume of isopropanol was added to the aspirated supernatant, mixed upside down, and left on ice for 10min. 7. Centrifuge at 4℃and 12000g for 15min. 8. After centrifugation, a portion of the white gum material was observed to adhere to the bottom of the tube, the supernatant was discarded, 1mL of 75% absolute ethanol was added, and the pellet was washed. 9. Centrifuge at 4 ℃,12000g,5min. 10. Discarding the supernatant, and evacuating for 2min. 11. Removing the supernatant as much as possible, and volatilizing the residual alcohol in a fume hood. 12. RNA was dissolved in 10. Mu.L-30. Mu.L of LDEPC water, and the concentration (OD (RNA) =2.0-2.1) was measured by ultraviolet spectrophotometry, at which time the RNA sample was stored in a-80℃refrigerator for use.

2.3.2 reverse transcription reactions:

according to PrimeScript ^TM RT reagent Kit with gDNA Eraser kit-related instructions were subjected to reverse transcription procedures.

2.3.2.1 genomic DNA removal reaction:

the reaction mixture was prepared on ice according to the ingredients of Table 1, taking care that the Master Mix was prepared in the amount of +2 of the reaction, and then split-packed into EP tubes, 1.5. Mu.L each, and finally RNA samples were added and placed on a PCR apparatus at 42℃for 2min.

Reagent name	Usage amount (mu L)
		5×gDNA Eraser Buffer	1
gDNA Eraser	0.5
		Total RNA	500ng
RNase Free ddH2O	up to 5

TABLE 1

2.3.2.2 reverse transcription reaction:

the reaction mixtures (reaction number +2) were prepared in accordance with Table 2 on ice and then filled into each EP tube, 5. Mu.L/tube. The reaction procedure: 15min at 37 ℃, 5sec at 85 ℃ and 4 ℃.

Reagent name	Usage amount (mu L)
		PrimeScript RT Enzyme Mix I	0.5
RT Primer Mix	0.5
		5x PrimeScript Buffer 2(for Real Time)	2
RNase Free ddH ₂ O	2
		Mix1	5
Total	10

TABLE 2

2.3.3 real-time fluorescent quantitative PCR:

the procedure was as described for Tiangen SuperReal Premix Plus, and 18. Mu.L of Real Time PCR reaction solution was prepared on ice, and 2. Mu.L of cDNA template was added thereto, followed by mixing with a centrifuge and taking care of light-shielding. The reaction system is shown in Table 3:

TABLE 3 Table 3

The reaction solution is placed on an ABI7500 Real-Time PCR instrument, and a three-step amplification program is operated, and the specific reaction steps are shown in table 4:

TABLE 4 Table 4

After the reaction is completed, data are collected for relative quantitative analysis, and the calculation formula adopts F=2-delta CT. The quantitative primers used in this example are shown in Table 5:

Object name	Sequence(s)
		RP11-426A6.5 F	ATAAACCTGCCAGAGACCCC
RP11-426A6.5 R	GAGGGTAGGAGGGGTTAAGC
		Human EZH2 F	AATCAGAGTACATGCGACTGAGA
Human EZH2 R	GCTGTATCCTTCGCTGTTTCC
		Human STAT3 F	GAGCTGCACCTGATCACCTT
Human STAT3 R	CTACCTGGGTCAGCTTCAGG
		GAPDH F	ACCACAGTCCATGCCATCAC
GAPDH R	TCCACCACCCTGTTGCTGTA
		β-actin F	CATGTACGTTGCTATCCAGGC
β-actin R	CTCCTTAATGTCACGCACGAT

TABLE 5

2.4 Western immunoblotting (Western Blotting):

2.4.1 cellular protein extraction:

2.4.1.1 total cell protein extraction:

1. the original liquid in the dish was aspirated off, rinsed three times with pre-chilled PBS and the dish placed on ice. 2. Cells were scraped into 1.5mLEP tubes using a cell scraper and labeled. 3. Taking out RIPA lysate from refrigerator at-20deg.C in advance, dissolving, preparing lysate (RIPA: PIC: PMSF=100:1:1) according to the number of samples +2, adding 100 μl of each tube into the sample, shaking, mixing, and performing ice lysis for 30min. 4. Cell disruption using an sonicator, program set up: AMPL 20, duration 3min, working time 3s, until protein solution is clear. 5. Centrifuge at 4℃at 13140rpm for 15min. 6. The supernatant was transferred to another EP tube and the cell pellet was discarded.

2.4.1.2 nuclear protein extraction:

the kit is carried out according to the operation instructions of the Biyun Tian nuclear plasma protein separation kit. The method comprises the following specific steps: 1. mu.L of reagent A was added to each 20. Mu.L of cell pellet, and PMSF was added, followed by vigorous shaking and ice-bath for 10-15s. 2. Adding 10 mu L of reagent B, shaking vigorously, and ice-bathing for 1min. 3. And (3) centrifuging at 4 ℃ for 5min with 12000-16000 g. 4. Immediately sucking the supernatant to obtain cytoplasmic protein, and temporarily storing at-20deg.C. 5. The supernatant of the pellet was completely aspirated and 50. Mu.L of the nucleoprotein extraction reagent was added. 6. And (3) carrying out ice bath for 1-2min after vigorous shaking, and carrying out ice bath for 1-2min again, and repeating the steps for 30min. 7. And (3) centrifuging at 4 ℃ for 10min with 12000-16000 g. 8. The supernatant was aspirated into another EP tube, which was a nucleoprotein, which was stored temporarily at-20 ℃.

2.4.2 BCA assay for protein concentration:

1. 2mg/mL BSA (Standard bovine serum albumin) was diluted to 0.5mg/mL, and the corresponding number of ELISA strips were taken according to the number of samples, and a standard curve was prepared according to Table 6.

PBS(μL)	0	1	2	4	8	12	16	20
									BSA(μL)	20	19	18	16	12	8	4	0

TABLE 6

2. At room temperature, as BCA reagent a: BCA reagent b=50: 1, and BCA working fluid is disposed in the ratio of 1. 3. mu.L of PBS, 2. Mu.L of protein solution and 100. Mu.L of BCA were added to each well, and the mixture was allowed to stand in an incubator at 37℃for 30 minutes. 4. The absorbance at OD 570nm was measured using a microplate reader, and the protein concentration and loading volume were calculated from the standard curve. 5. Each protein sample was added with 25. Mu.L of 5×loading Buffer, boiled for 10min, and stored in a-20deg.C refrigerator.

2.4.3 gel configuration and SDS-PAGE electrophoresis:

1. the glass plates are cleaned, then dried in a drying oven, the plate is assembled according to the operation instruction, the separating gel liquid which is uniformly mixed in advance is injected between the two glass plates by a liquid transferring gun, so that bubbles are avoided, the liquid level is flattened by absolute ethyl alcohol, the mixture is stood for 1h for gelation and fixation, and the components of the separating gel are shown in the table 7:

TABLE 7

2. Discarding the upper absolute ethyl alcohol after the separation gel is solidified, sucking the water by filter paper, then injecting the concentrated gel again, inserting a comb, and standing for 1h at room temperature for loading, wherein the components of the concentrated gel are shown in the table 8:

TABLE 8

3. Loading: taking out the sample temporarily stored in the refrigerator at-20deg.C, boiling for 5min, loading according to the Loading volume calculated in advance, filling the volume to 10 μL/15 μL with 1×loading Buffer, and adding protein Marker. 4. Electrophoresis: setting the voltage to 80v, starting electrophoresis, observing that the bromophenol blue indicator gradually moves downwards, adjusting the voltage to 120v after the protein runs out of the concentrated gel, and observing that the bromophenol blue indicator reaches the bottom of the separation gel after 1h, and ending electrophoresis.

2.4.4 transfer film and blocking:

1. the PVDF membrane was cut to the corresponding size and placed in methanol for activation for 90s. 2. The glue and PVDF film are placed in sequence according to the cathode (blackboard) -three layers of filter paper-glue-PVDF film-anode (whiteboard), the pressing plate is clamped, the film transferring instrument is placed according to the position of the anode and the cathode, meanwhile, the wet transferring liquid is poured in, and the film transferring instrument is immersed in ice water. 3. Constant pressure 100v, transfer for 1-2h, the transfer time can be reduced or increased as appropriate according to the protein size, but not less than 50min. 4. Closing: 5% milk or BSA was blocked at room temperature for 1h. (blocking of phosphorylated proteins with 5% bsa) 5, incubation of primary antibodies: after diluting the antibodies in a proportion with TBST, the membrane was immersed in the antibodies and spun overnight on a 4 ℃ suspension. 6. Washing the film: the primary antibody was eluted 3 times, 7min each at room temperature using TBST. 7. Incubating a secondary antibody: the secondary antibody corresponding to the primary antibody was diluted as well, and the eluted membrane was gently placed in the shaker at room temperature for 1h. 8. Washing the film: the steps are the same as above.

