CN116875658A

CN116875658A - Deoxyribozyme and method for detecting mRNA capping rate

Info

Publication number: CN116875658A
Application number: CN202311159046.3A
Authority: CN
Inventors: 孙秀莲; 赵晟; 孙叶
Original assignee: Yiming Suzhou Cell Biotechnology Co ltd; Nanjing Hongming Biotechnology Co ltd
Current assignee: Yiming Suzhou Cell Biotechnology Co ltd; Nanjing Hongming Biotechnology Co ltd
Priority date: 2023-09-09
Filing date: 2023-09-09
Publication date: 2023-10-13
Anticipated expiration: 2043-09-09
Also published as: CN116875658B

Abstract

Provided herein is a method of detecting RNA capping efficiency comprising the steps of: 1) Treating the RNA with a deoxyribose nucleic acid enzyme DNAzyme (10-23) to generate an RNA fragment with a cap structure and a corresponding RNA fragment without the cap structure; and 2) detecting a proportional relationship between the cap-bearing RNA fragment and the corresponding RNA fragment to determine the capping efficiency, wherein the two binding arm lengths of the DNAzyme (10-23) are independently selected from 11, 12, 13, 14 and 15 nt. Also provided herein are the above-described DNAzyme (10-23) and RNA capping efficiency detection kits comprising the above-described DNAzyme (10-23).

Description

Deoxyribozyme and method for detecting mRNA capping rate

Technical Field

The application relates to the technical field of biology, in particular to a deoxyribozyme and a method for detecting mRNA capping rate.

Background

Ribonucleic acid (RNA) is an important macromolecule in the transmission of all biological genetic information, and plays a variety of regulatory roles in organisms, and in recent years, RNA research has become one of the most popular fields in biological research. For example, mRNA-based therapies that are more accurate in practical applications and can be used for personalized therapy can avoid complex manufacturing problems compared to the production of therapeutic proteins in patients; mRNA is also much less toxic as a drug than gene therapy, which alters DNA to produce a permanently irreversible effect. Therefore, mRNA treatment has become one of the most popular drug research directions, and is expected to be an effective method for coping with various diseases, and has a good development prospect.

Effective mRNA treatment requires efficient delivery of mRNA into a patient and efficient synthesis of the corresponding protein in vivo. To optimize mRNA delivery and protein production in vivo, proper capping is typically required at the 5' end of the construct to prevent mRNA degradation while promoting protein translation. Therefore, effective detection of capping efficiency is critical. The earliest capping detection methods were to label the cap structure with a radioisotope and then perform qualitative or quantitative analysis. The radioactive labeling method has high sensitivity, but needs to use isotopes, has certain potential safety hazards and risk of isotope pollution, needs special protection means, and is not easy to popularize, so researchers also start to develop detection methods which do not depend on isotope labeling.

CN114894916a discloses a method for quantitatively detecting the capping rate of RNA, designing a deoxyribozyme according to the sequence of the RNA to be detected, cutting the molecule of the RNA to be detected by using the deoxyribozyme, detecting the molecular weight and the relative proportion of the cut RNA to be detected, and determining the capping efficiency. Deoxyribozymes are single-stranded DNA molecules that have catalytic activity. One well-known family of deoxyribozymes is the "10-23" deoxyribozymes (DNAzyme (10-23)), which specifically recognizes, complementarily binds to and cleaves a target sequence of an RNA molecule by catalytic activity, thereby losing or reducing the activity of the cleaved RNA molecule. DNAzyme (10-23) has a 15 nucleotide core catalytic domain flanked by two substrate binding domains (I and II). 10-23DNAzyme binds to RNA substrates by base pairing through substrate binding domains I and II according to Watson-Crick rules. And (3) cutting the RNA to be detected by using deoxyribozyme, judging whether capping is successful by measuring the molecular weight of the RNA, and quantitatively measuring the RNA capping efficiency by calculating the abundance of different molecular weights. The method has high sensitivity, and does not need to use radioactive labels or worry about radioactive pollution. However, this prior method does not further optimize and screen DNAzyme (10-23), and in practice, the cleavage efficiency is often low. In some methods, RNaseH is used for cleavage, but the fixed-point cleavage of RNaseH has stricter requirements on target sequences and has poorer generality. In addition, some methods use RNA-based ribozymes (ribozymes), but are more unstable than DNAzymes, both ribozymes and protein nucleases (e.g., RNaseH), are much more expensive to produce than DNAzymes, and are prone to the introduction of other impurities, such as those that degrade and result in the production of ineffective RNA fragments, and RNaseH often contains other non-specific nuclease residues during its production. In addition, the mass spectrum-based method needs to adopt expensive equipment such as eHPLC-MS or LC-MS to detect the cut RNA, and the use and maintenance costs are very high. Therefore, how to design a detection method with simpler operation and lower cost is still a problem to be solved in the art.