2.4.5 development:

the protein bands were visualized by exposure using Azure C300 or Bio-rad imaging systems and the protein bands were greyscale analyzed using ImageJ. The difference in protein expression after different treatments was compared using GAPDH/LaminA as an internal reference.

2.5 cell transfection:

2.5.1 plasmid transformed bacterial cells:

1. competent cells, commonly referred to as DH-5α, stbl3, etc., were prepared, taken out of the-80℃refrigerator and placed on ice until they were thawed. 2. mu.L of plasmid was added to 100. Mu.L of competent cells (1/10 volume) and incubated on ice for 15-30min. 3. And (5) heat-shocking at 42 ℃ for 90s, rapidly inserting into ice, and standing for 5min. 4. 1mL of Amp-free medium was added thereto, and the culture was performed at 37℃and 200rpm with shaking for 1 hour. 5. 3000rpm, centrifuging for 3min, keeping 150-200 μl of culture medium, blowing bacterial precipitate uniformly, sucking 50 μl, dripping onto plate culture medium (containing Amp), uniformly coating with sterilized coating rod, and standing for 30min. 6. And (3) culturing for 16-24h in an inverted mode at 37 ℃, when single colonies grow larger and full, picking up the single colonies by using a gun head, putting the single colonies into 1.5mL of EP tube containing bacterial LB culture medium (containing Amp), placing the single colonies on a shaking table for 5-6h, taking 50mL of EP tube when the culture medium in the EP tube is turbid, adding 20-30mL of culture medium, transferring bacterial liquid in the EP tube into a large tube, and continuing shake culturing for 16-18h.

2.5.2 plasmid extraction:

the method is carried out according to the operation instructions of the Magen endotoxin-free plasmid small-scale kit, and comprises the following specific steps: 1. plasmid extraction can be performed when the OD of bacteria in 50mL tubes reaches 0.5-0.6 at 600nm as detected using an enzyme-labeled instrument. Taking out the tube, centrifuging at 4deg.C and 3000-5000g for 10min. 2. The medium was poured, inverted and the liquid was drained on absorbent paper, 600. Mu.L of BufferE1/RNaseA was added, and the mixture was blown and mixed. 3. 600 μl Buffer E2 is added, mixed upside down for 6-8 times, and left standing at room temperature for 2min, and mixed upside down for 2-3 times. 4. 600. Mu.L Buffer E3 was added and immediately mixed upside down 10-15 times to give a white lump. 5. 13000g, and centrifuged for 10min. 6. Transfer the supernatant to a 4mL tube, add 1/3 volume Buffer E4 (-550. Mu.L) to the supernatant and mix upside down. 7. HiPure EF Mini Column was set in a collection tube and 750. Mu.L of the mixture was transferred to the tube. 8. 10000g, and centrifuging for 15-60s. 9. The waste liquid was discarded, the column was returned to the collection tube, the remaining liquid was transferred to the column, 10000g was centrifuged for 15-60s. 10. The above process is repeated until all liquid passes through the column. 11. The filtrate was discarded, the column was set back into the collection tube, 650. Mu.L Buffer E5 was added to the column, 10000g, and centrifuged for 15-60s. 12. The above steps were repeated, 650. Mu.L Buffer PW2 (absolute ethanol was added thereto), and the mixture was allowed to stand for 2min,10000g and centrifuged for 15-60s. 13. The above procedure was repeated and air-dried once. 14. The column was placed in a sterilized 1.5mL EP tube, 30-100 μl of pre-heated Buffer TE was added to the center of the column, left stand for 2min,10000g, centrifuged for 60s, the DNA eluted, the column was discarded, and the plasmid concentration (OD (DNA) =1.8-2.0) was measured and stored at-20 ℃.

2.5.3 transient transfection:

1. cells with good growth state and density of 80% -90% are prepared, the volume of the transfection reagent and the mass of the plasmid recommended by the transfection reagent TurboFect are added according to the area of the culture medium, and the added plasmid volume is calculated. 2. Taking 6cm dish cells as an example: taking a 1.5mL EP tube, sequentially adding 300 mu L of serum-free culture medium, 3 mu g of plasmid and 5 mu L of transfection reagent TurboFect, standing for 15-30min, waiting for the formation of transfection complex, and taking notice of no blowing. 3. The original culture dish is sucked and removed, 2mL of fresh complete culture medium is replaced, the transfection complex is added along the wall of the dish, and the mixture is gently mixed and placed in an incubator for culture. 4. After 18-24 hours, observing the growth state of the cells under a microscope, and changing fresh culture medium to continue culturing for 48 hours, and then collecting protein samples or RNA for identifying and observing the over-expression/silencing efficiency of genes.

2.5.4 lentiviral infection:

1. the whole process is carried out in a biosafety cabinet, the fusion rate reaches 80%, 293T cells and packaging plasmid systems (PHR, VEVG and destination plasmid) with good states are prepared, and 2mL of fresh complete culture medium is replaced. 2. Taking a 6cm dish 293T cell as an example: two 1.5mL EP tubes were prepared and labeled. 600. Mu.L of serum-free medium, 3. Mu.g of plasmid or vector of interest, 2.25. Mu.g of PHR plasmid, 0.75. Mu.g of VSVG plasmid, 12. Mu.L of TurboFect were added sequentially to the tube. Standing at room temperature for 15-30min. (plasmid ratio PHR: VSVG: plasmid of interest=3:1:4) 3, the resulting transfection complex was gently added to 293T cell dishes and shaken well in culture medium. 4. After 6-8h, the medium was changed to 4mL of complete medium. 5. After 48 hours, the growth state of the cells was observed, and if the state was good, the virus liquid was collected, filtered by a 0.45 μm filter head, and then the solution was dispensed into 1.5mL EP tubes. At this time, the virus liquid can be stored in a refrigerator at-80 ℃ for standby. 6. Infection: the virus liquid is prepared by the following steps of: virus liquid = 1:1 (at this time, the cell fusion rate should be about 30%), 1000 Xpolybrene is added at the same time, the transfection efficiency can be observed under a fluorescence microscope after the continuous culture for 18-24h, if the state is good, the cell passage can be carried out, puro screening can be carried out, and stable cell strains with stable expression or knockdown of a certain gene can be obtained by continuous screening for one week.

2.5.5siRNA transfection:

1. taking a 6-well plate as an example: 500. Mu.L of medium per well was added (1.5-3.5). Times.10 4 cells 24h before transfection to achieve a density of 30% -50% at the time of transfection. 2. Preparing transfection complex: two 1.5mL RNase-free EP tubes were taken and 200. Mu.L of serum-free medium was added to the sterile EP tubes. 3. mu.L of siRNA to be transfected (100 nM) was added to the EP tube, thoroughly mixed, followed by 4. Mu.L of siRNA-Mate transfection reagent, and mixed by shaking the tube wall. 4. Standing at room temperature for 10-30min to form transfection complex between siRNA and transfection reagent. 5. While still, fresh medium was exchanged for the cells to be transfected, and then the transfection complex was added to the wells, and the dishes were gently shaken to a final volume of 1mL. 6. Continuing to culture the cells, the gene silencing efficiency can detect mRNA in 24-48h and protein in 48-72 h. 7. The transfection complex composition for each format dish is shown in table 9:

TABLE 9

2.6IP experiments:

2.6.1Co-IP：

1. collecting cells: the dishes were removed, rinsed three times with pre-chilled PBS and the cells scraped off with a cell scraper, collected in a 1.5mL EP tube, centrifuged at 5000rpm for 3min, the supernatant discarded, the pellet left and labeled. 2. Lysing the cells: according to the cell number, an appropriate volume of IP lysate (1 mL) was added, together with PMSF (100×), PIC (100×), na3VO4 (100×), mixed by shaking, and lysed on ice for 50-70min. 3. At 4 ℃,13500g, centrifuged for 15min, the supernatant was collected and 100. Mu.L of protein solution was reserved as Input. 4. The BCA method is used for measuring the protein concentration, and the total mass of one IP protein is ensured to be more than 2 mg. 5. Preparing loads: two copies of the Beads need to be prepared, one for pre-removal and one for antibody-Beads protein incubation, the amount of pre-removed Beads can be reduced to half of the latter. And calculating the total volume of the required Beads according to the number of samples, adding the total volume into a 1.5mL EP tube, placing the EP tube on a magnetic rack, absorbing and discarding the mother liquor, re-suspending the EP tube by 200 mu L-500 mu L of IP lysate, repeating the steps for two times, thoroughly removing the preservation solution, adding the original volume of IP lysate, and placing the EP tube on ice for standby. 6. Pre-cleaning: adding the protein solution into balanced pre-removed magnetic beads, and slowly mixing at 4deg.C for 40-60min to remove nonspecific proteins. 7. Beads-protein-antibody incubation: the pre-cleared protein solution (1 mg) and the corresponding primary antibody (1. Mu.g) were added sequentially to the beads and incubated overnight at 4 ℃. The control group was pre-cleared protein solution (1 mg) +normal igg+ magnetic beads. 8. Eluting: the overnight incubated protein solution is placed on a magnetic rack, the solution is sucked and removed, pre-cooled 500 mu L PBS is added for resuspension, the protein solution is placed on a spin mixer for cleaning for 5min, the supernatant is removed again, the process is repeated for 2 to 3 times, and PBS with the same volume as the magnetic beads is added for the last time for resuspension. 9. According to the volume of the magnetic Beads, adding 2×loading Buffer, boiling for 10min, collecting supernatant, discarding the Beads, and storing the sample at-20deg.C, or performing subsequent experiments such as Western Blotting.

2.7 validation of RNA-protein binding:

2.7.1 RIP(RNA immunoprecipitation)：

the operation was performed according to the instructions associated with the BersinBio RIP kit, and the specific steps are as follows:

2.7.1.1 cell lysis:

1. the dishes were blotted off with liquid, rinsed three times with pre-chilled PBS, cells were collected with a cell scraper into RNase-free EP tube, centrifuged at 5000rpm for 3min, the supernatant discarded, and the cell pellet was left. (1×107) 2, adding 1.7mL polysome lysis buffer,17 μ L protease inhibitor and 7.5 μ L RNase inhibitor into the precipitate, mixing, standing on ice for 10min, and dissolving on ice in-80deg.C refrigerator for 5 min.

2.7.1.2 DNA removal:

1. 8.5 mu. L DNase salt stock and 20 mu.L DNase were added to the lysates and incubated at 37℃for 10min. 2. Transfer the sample to ice bath, add 9 μl of 0.5MEDTA, 3.6 μl of 0.5M EGTA, 17 μl DTT quickly, mix well. 3. Centrifuge at 4℃for 15min at 16000g, transfer supernatant to another EP tube, take another 100. Mu.L as Input group, store in-20℃refrigerator.

2.7.1.3 balanced protein A/G magnetic beads:

taking 40 mu L of magnetic beads, adding 500 mu L polysome lysis buffer, uniformly mixing and washing, placing the magnetic beads on a magnetic rack, collecting the magnetic beads, discarding the supernatant, repeating the steps for 2-3 times, and adding 40 mu L polysome lysis buffer again for uniform mixing.

2.7.1.4 immunoprecipitation and elution:

1. The cell lysate was divided equally into two parts, and the experimental group was added: lysates + corresponding antibodies +20 μl of magnetic beads, control group addition: lysates + normal IgG +20 μl magnetic beads. 2. The IP samples were spun overnight at 4℃on a spin mixer. 3. The IP sample was placed on a magnetic rack, the supernatant was blotted off, washed three times with 500. Mu. L polysome washing buffer1 and 5. Mu.L DTT, and mixed well for 5min at 4 ℃. 4. The IP sample was placed on a magnetic rack, the supernatant was blotted off, washed twice with 500. Mu. Lpolysome washing buffer2 and 5. Mu.L DTT, mixed well for 5min at 4℃each time and the supernatant was removed. 5. 200. Mu. L polysome elution buffer, 2. Mu.L DTT and 2. Mu.L proteoaseK were added to resuspend the beads. The same reagent (100. Mu. L polysome elution buffer +2. Mu.L DTT+2. Mu.L protease K) was added to the Input group. 6. The RNA was eluted in a 55℃water bath for 1h and the bead transfer supernatant was collected into a new centrifuge tube using a magnetic rack.

2.7.1.5 extraction of RNA:

1. the supernatant was added with the same volume of RNA extraction reagent Trizol and vigorously shaken. 2. 13500g, centrifuged at 4℃for 15min, and the upper colorless liquid was collected into a new centrifuge tube. 3. 1. Mu.L of glycogen, 10. Mu.L of sodium acetate and 500. Mu.L of absolute ethanol were added to the ice and mixed well upside down. 4. The RNA samples were precipitated by standing overnight at-80 ℃. 5. The sample was removed, dissolved on ice, at 4 ℃,16000g, centrifuged for 30min and the supernatant discarded. 6. 1mL of pre-chilled 75% absolute ethanol was added, 4 ℃,16000g, centrifuged for 10min, the supernatant discarded, and the air was taken once more. 7. The fume hood volatilizes the alcohol and 10-30. Mu.L of DEPC water is added to dissolve the RNA, at which point the sample can be stored at-80 ℃. 8. The purified RNA sample can be subjected to reverse transcription-real-time fluorescent quantitative PCR quantitative analysis of gene expression, and can also be verified by common PCR.

2.7.2 RNA pull down：

The operation is carried out according to IEMedTM RNA pulldown Kit related description, and the specific steps are as follows:

2.7.2.1 probe-magnetic bead binding:

1. 30 mu L Streptavidin beads is placed in an RNase-free centrifuge tube, placed on a magnetic rack, the liquid is discarded, 200 mu L of 1 XTES is added, and after being mixed evenly in an upside down manner, the mixture is placed on the magnetic rack again to remove TES washing liquid. 2. After adding 150. Mu.L of 1 XTES, the mixture was stirred uniformly, 100. Mu.L was packed as pulldown, and 50. Mu.L was packed as NC. 3. Target RNA is added into the pulldown magnetic beads, negative control probes are added into the NC magnetic beads, and the combination is performed for 30min by shaking at room temperature. 4. 100. Mu.L of 1 XTES was added to each of the two centrifuge tubes and mixed upside down, and the supernatant was collected on a magnetic rack.

2.7.2.2 protein-RNA complex extraction:

1. collecting cells: the medium was discarded, washed twice with 1 XPBS and the residual PBS was blotted off the last time. 2. After adding 1.5mL pulldown buffer, 15 μ L Protease inhibitor, 15 μ L RNase inhibitor, ultrasound was performed for 10min (5 s ON, 5s OFF, 60% power) under ice bath conditions. 3. After 15. Mu.L of PDB buffer was added and stirred, the mixture was centrifuged at 12000g for 10min at 4 ℃. 4. Transfer 100 μl of supernatant to fresh RNase-free centrifuge tube for Input, -20deg.C temporary storage, transfer 800 μl of sample to RPD probe-bead tube, and transfer 400 μl of sample to NC probe-bead complex tube.

2.7.2.3 RNA pull down：

1. Placing the centrifuge tube on a mixer, shaking at room temperature, incubating for 1h, and collecting magnetic beads on a magnetic rack to remove supernatant; 2. adding 500 mu L of NT2buffer, washing for 5min at room temperature on a mixer, standing for 1min on a magnetic rack, collecting magnetic beads, removing supernatant, and repeating washing for 2 times.

2.7.2.4 elution:

and adding 100 mu L WB Elution buffer into the pulldown sample, adding 50 mu L WB Elution buffer into the NC sample, blowing and mixing uniformly, performing thermal elution at 95 ℃ for 10min, and collecting the supernatant on a magnetic rack to obtain the protein eluting solution.

2.7.2.5 Western Blotting identification protein:

the extracted protein liquid can be subjected to loading, electrophoresis and development according to the step of Western Blotting after the concentration is measured by a BCA method, and the optical density value of a target strip can be analyzed by using an Image J for quantitative analysis.