The contents of all articles and references cited herein are incorporated by reference in their entirety.

Disclosure of Invention

In one aspect, provided herein is a method of detecting RNA capping efficiency comprising the steps of:

1) Treating the RNA with a deoxyribose nucleic acid enzyme DNAzyme (10-23) to generate an RNA fragment with a cap structure and a corresponding RNA fragment without the cap structure; and

2) Detecting a proportional relationship between the cap-structured RNA fragment and the corresponding RNA fragment to determine the capping efficiency,

wherein the two binding arm lengths of the DNAzyme (10-23) are independently selected from 11, 12, 13, 14 and 15 nt.

In some embodiments, the RNA is mRNA.

In some embodiments, the two binding arms of the deoxyribose nucleic acid DNAzyme (10-23) are equal in length.

In some embodiments, the RNA fragment is 26 nt in length.

In some embodiments, the difference in molecular weight determines whether the RNA fragment carries the cap structure.

In some embodiments, the proportional relationship is determined by capillary electrophoresis.

In some embodiments, the cap structure is located at the 5' end of the RNA.

In some embodiments, the Cap structure is selected from Cap O, cap I, and Cap II type structures.

In some embodiments, the mRNA comprises SEQ ID NO:1, and the deoxyribose nucleic acid DNAzyme (10-23) comprises a sequence shown in SEQ ID NO: 7. 8, 9, 10 and 11.

In some embodiments, step 1) comprises mixing the RNA with the deoxyribose nucleic acid DNAzyme (10-23) followed by pre-denaturation at 85℃for 1 min, followed by reaction at 37℃for 3 h.

In one aspect, provided herein is a deoxyribose nucleic acid enzyme (10-23) comprising SEQ ID NO: 7. 8, 9, 10 and 11.

In one aspect, provided herein is an mRNA capping efficiency test kit comprising the deoxyribose nucleic acid DNAzyme (10-23) described above.

Drawings

For a better understanding of the application and to show more clearly how it may be carried into effect, features according to embodiments of the application will now be described, by way of example, with reference to the accompanying drawings, in which:

fig. 1: schematic representation of the principle of cleavage of mRNA by 10-23 DNAzyme;

fig. 2: capillary electrophoresis patterns after cleavage of different cleavage sites in the 5' -UTR region of mRNA by DNAzyme (10-23) x-35;

fig. 3: capillary electrophoresis patterns of different arm lengths DNAzyme (10-23) 26-y after cutting the 5' -UTR region of mRNA;

fig. 4: capillary electrophoresis detection patterns of mRNA cleavage by DNAzyme (10-23) 26-43 after mRNA enzymatic capping for different reaction times;

fig. 5: capillary electrophoresis detection patterns of mRNA cleavage with DNAzyme (10-23) 26-43 after transcription co-capping at different concentrations of mRNA cap analogues.

Detailed Description

In order to provide a clear and consistent understanding of the terms used in the description of the present application, some definitions are provided below. Furthermore, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

The use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims and/or specification may mean "one" but it is also consistent with the meaning of "one or more", "at least one" and "one or more". Similarly, the word "another" may mean at least a second or a plurality.

The word "comprising" (and any form of comprising, such as "comprising" and "comprises"), "having" (and any form of having, "having", "including" and "containing") as used in this specification and claims is inclusive and open-ended and does not exclude additional unrecited elements or process steps.

The terms "about" or "approximately" are used to indicate that the value includes errors in the instruments and methods used in determining the value. As used herein, when used in reference to a specifically recited value, the term "about" means that the value can vary no more than 1% from the recited value. For example, the expression "about 100" includes 99 and 101 and all values in between (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

The present specification relates to a number of terms and abbreviations used by those skilled in the art. However, for the sake of clarity and consistency, definitions of selected terms are provided.