2.8 Immunofluorescence (Immunofluorescence):

1. the original culture medium of the cell slide is discarded, and the PBS is rinsed three times to suck the liquid. 2. 4% paraformaldehyde is fixed for 15-30min. 3. The PBS was rinsed 3 times for 5min each. 4. And sucking the redundant liquid around the climbing sheet by using filter paper, and circling around the climbing sheet by using a grouping pen, so as to keep the central part. 5. 1% membrane permeable solution (1% Triton-100+1% citric acid) was added dropwise to the ring, and incubated at room temperature for 20-30min. 6. The PBS was rinsed 3 times for 5min each. 7. Blocking with 5% goat serum, and standing at room temperature for 1h. 8. The primary antibody was diluted with an existing antibody dilution (PBS containing 0.3% Triton-100,1% BSA) and incubated overnight at 4 ℃. 9. The PBS was rinsed 3 times for 5min each. 10. The secondary fluorescent antibody was diluted with antibody dilution and incubated at room temperature or 37℃for 1h in the absence of light. 11. The PBS was rinsed 3 times for 5min each. 12. Encapsulation of tablet using anti-fluorescence quenching: dropping 5-10 μl of sealing agent onto the glass slide, contacting one end of the cover glass with liquid, and covering with transparent nail polish to avoid bubble, and covering the slide with transparent nail polish. 13. And (5) placing the fluorescent image under a forward multiphoton fluorescence confocal system to acquire a fluorescence image.

2.9 construction of nude mice tumor-bearing model to observe the effect of RP11-426A6.5 on tumor growth:

2.9.1 nude mice were tumorigenic:

1. nude mice were prepared: BALB/c male nude mice, 10, 4-5 weeks old, weighing 17-18g, purchased from Beijing Vetong Lihua laboratory animal technology Co., ltd, were adapted for one week. 2. Cell preparation: cloning the RP11-426A6.5 fragment onto LV003 Vector, and constructing stable expression RP11-426A6.5 and empty SAS cell lines (LV-RP 11-426A6.5 and LV-Vector) according to the "lentiviral transfection" experimental procedure. 3. The nude mice subcutaneous tumor-bearing model was constructed by digesting cells with pancreatin and resuspension with physiological saline, counting total cells in the "cell count" step, and sub-packaging into 3X 106/100. Mu.L/tube, sealed with sealing film. 4. Cells were injected subcutaneously into the right axillary lymph rich site of nude mice, and the mice were carefully withdrawn in parallel and pressed for several minutes to prevent fluid spillage. 5. The nude mice were recorded every 5 days for tumor formation, the weight of the nude mice was weighed with an electronic balance, and the nude mice were measured for volume (tumor volume (mm 3) =1/2 (long diameter×short diameter)) with vernier calipers while observing changes in spirit, diet, activity of the nude mice. 6. After the experiment is completed, the nude mice are sacrificed by high-concentration CO2, tumor-bearing pictures of the nude mice are taken, then tumors are stripped off, and tumor pictures are taken. 7. Two groups of nude mouse tumor tissue RNAs were extracted, 1/2 was used for qRT-PCR detection of RP11-426A6.5 levels, and 1/2 was used for embedding and subsequent experiments.

2.9.2 paraffin embedding of tissue:

1. the materials are fixed: the stripped nude mouse tissue is put into 4% formaldehyde and fixed for more than 24 hours. 2. Dehydrating: the day before dehydration, the fixed tissue is taken out, the surrounding of the tissue is trimmed and flattened, the tissue is placed into an embedding box, marked by a pencil and placed into a beaker, and the tissue is flushed with running water overnight. Then putting the tissues into gradient alcohol in turn: 50%, 75%, 85%, 95%, 100%, 30min each, for thorough dehydration, can be placed on a shaking table and gently shaken. 3. Preheating and dissolving, namely putting 1/2 xylene, a 1/2 paraffin iron box, a 100% paraffin iron box I and a 100% paraffin iron box II into a water bath kettle at 65 ℃ for complete dissolving for standby after 1h in advance. 4. Placing the tissue embedding box after gradient alcohol treatment into 1/2 xylene and 1/2 ethanol (transparent agent) for 15min, and xylene for 30min. 5. And (3) maintaining a constant-temperature water bath kettle at 65 ℃, and placing the embedding box into a 1/2 xylene and 1/2 paraffin iron box for 30min, a 100% paraffin iron box I for 40min and a 100% paraffin iron box II for 1h to enable paraffin to completely infiltrate into tissues. 6. Embedding: the embedding box is put into 65 ℃ paraffin in advance for preheating, a small amount of paraffin is dripped into the center of the embedding box, the tissue is put into the center, the smooth and flat surface is noted outwards, the embedding box is covered by the embedding box, the paraffin is dripped continuously until the tissue is completely wrapped, the whole embedding box can be moved into a cold table for cooling, the tissue can be taken out after the paraffin is completely whitened, and the temperature is 4 ℃ overnight. 7. Slicing: the wax block is correctly placed on the slicing machine, the distance between the blade and the wax block is slowly adjusted, the thickness of the blade is 5mm, tissues are continuously cut out, the complete tissue wax sheet is horizontally placed in the water bath kettle, and after the complete tissue wax sheet is completely unfolded, the glass slide is vertically fished out below the tissues, so that bubbles are avoided. 8. The sections were placed in an oven at 55 ℃ overnight for use.

2.9.3H-E staining (Hematoxylin-Eosin staining):

1. dewaxing: the slices are placed in a 65 ℃ oven for baking for 2 hours until paraffin is melted, then xylene I is placed for 15 minutes, xylene II is placed for 15 minutes, and hydration is carried out after the paraffin is observed to be completely removed. 2. Hydration: the slices were sequentially put into absolute ethanol, 95% absolute ethanol, 80% absolute ethanol, 70% absolute ethanol, each for 3min. 3. Distilled water is put in, and the mixture is put on a shaking table to be slowly shaken and washed for 1min. 4. The nuclei were stained with hematoxylin for 10s. (if the tissue is left to stand too long, the staining time can be prolonged appropriately). 5. Flushing with running water to turn blue for 10min. 6. Eosin-stained cytoplasm, 20-30s. 7. Sequentially placing the slices into gradient alcohol: 70%, 85%, 95%, 100%, each for 3 minutes. (eosin is easily decolorized in low concentration alcohol, and the standing time in 70% alcohol should be appropriately reduced). 8. The sections were placed in xylene for 10min. 9. The neutral resin seals were used with care to avoid air bubbles. 10. Observed under a normal microscope and photographed.

2.9.4 immunohistochemistry and tissue fluorescence:

1. dewaxing and rehydrating: the slices are put into a 65 ℃ oven to be baked for 2 hours or 70 ℃ to be baked for 1 hour, and then the slices are put into gradient alcohol: 100%, 95%, 85%, 70%, each for 3min. 2. Rinse 3 times with PBS for 3min each. 3. Antigen retrieval: and (3) repairing by adopting citric acid microwaves, heating a citric acid buffer solution to be boiled, then placing slices, performing microwave heating again with small fire to repair for 24min, placing the beaker into a basin after repairing, and cooling to room temperature. 4. The tissue is circled around each tissue by a histochemical pen, and a drop of endogenous peroxidase blocking agent is dripped at the center of each tissue, so that the samples are covered completely, and the samples are incubated for 20 minutes at room temperature. 5. Rinse 3 times with PBS for 3min each. 6. Closing: 50. Mu.L of 5% goat serum was added to the center of each tissue, and incubated at room temperature for 30min. 7. The sealing liquid is sucked up by a gun head, the corresponding primary antibody is dripped in the center of the tissue after dilution, a proper amount of double distilled water is added into a wet box, and the mixture is incubated overnight at 4 ℃. 8. The PBS was rinsed three times for 3min each. 9. Biotin-labeled goat anti-mouse/rabbit IgG or diluted fluorescent secondary antibody was dropped on the tissue and incubated for 1h at room temperature. 10. Rinse with PBS for 3X 3min. (if tissue fluorescence should be taken care of to avoid light). 11. Tissue fluorescence: an anti-fluorescence quenching tablet sealer is used. 12. Immunohistochemistry: DAB color development liquid is prepared according to the following formula: and (2) liquid B: liquid C (μl) =1000: 50: preparing DAB color development liquid according to a proportion of 50, dripping the DAB color development liquid on tissues, and immediately flushing the tissues with running water to stop the reaction after the tissues are yellow-brown. 13. To better label the cell profile, nuclei were stained with hematoxylin, 10s, and bluted for 10min with running water. 14. Dehydrating and transparentizing: sequentially placing the slices into gradient alcohol: 70%, 85%, 95%, 100%, 3min each time, and then put into xylene for 10min. 15. The photographs were taken using a neutral resin sealer and placed under a microscope. 16. The histochemical staining depth was quantitatively analyzed using ImageJ. (aod= (IOD/Area)).

2.10 statistical analysis:

the survival curves of this example were analyzed by Kaplan-Meier method, statistical analysis by GraphPad Prism V6.0 (GraphPad Software, lnc., la Jolla, CA, USA), inter-group variance analysis by t-test, one-way anova or x 2 test, all independent replicates, P < 0.05 was considered statistically significant.

3. Experimental results

3.1 Correlation of LncRNA RP11-426A6.5 with oral squamous cell carcinoma:

3.1.1 LncRNA RP11-426A6.5 is significantly highly expressed in oral squamous cell carcinoma and is associated with poor prognosis in patients:

previous studies have shown that aberrant expression of LncRNA and its corresponding pathway targets play a complex role in the progression of oral squamous cell carcinoma. In the embodiment, lncRNA RP11-426A6.5 with high specificity and high expression is screened by analyzing and comparing LncRNA which is abnormally expressed in head and neck squamous carcinoma tissues of TCGA and GEO databases. To explore the correlation of RP11-426A6.5 with oral squamous carcinoma, this example first examined the differences in expression of RP11-426A6.5 in a tissue chip containing 50 oral squamous carcinoma tissues and 11 normal oral mucosal tissues using in situ hybridization and quantitatively analyzed the degree of staining using ImageJ, and the results showed significantly higher expression of RP11-426A6.5 in oral squamous carcinoma tissues compared to normal oral mucosal tissues. Next, this example demonstrates that RP11-426A6.5 expression is significantly increased in different OSCC cell lines (SAS, CAL-27, HSC3, HSC4, SCC-25) compared to human oral leukoplakia cells DOK using qRT-PCR. In the TCGA database, kaplan-Meier analysis shows that the disease-free Survival (Disease Free Survival, DFS) and total Survival (OS) of patients with high expression of RP11-426A6.5 are obviously reduced, and the median Survival time of the patients with high expression of RP11-426A6.5 is 140 months (DFS) and 135 months (OS), respectively. Furthermore, by in situ hybridization, this example found that with increasing clinical grading of OSCC, staining became progressively darker, the degree of disorder of cell arrangement increased, and the allotype increased progressively. The above results demonstrate that RP11-426A6.5 is significantly highly expressed in oral squamous cell carcinoma and is associated with poor prognosis in patients.

3.1.2 knockdown RP11-426A6.5 inhibits invasion, metastasis and proliferation of oral squamous carcinoma cells:

to explore the biological role of RP11-426A6.5 in the development of oral squamous cell carcinoma, the oral squamous cell carcinoma cell lines SAS and HSC3 which significantly express RP11-426A6.5 were selected as follow-up subjects in this example. Firstly, knocking down RP11-426A6.5 by using small interfering RNA (Small interfering RNA, siRNA) in two cell lines, and verifying the knocking down efficiency by using qRT-PCR, and the result shows that compared with a si-NC group, the inhibition rate of LncRNA expression after si-RP11-426A6.5 reaches 80% or more. Subsequently, scratch experiments (FIG. 1) and Transwell migration experiments (no matrigel) (FIG. 2) showed that knock-down RP11-426A6.5 was able to significantly hinder scar wound healing and cell migration compared to the si-NC group. Transwell invasion experiments (matrigel addition) (fig. 2) showed that knockdown of RP11-426A6.5 significantly inhibited tumor cell invasion capacity. Image J was used for quantitative analysis. Finally, cloning experiments and CCK-8 proliferation experiments demonstrated that knockdown of RP11-426A6.5 was able to reduce the absorbance of SAS and HSC3 viable cells and the clonogenic capacity of single cells. Since the epithelial mesenchymal transition process is closely related to invasion and metastasis of tumor cells, western Blotting was used to examine E-cadherin and N-cadherin expression after cell knockdown of RP11-426A6.5 to elucidate this mechanism. The epithelial marker E-cadherein rises and the interstitial marker N-cadherein falls after the RP11-426A6.5 is knocked down, so that the cell migration invasion capacity is obviously weakened, namely the epithelial-interstitial transformation of oral squamous carcinoma cells can be inhibited by knocking down the RP 11-426A6.5. The result shows that the knockdown RP11-426A6.5 can reduce the migration, invasion and proliferation of oral squamous carcinoma cells by inhibiting the EMT process.

The scratch test of FIG. 1 was used to examine the effect of knockdown RP11-426A6.5 on cell migration (scale: 100 μm). The Transwell migration (no matrigel) and invasion (matrigel with matrigel) experiments of FIG. 2 were performed to test the migration or invasion capacity of knockdown RP11-426A6.5 on cells (for SAS cells: migration and invasion experiments for 24h, for HSC3 cells: migration and invasion experiments for 30 h), respectively (scale: 200 μm).

3.1.3 overexpression of RP11-426A6.5 promotes invasive metastasis and proliferation of oral squamous carcinoma cells:

to further investigate the effect of RP11-426A6.5 on the biological behavior of oral squamous carcinoma cells, the pCDNA3.1-RP11-426A6.5 plasmid (RP 11-426A6.5) and the empty control pCDNA3.1 (Vector) were constructed and transfected with Tuborect and tested for proliferation and migration capacity after 48 hours. To examine the effect of RP11-426A6.5 on cell migration invasion, scratch experiments (FIG. 3) and Transwell experiments (FIG. 4) were performed in this example (migration experiments: no matrigel, invasion experiments: matrigel present), and quantitative analysis results showed that overexpression of RP11-426A6.5 significantly promoted the ability of SAS and HSC3 cells to migrate invasion. Next, the colony formation experiments showed that overexpression of RP11-426A6.5 significantly increased the number of colonies, and similarly, the CCK-8 proliferation experiments showed that the proliferation capacity of SAS and HSC3 was increased to a different extent when RP11-426A6.5 was overexpressed compared to the control group (Vector). Knock-down of RP11-426A6.5 has been demonstrated to inhibit EMT progression and similarly, western Blotting was used to examine E-cadherin and N-cadherin expression after cell overexpression of RP11-426A6.5 to fully elucidate this mechanism. After the RP11-426A6.5 is over-expressed, the epithelial marker E-cadherein is reduced, the interstitial marker N-cadherein is increased, and the cells lose polarity and cell connection, so that the migration invasion capacity is enhanced, namely the RP11-426A6.5 can promote the epithelial-interstitial transformation of oral squamous carcinoma cells. The results show that RP11-426A6.5 can enhance the migration, invasion and proliferation of oral squamous carcinoma cells by promoting the EMT process.

The scratch test of FIG. 3 was used to examine the effect of over-expressed RP11-426A6.5 on cell migration (scale: 100 μm). The Transwell migration (no matrigel) and invasion (matrigel with matrigel) experiments of FIG. 4 were performed to examine the migration or invasion capacity of cells overexpressing RP11-426A6.5 (for SAS cells: migration and invasion experiments for 24h, for HSC3 cells: migration and invasion experiments for 30 h), respectively (scale: 200 μm).

3.2RP11-426A6.5 mechanism study of oral squamous carcinoma invasion and metastasis promotion:

3.2.1RP11-426A6.5 direct targeting EZH2:

to further explore the molecular mechanism of RP11-426A6.5 to promote oral squamous cell carcinoma, total RNA of the cell nucleus and cytoplasm is firstly extracted by using a nuclear-plasma separation technology, and the expression difference of RP11-426A6.5 in the cell nucleus and cytoplasm is detected by using qRT-PCR, wherein the expression of RP-11426A6.5 in the cell nucleus of a SAS cell is found to be significantly higher than that of the cytoplasm, which indicates that LncRNA is mainly positioned in the cell nucleus, and suggests that the LncRNA can directly interact with a protein or can be used as a molecular platform to support the interaction of two or more proteins, so a series of bioinformatics methods are used for predicting the protein targeted by RP11-426A6.5, such as CatRAPID, lncPro, lncbase. Protein EZH2 (enhancer of zeste homolog, EZH 2) was screened therefrom for a highly targeted association with RP11-426A6.5, while using RNAfold web server to predict the secondary structure of RP 11-426A6.5. Furthermore, to verify the binding of RP11-426A6.5 to the target protein EZH2, the EZH2-RNA complex was first extracted and the RNA purified using RIP, qRT-PCR confirmed that LncRNA RP11-426A6.5 was significantly enriched in the 500-1117bp segment, i.e., the presence of the EZH2 binding site in this segment was confirmed from the forward direction. Similarly, RNA pulldown experiments utilized RP11-426A6.5 probes incubated with HSC3 cell suspensions, the probe-protein complexes were extracted and the protein solution eluted, western Blotting confirmed from the reverse direction that RP11-426A6.5 was co-bound to EZH2 and that the enriched EZH2 protein increased significantly after overexpression of RP 11-426A6.5. The above results indicate that RP11-426A6.5 targets EZH2 directly.