A "deoxyribose" or "deoxyribonuclease" or "DNAzyme" or similar expression is a catalytic DNA sequence. They comprise a catalytic core consisting of about 15 nucleotides flanked by short binding arms on the left and right sides of the catalytic core. Although the sequence of the catalytic core is fixed, the binding arms can be modified to specifically match virtually any RNA target sequence. Non-limiting examples of deoxyribozymes can be found in U.S. Pat. No. 6,159,714 to Ussman et al, the entire contents of which are incorporated herein by reference; chartrand et al, 1995, NAR 23, 4092; breaker et al, 1995, chem. Bio.2, 655; santoro et al, 1997, PNAS 94, 4262; breaker, 1999, nature Biotechnology, 17, 422-423; and Santoro et. al, 2000, j. Am. chem. Soc., 122, 2433-39. All of the above are incorporated herein by reference. The "10-23" DNAzyme motif is a special type of DNAzyme that has evolved using in vitro selection, as generally described in Joyce et al, U.S. Pat. No. 5,777,37. U.S. Pat. No. 5,807,718 and Santoro et al, supra. Additional DNAzyme motifs can be selected using techniques similar to those described in these references, and thus are within the scope of the application.

Bases are the basic building blocks of synthetic nucleosides, nucleotides and nucleic acids. The common bases in organisms are 5, adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U), respectively, and 4 bases have been artificially synthesized in 2019, U.S. scientist StevenA. Benner has named these 4 new members as "Z" P "S" B, respectively (as the name implies, adenine and guanine belong to the purine family (abbreviated as R), they have a bicyclic structure. Cytosine, uracil, thymine belong to the pyrimidine family (Y), their ring systems are a six membered heterocycle, also known as the main or standard base, are the basic units that make up the genetic code, wherein bases A, G, C and T are present in DNA, while A, G, C and U are present in RNA. Each base pair contains a purine and a pyrimidine: A is linked to T by 2 hydrogen bonds, C is linked to G pairing or Z is paired with P or S is paired with B by 3 hydrogen bonds, and "C" refers to the number of nucleotides, which may also refer to the number of nucleotides.

"complementarity" between purines and pyrimidines refers to the ability of a nucleic acid to form hydrogen bonds with another RNA sequence through conventional Watson-Crick or other non-conventional types. With respect to the nucleic acid molecules of the application, the free energy of binding of the nucleic acid molecule to its target sequence or complementary sequence is sufficient to allow the relevant function of the nucleic acid to be performed, such as enzymatic nucleic acid cleavage, ligation, isomerisation, phosphorylation or dephosphorylation. "fully complementary" means that all consecutive residues of a nucleic acid sequence will form hydrogen bonds with the same number of consecutive residues in a second nucleic acid sequence.

"RNA fragment" as used herein refers to fragments resulting from cleavage of RNA, particularly mRNA, by the deoxyribose enzyme DNAzyme (10-23), particularly fragments that are related to capping efficiency of interest. For example, when attention is paid to the efficiency of 5' end capping, the RNA fragment refers to a 5' end fragment comprising the 5' end base. When capping is incomplete (capping efficiency is less than 100%), the RNA fragments produced by treatment with DNAzyme (10-23) in the same sample may or may not be capped, i.e.RNA fragments with and corresponding RNA fragments without caps (identical in nucleotide sequence, except for whether they are capped or not).

"binding arm", "substrate binding domain", "substrate binding region", "homology arm" or similar descriptions refer to a partial region of DNAzyme that is capable of binding to a portion of its substrate or reporter gene by complementarity. Preferably, this complementarity is 100%, but may be lower if desired. For example, as few as 10 of 14 bases can base pair (see, e.g., werner and Uhlenbeck,1995,Nucleic Acids Research,23,2092-2096; hammann et al 1999, antisense and Nucleic Acid Drug Dev., 9, 25-31). That is, these sequences of arms contained within DNAzyme are intended to bind DNAzyme and a substrate, such as RNA, together by complementary base pairing interactions. DNAzyme of the application may have continuous or discontinuous binding arms and may have different lengths. The binding arms are preferably greater than or equal to six nucleotides in length and of sufficient length to stably interact with the target substrate. The length of the two binding arms around DNAzyme is symmetrical (i.e., each binding arm has the same length; e.g., five and five nucleotides, or six and six nucleotides, or seven and seven nucleotides long) or asymmetrical (i.e., the binding arms are different in length; e.g., six and three nucleotides; three and six nucleotides long; four and five nucleotides long; four and six nucleotides long; four and seven nucleotides long).