3.2.2EZH2 is involved in the promotion of oral squamous carcinoma invasion and metastasis by RP 11-426A6.5:

this example has demonstrated that RP11-426A6.5 can enhance proliferation migration and invasion of oral squamous carcinoma cells by promoting EMT progression, and that RP11-426A6.5 targets EZH2 directly. To further verify the effect of EZH2 on RP11-426A6.5 to promote the migration and invasion of oral squamous carcinoma cells, this example overexpresses RP11-426A6.5 in SAS cells and knocks down EZH2 expression, and scratch experiments (fig. 5) and Transwell migration or invasion experimental results (fig. 6) indicate that knocking down EZH2 can significantly reverse the promotion effect of RP11-426A6.5 on cell migration invasion. Next, RP11-426A6.5 was overexpressed in SAS and HSC3, WB results showed an increase in EZH2 expression (FIG. 7), whereas knockdown of EZH2 resulted in an increase in E-cadherin and a decrease in N-cadherin, i.e., inhibition of epithelial-mesenchymal transition (FIG. 8). The above results indicate that EZH2 promotes oral squamous carcinoma invasive metastasis by promoting EMT progression to participate in RP 11-426A6.5.

Figure 5 uses Image J to quantitate protein bands from scratch experiments after overexpression of RP11-426A6.5 in SAS cells and knockdown of EZH2 expression where p <0.05 and p <0.01. FIG. 6 uses Image J to quantitatively analyze protein bands from Transwell migration (matrigel-free) and invasion (matrigel-loaded) experiments after overexpression of RP11-426A6.5 in SAS cells and knock-down of EZH2 expression. FIG. 7 uses Western Blotting to detect changes in the EZH 2-associated index (E-cadherin, N-cadherin) protein in SAS and HSC3 cells over-expressing RP 11-426A6.5. FIG. 8 shows the detection of changes in EMT-related index (E-cadherin, N-cadherin) proteins in SAS and HSC3 cells knocked down with EZH2 using Western Blotting.

3.2.3EZH2 bind directly and promote STAT3 methylation:

the Co-IP experiment is used in the embodiment to prove that the EZH2 and STAT3 in the oral squamous carcinoma cells SAS and HSC3 can Co-precipitate, namely the EZH2 and STAT3 can perform endogenous interaction in the intracellular. Next, immunofluorescent localization staining suggests that EZH2 also exists within OSCC tissue to bind STAT3. Since co-binding of EZH2 to STAT3 is present both intracellularly and in tissues. Using Co-IP, antibodies STAT3 or Methyl K were incubated with the EZH2 knockdown SAS and HSC3 cell suspensions, followed by immunoblotting to confirm that the extent of STAT3 methylation was significantly impaired following EZH2 knockdown (Methyl K represents an antibody recognizing methylated lysine). The above results indicate that EZH2 is able to bind STAT3 directly and to increase its methylation level.

3.2.4EZH2 activates STAT3 in vitro:

to examine whether EZH2 can activate STAT3 activity, this example uses EZH2 specific inhibitors DZNep or short hairpin RNA (shRNA) targeting EZH2 to treat cells, observing the effect of knockdown EZH2 on intracellular STAT3 and p-STAT 3. First, to determine the optimal concentration of DZNep-treated cells, cells were treated with different concentrations of DZNep (2. Mu.M, 5. Mu.M, 10. Mu.M) and EZH2 was effectively inhibited when cells were treated with 10. Mu.M DZNep for 48 hours, so DZNep (10. Mu.M) was selected as the treatment concentration. Western Blotting results show that the expression of p-STAT3 is obviously reduced no matter a DZNep inhibitor or sh-EZH2 is used, and quantitative analysis shows that the STAT3 activity is obviously inhibited by DZNep (10 mu M) or sh-EZH 2. Next, the effect of EZH2 on expression of STAT3 and p-STAT3 proteins in OSCC cells was examined by further overexpressing EZH2, and western blotting results showed that overexpression of EZH2 stimulated expression of STAT3 and p-STAT3 proteins. The above results indicate that EZH2 can activate STAT3 in vitro.

3.2.5EZH2 regulates STAT3 activity following transcription of LncRNA RP 11-426A6.5:

this example has demonstrated that EZH2 binds to LncRNA RP11-426A6.5 and participates in LncRNA RP11-426A6.5 to promote invasion and metastasis of OSCC cells, and that EZH2 can activate STAT3 in vitro. To see if RP11-426A6.5 also regulates STAT3, using western blotting, the results showed that after overexpression of RP11-426A6.5 in SAS and HSC3 cells using pCDNA3.1-RP11-426A6.5 plasmid, EZH2, STAT3 and p-STAT3 protein levels were significantly elevated and nuclear transfer of STAT3 and p-STAT3 occurred, suggesting that RP11-426A6.5 also activated STAT3 signaling in the cell, however qRT-PCR results showed that the mRNA levels of STAT3 did not change much after overexpression of RP11-426A6.5, thus presumably, RP11-426A6.5 affected STAT3 activity at post-transcriptional levels. EZH2 has been shown to affect STAT3 methylation levels, so it is speculated that RP11-426A6.5 may affect STAT3 methylation levels. Consistent with expectations, co-IP experiments demonstrated that RP11-426A6.5 could increase STAT3 methylation levels after actual overexpression in SAS and HSC3 cells, suggesting that RP11-426A6.5 could enhance EZH2 methyltransferase activity and promote STAT3 methylation. The results show that LncRNA RP11-426A6.5 activates STAT3 in vitro in both the classical and non-classical pathways.

This example has demonstrated that there is physical binding of EZH2 to STAT3, and to further investigate whether RP11-426A6.5 modulates interactions of EZH2 with STAT3, the results of co-IP experiments over-express RP11-426a6.5 in SAS cells, demonstrating that co-precipitation of EZH2 with STAT3 is significantly enhanced compared to control (Vector), and that, in addition, fluorescence intensity of EZH2 with STAT3 was significantly enhanced after over-expression of RP11-426A6.5 by co-staining STAT3 and EZH2 antibodies with cells immobilized on a slide overnight and observing under a fluorescence confocal microscope. Next, to see if EZH2 is involved in the activation of STAT3 by RP11-426A6.5, based on over-expression or knock-down of RP11-426A6.5 in SAS and HSC3 cells, the Western blotting results showed that knock-down EHZ2 could reverse the promotion of p-STAT3 protein by RP11-426A6.5, while over-expression of EZH2 could eliminate the inhibition of p-STAT3 by sh-RP 11-426A6.5.

Taken together, EZH2 mediates post-transcriptional regulation of STAT3 activity by RP11-426A6.5, and RP11-426A6.5 increases STAT3 methylation levels by enhancing interactions of EZH2 with STAT 3.

3.3 discussing the molecular mechanism of RP11-426A6.5/EZH2/p-STAT3 axis to promote oral squamous carcinoma invasion metastasis:

3.3.1RP11-426A6.5 promote oral squamous cell carcinoma invasion metastasis via the EZH2/p-STAT3 signaling axis:

To further investigate whether the RP11-426A6.5/EZH2/p-STAT3 axis can regulate oral squamous carcinoma invasion and metastasis, scratch experiments and Transwell migration or invasion experiments were used to demonstrate that overexpression of RP11-426A6.5 in SAS and HSC3 cells significantly promoted cell metastasis and invasion capacity, and that after treatment with STAT 3-specific inhibitor Stattic (5. Mu.M) for 24 hours, cell invasion and migration capacity was inhibited and the process was reversed by co-transfection of EZH2, and cells restored their migration and invasion capacity. The results were statistically analyzed using Image J. The results indicate that RP11-426A6.5 can promote invasion and metastasis of oral squamous cell carcinoma through an EZH2/p-STAT3 signal shaft.

3.4 in vivo exploration of the progression of RP11-426A6.5 to promote oral squamous cell carcinoma:

3.4.1RP11-426A6.5 promote in vivo nodulation in nude mice:

to explore the effect of RP11-426A6.5 on in vivo tumorigenesis, cloning RP11-426A6.5 sequences onto LV003 vector to construct plasmid (LV 003-RP 11-426A6.5) for stably over-expressing RP11-426A6.5, constructing virus solution by using 293T cells and packaging plasmid, infecting cells when the SAS cell fusion rate reaches 30% -50%, screening for 2 to 3 generations by puro to obtain SAS cells for stably expressing RP11-426A6.5, then re-suspending the cells by using normal saline and inoculating the cells under the right upper arm of nude mice (3×106/100 μL/each) and recording the tumor volume of nude mice every 5 days, wherein the body type of nude mice over-expressing RP11-426A6.5 groups is observed to be thin, the growth of tumors on the arm side is obvious, the skin is dull, partially shrunken, indifferent, lised, well coiled in corners, and the high-concentration CO is utilized ₂ Nude mice were sacrificed and subcutaneous tumors were dissected. The qRT-PCR result shows that the over-expression efficiency of RP11-426A6.5 in the tumor tissue of the nude mice of the experimental group is more than 10 times. Compared with a control group, RP11-426A6.5 can obviously promote the growth of tumors in the nude mice of an experimental group. Likewise, FIGS. 9-10 demonstrate that RP11-426A6.5 is capable of significantly promoting tumor volume increase and tumor mass increase over time. The results show that RP11-426A6.5 can promote the in vivo nodulation of nude mice. P in fig. 9<0.0001, p in fig. 10<0.05。

3.4.2RP11-426A6.5 promote expression of EZH2, STAT3, p-SATT3 and N-cadherein in vivo, down-regulate E-cadherein:

the extracted tumor tissues are embedded and sliced and subjected to HE staining, the increase of the cell volume of the tumor tissues of two groups of nude mice, the increase of the nuclear plasma proportion, the increase of the nuclear division images, the deep staining of nucleolus, the hyperplasia and disorder of epithelium are observed under a 20x microscope, compared with the LV-Vector group, the tissue allotype of the tumor formed by the SAS cells over-expressing RP11-426A6.5 is more obvious, the infiltration degree is increased, and tissues such as nerves, muscles, blood vessels and the like are invaded. Next, to verify the in vivo tumor promotion specificity of the RP11-426A6.5/EZH2/p-STAT3 axis, immunohistochemical staining was used to find that the trend of the EZH2, STAT3, p-STAT3, N-cadherin and E-cadherin proteins in tumor tissue was consistent with in vitro results. Specifically, EZH2, STAT3, P-STAT3, N-cadherin and E-cadherin proteins are deposited in the nucleus and nucleolus as brown yellow particles, and compared with a control group, the EZH2, STAT3, P-STAT3 and N-cadherin in the over-expressed RP11-426A6.5 tumor tissue are obviously deeply dyed, which shows that the protein expression level is obviously improved in the tumor tissue of an experimental group, and the E-cadherin shows the opposite trend. The above results indicate that RP11-426A6.5 promotes in vivo neoplasia through RP11-426A6.5/EZH2/p-STAT3 while promoting invasive metastasis by stimulating tumor epithelial mesenchymal transition.

4. Conclusion(s)

4.1 discussion RP11-426A6.5 promotes oral squamous carcinoma invasive metastasis:

in order to explore the correlation and biological characteristics of LncRNA RP11-426A6.5 and oral squamous carcinoma, in-situ hybridization is firstly used in an oral squamous carcinoma chip to prove that the LncRNA is highly expressed in oral cancer tissues, compared with normal tissues of the oral mucosa, the staining difference has statistical significance, and the Kaplan-Meier analysis shows that the high expression of the LncRNA is inversely correlated with the postoperative survival rate (DFS) and the average survival rate (OS) of head and neck squamous carcinoma patients. To further investigate whether RP11-426A6.5 is involved in the malignant biological behavior of oral squamous carcinoma cells, specific small interfering RNAs (Small interfering RNA, siRNA) (si-RP 11-426A6.5) which disturb transcription of RP11-426A6.5 and corresponding negative controls (si-NC) are constructed, and scratch experiments and Transwell migration or invasion experiment results show that the capability of inhibiting migration and infiltration of SAS and HSC3 after the RP11-426A6.5 is knocked down can be obviously inhibited, and a clone formation experiment and a CCK-8 proliferation experiment prove that the interference RP11-426A6.5 weakens the cell colony forming and proliferation capability. Next, the RP11-426A6.5 fragment was cloned into the pCDNA3.1 vector to construct a plasmid (pCDNA3.1-RP 11-426A6.5) that overexpresses RP11-426A6.5 and transfects it into cells, and the scratch test, transwell migration or invasion test, clone formation test and CCK-8 proliferation test all tended to be in a manner that the above results, namely, the overexpression of RP11-426A6.5, significantly promoted the transfer, invasion, proliferation and colony formation of SAS and HSC 3. Finally, SAS cell suspensions of stable expression RP11-426A6.5 (LV-RP 11-426A6.5) and no-load (LV-Vector) are respectively injected into the subcutaneous parts (3X 106/mouse) of the right upper arms of two groups of nude mice, the promotion effect of RP11-426A6.5 on in-vivo tumors is observed on animal models, and compared with a control group, the RP11-426A6.5 can obviously promote the increase of the volume and the mass of the tumors of nude mice of an experimental group as the time passes.

4.2 discussion of the molecular mechanisms by which RP11-426A6.5 promotes oral squamous carcinoma invasive metastasis:

epithelial-mesenchymal transition (EMT) refers to the cellular process by which cells lose Epithelial characteristics and acquire mesenchymal characteristics. Is generally defined as the deletion of the epithelial marker E-cadherin (E-cadherin) and the overexpression of the mesenchymal markers N-cadherin (N-cadherin), vimentin. Epithelial cells lose adhesion and are more prone to metastasis and invasion of adjacent tissues, so EMT is linked to a variety of tumor functions including tumor initiation, malignant progression, migration of tumor cells, blood infiltration, metastasis and therapeutic resistance. In this example, the change of the corresponding index of EMT after knocking down or over-expressing RP11-426A6.5 was detected in vitro and in vivo, and it was confirmed that when RP11-426A6.5 was knocked down, E-cadherin was elevated and N-cadherin was decreased, the EMT process was inhibited, and when RP11-426A6.5 was highly expressed, E-cadherin protein was inhibited and N-cadherin protein expression was upregulated, indicating that RP11-426A6.5 enhanced cell transfer by pushing the epithelial to mesenchymal transition process. In this example, both in vivo and in vitro demonstrated that RP11-426A6.5 promotes oral squamous carcinoma invasion, migration, proliferation and colony formation by triggering EMT processes, while correlating with poor prognosis for OSCC patients.

4.3 EZH2 is involved in RP11-426A6.5 to promote oral squamous cell carcinoma invasive metastasis:

based on the subdocalization of LncRNA in cells, the manner in which LncRNA functions can be roughly determined. If LncRNA is localized in the nucleus, it may act as a "molecular platform" or bind to transcription factors, disrupting their transcriptional activity. For example, during neuronal differentiation, lncRNA rhabdomyosarcoma 2 related transcripts (Rrhabdomyosarcoma 2-associated transcript, RMST) may bind to the transcription factor Sox2 and chromatin physically, activating transcription of neurogenic genes, such as ASCL1 and DLX1, driving neuronal differentiation. However, when LncRNA is primarily localized in the cytoplasm, the function of LncRNA is to mediate signal transduction pathways, translation programs, and posttranscriptional control of gene expression. For example, lncRNA linc-MD1 can be used as competitive endogenous RNAs (competing endogenous RNAs, ceRNAs) to competitively sequester miR-133 and miR-135, and in addition, LRRK2 recruited by long intergenic non-coding RNAs (long intergenic non-coding RNA for kinase activation, LINK-A) can phosphorylate Ser 797 site of HIF 1. AlphA. To participate in protein post-transcriptional modification. The identification of LncRNA RP11-426A6.5 being mainly located in the cell nucleus by RNA nucleoplasm separation and qRT-PCR shows that the LncRNA may be combined with transcription factors or target proteins to regulate gene transcription or influence the expression of downstream genes. Through TCGA database (GEPIA) and on-line bioinformatics website screening, such as CatRAPID, lncPro, etc., RP11-426A6.5 was found to be highly correlated with EZH 2), EZH2 was the potential target protein. To verify this hypothesis, this example uses RIP and RNA Pull Down to confirm that RP11-426A6.5 binds EZH2 directly in the cell from both the forward and reverse directions, while referencing RNAfold web servery predicted secondary structure of RP11-426A6.5 and possibly the sequence that binds EZH2, to determine that RP11-426A6.5 targets EZH2 with a sequence of 500-1117bp.

In the embodiment, RP11-426A6.5 is over-expressed in SAS cells, and when EZH2 is knocked down on the basis, a scratch experiment and a Transwell migration invasion experiment show that the knockdown EZH2 can obviously reverse the promotion effect of RP11-426A6.5 on cell migration invasion. This example has demonstrated that RP11-426A6.5 can directly target EZH2 and that overexpression of EZH2 also down-regulates E-cadherin, up-regulates N-cadherin, stimulates EMT progression, and thus, western Blotting was used to find that RP11-426A6.5 can regulate EZH2 expression in SAS and HCS3 cells, as expected. The results show that EZH2 participates in RP11-426A6.5 by enhancing epithelial mesenchymal transition to promote the invasion and metastasis process of oral squamous carcinoma.

4.4EZH2 activates STAT3 signal:

this example demonstrates that EZH2 not only acts as a histone methyltransferase to silence genes, but also activates STAT3 signaling by mediating STAT3 methylation. Co-IP and tissue fluorescence were used to confirm that EZH2 and STAT3 were physically bound in oral squamous carcinoma cells and OSCC tissues, and then antibody Methyl K recognizing lysine methylation was used to incubate with the cell suspension, and Western Blotting results showed that knock-down of EZH2 significantly reduced STAT3 methylation, which indicated that EZH2 was physically bound to STAT3 and promoted methylation, i.e., that EZH2 activated STAT3 in a non-classical pathway.

This example first treated cells with different concentrations of DZNep: 2 mu M, 5 mu M and 10 mu M show that the inhibition effect on EZH2 is gradually enhanced along with the increase of the concentration of DZNep, and the 10 mu M DZNep can obtain a better inhibition effect after 48 hours of treatment, thus being ideal drug treatment concentration, and selecting 10 mu M DZNep for subsequent experiments. Cell treatment with 10. Mu.M DZNep, with DMSO at the same concentration as a control, was performed after 48h, and Western Blotting images showed that the use of DZNep prevented the change in p-STAT3 after EZH2 expression, i.e., from a pharmacological point of view, down-regulation of EZH2 expression significantly inhibited p-STAT3 expression. Then, the fragment knocked down EZH2 was cloned into PLKO.1 vector to construct plasmid knockdown EZH2 (PLKO.1-EZH 2) and transfected into SAS and HSC3, and after 48 hours, the sample was collected, and Western Blotting confirmed that from the viewpoint of gene knockdown, inhibition of EZH2 also significantly inhibited p-STAT3, while STAT3 protein changes were not significantly different. Similarly, the EZH2 fragment was cloned into pCDNA3.1 to construct an over-expressed EZH2 plasmid and transfected into cells, and Western Blotting results showed that over-expression of EZH2 stimulated the expression of STAT3 and p-STAT3 to a great extent. The above results indicate that EZH2 can activate STAT3 signaling through classical pathways in oral squamous carcinoma cell lines SAS and HSC 3.

4.5RP11-426A6.5 promote oral squamous cell carcinoma invasion and metastasis by RP11-426A6.5/EZH2/p-STAT 3:

in this example, RP11-426A6.5 was found to promote expression of EZH2, STAT3 and p-STAT3 proteins in vivo and in vitro simultaneously, induce transfer of STAT3 and p-STAT3 in the cytoplasm to the nucleus and activate STAT3, however, there was no significant trend in the variation of STAT3 at mRNA levels after overexpression of RP11-426A6.5, suggesting that LncRNA RP11-426A6.5 is involved in the posttranscriptional regulation of STAT3. Meanwhile, co-IP experiments show that LncRNA can also promote the methylation of STAT3 by promoting the interaction of EZH2 and STAT3. In addition, western Blotting suggested that EZH2 was able to mediate the activation of STAT3 by RP 11-426A6.5. Stattic (naftifine hydrochloride) is a non-peptide STAT3 inhibitor, and can effectively inhibit STAT3 activation and nuclear translocation and selectively inhibit p-STAT3. Functional "reversion experiments" suggest that when cells are treated with Stattic (5. Mu.M), the high invasive transfer capacity of cells obtained by overexpression of RP11-426A6.5 is diminished and this change can be reversed by co-transfection of EZH2. Namely RP11-426A6.5 promotes the vitality of oral squamous carcinoma cells through the EZH2/p-STAT3 shaft and enhances the capability of outward infiltration and migration.

In summary, the invention provides that LncRNA RP11-426A6.5 is highly expressed in oral squamous cell carcinoma, promotes migration, erosion, proliferation and colony formation in vitro and in vivo, and is related to low survival rate of OSCC patients. RP11-426A6.5 directly targets EZH2. There is physical binding of EZH2 to STAT3, with EZH2 promoting STAT3 methylation. RP11-426A6.5 activates STAT3 intracellular and promotes STAT3 methylation by pushing EZH2 interactions with STAT3. RP11-426A6.5 promotes oral squamous cell carcinoma invasive metastasis via RP11-426A6.5/EZH2/p-STAT3 signaling pathway. And further, the LncRNA RP11-426A6.5 gene expression inhibitor can inhibit the EMT process by down-regulating the LncRNA RP11-426A6.5 gene expression, thereby inhibiting the proliferation and/or migration and/or invasion and/or colony formation of oral squamous carcinoma cells. EZH2 gene expression inhibitors inhibit the progression of EMT by down-regulating EZH2 gene expression and inhibiting STAT3 activation, thereby inhibiting proliferation and/or migration and/or invasion and/or colony formation of oral squamous carcinoma cells. STAT3 gene expression inhibitors inhibit EMT progression by down-regulating STAT3 gene expression, thereby inhibiting oral squamous carcinoma cell proliferation and/or migration and/or invasion and/or colony formation. Inhibitors of LncRNA RP11-426A6.5 gene expression inhibit EMT progression by down-regulating LncRNA RP11-426A6.5 gene expression and inhibiting RP11-426A6.5/EZH2/p-STAT3 signaling pathway, thereby inhibiting oral squamous cell carcinoma proliferation and/or migration and/or invasion and/or colony formation.

The above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art will understand that; the technical scheme described in the foregoing embodiments can be modified or some technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of a reagent for detecting a biomarker in the manufacture of a product for the diagnosis and/or prognosis of oral squamous cell carcinoma, characterised in that the biomarker comprises LncRNA RP11-426A6.5.

2. The use of claim 1, the biomarker further comprising EZH2 and/or STAT3.

3. The use according to claim 1, wherein the reagent comprises a reagent for detecting the expression level of a biomarker by a sequencing technique, a nucleic acid hybridization technique, a nucleic acid amplification technique;

the agent is selected from: probes specifically recognizing LncRNA RP 11-426A6.5; or a primer for specifically amplifying LncRNA RP11-426A6.5.

Application of LncRNA RP11-426A6.5 gene expression inhibitor in preparing medicine for treating oral squamous cell carcinoma.

5. The use according to claim 4, characterized in that the LncRNA RP11-426A6.5 gene expression inhibitor is used in the preparation of a medicament for inhibiting proliferation and/or migration and/or invasion and/or colony formation of oral squamous carcinoma cells.

6. The use according to claim 5, wherein the LncRNA RP11-426A6.5 gene expression inhibitor inhibits the progression of EMT by down-regulating LncRNA RP11-426A6.5 gene expression, thereby inhibiting oral squamous carcinoma cell proliferation and/or migration and/or invasion and/or colony formation.

7. The use according to claim 5, wherein the LncRNA RP11-426A6.5 gene expression inhibitor inhibits the progression of EMT by down-regulating LncRNA RP11-426A6.5 gene expression, down-regulating EZH2 gene expression, inhibiting STAT3 activation, and thereby inhibits oral squamous carcinoma cell proliferation and/or migration and/or invasion and/or colony formation.

8. The use according to claim 5, wherein the LncRNA RP11-426A6.5 gene expression inhibitor inhibits EMT progression by down-regulating LncRNA RP11-426A6.5 gene expression, down-regulating STAT3 gene expression, and thereby inhibits oral squamous carcinoma cell proliferation and/or migration and/or invasion and/or colony formation.

9. The use according to claim 5, wherein the LncRNA RP11-426A6.5 gene expression inhibitor inhibits EMT progression by down-regulating LncRNA RP11-426A6.5 gene expression, inhibiting RP11-426A6.5/EZH2/p-STAT3 signaling pathway, and thereby inhibits oral squamous carcinoma cell proliferation and/or migration and/or invasion and/or colony formation.

10. A pharmaceutical composition for treating oral squamous cell carcinoma, wherein the pharmaceutical composition comprises an inhibitor of LncRNA RP11-426A6.5 gene expression.