"cap structure" refers to chemical modification of either end of an oligonucleotide (see, e.g., wincott et al, WO 97/26170, incorporated herein by reference). These terminal modifications can protect the nucleic acid molecule from exonuclease degradation and aid in intracellular delivery and/or localization. Caps may be present at the 5 '-end (5' -cap) or the 3 '-end (3' -cap) or may be present at both ends. In non-limiting examples, the 5'-cap is selected from the group consisting of inverted abasic residues (moieties), 4',5 '-methylene nucleotides, 1- (. Beta. -D-erythrofurosyl) nucleotides, 4' -thio nucleotides, carbocyclic nucleotides, 1, 5-anhydrohexitol nucleotides, L-nucleotides, alpha-nucleotides, modified base nucleotides, dithiophosphate linkages, su Wu furanosyl nucleotides, acyclic 3',4' -seco nucleotides, acyclic 3, 4-dihydroxybutyl nucleotides, acyclic 3, 5-dihydroxypentyl nucleotides, 3'-3' -inverted abasic moieties, 3'-2' -inverted nucleotide moieties, 3'-2' -inverted abasic moieties, 1, 4-butanediol phosphates, 3 '-phosphoramidates, hexyl phosphates, amino hexyl phosphates, 3' -phosphorothioates, dithioates, or bridged or unbridged methylphosphonate moieties (see further Wincott et al, international patent application No. PCT, international 26262, WO 97, incorporated herein by reference for details). In another preferred embodiment, the 3' -cap is selected from the group consisting of 4',5' -methylene nucleotide, 1- (. Beta. -D-erythrofuranosyl) nucleotide, 4' -thionucleotide, carbocyclic nucleotide, 5' -aminoalkyl phosphate, 1, 3-diamino-2-propyl phosphate, 3-aminopropyl phosphate, 6-aminocaproyl phosphate, 1, 2-aminocodecyl phosphate, hydroxypropyl phosphate, 1, 5-anhydrohexitol nucleotide, L-nucleotide, alpha-nucleotide, modified base nucleotide, dithiophosphate, su Wu furanosyl nucleotide, 3',4' -seco nucleotide, 3, 4-dihydroxybutyl nucleotide, 3, 5-dihydroxyamyl nucleotide, 5' -5' -inverted nucleotide moiety, 5' -5' -inverted abasic moiety, 5' -phosphoramidate, 5' -phosphorothioate, 1, 4-butanediol phosphate, 5' -amino, bridged and/or unbridged 5' -ammoniaThe phosphorothioates, phosphorothioates and/or phosphorodithioates, bridged or unbridged methylphosphonates and 5' -mercapto moieties (see Beaucage and Iyer, 1993, tetrahedron 49, 1925; incorporated herein by reference for more details). In some examples, the cap structure is 7-methylguanosine triphosphate m ⁷ Gppp (Cap O type); in other examples, the cap structure includes 7-methylguanosine triphosphate m ⁷ Gppp and 2'-OH methylation of a first nucleobase and even 2' -OH methylation of a second nucleobase (referred to as Cap type I and Cap type II, respectively). Exemplary mRNA capping methods include enzymatic capping or cap analogue transcription co-capping, and the like.

The application utilizes the screening and improving deoxyribozyme DNAzyme (10-23) to improve the efficiency of cutting mRNA molecules to be detected, generates enough cut RNA capping fragment products or uncapped fragments which can be clearly separated and detected by capillary electrophoresis and respectively quantitated, thereby quantitatively detecting the mRNA capping rate through a capillary electrophoresis instrument, and the method is simpler, has lower cost and is easier to obtain detection equipment.

Accordingly, in one aspect, the application provides a method of detecting mRNA capping efficiency, the method comprising: and designing a deoxyribozyme (10-23) x-y according to the sequence of the RNA to be detected, and cutting the RNA molecule to be detected by using the deoxyribozyme, wherein the cut RNA molecule to be detected is divided into a capped short fragment and an uncapped short fragment. And detecting the molecular weight of the short fragments cut from the RNA to be detected and the relative proportion of the two short fragments by capillary electrophoresis, and further determining the capping efficiency, wherein x represents the number of mRNA short fragment nucleotides generated after cutting, y represents the number of deoxyribose nucleic acid per se, and y is an integer greater than or equal to 37.

Because the total length of the RNA to be detected is longer, the number of nucleotides is larger, the molecular weight is larger, one end of the RNA is capped, the increased molecular weight is not enough relative to the initial molecular weight, the RNA is difficult to distinguish by an instrument, the capped end or the planned capped end is cut out to become a short segment with smaller molecular weight, the difference between the capped short segment and the uncapped short segment is increased, the differentiation and the reading of the capped or uncapped short segment are facilitated, DNAzyme (10-23) x-y is adopted, after the RNA to be detected is cut, a sufficient number of capped or uncapped short segments are obtained, then the characteristic that capillary electrophoresis is high-sensitive and can be distinguished with single base with high precision is utilized, after the single base separation detection is carried out on the display peak of the capped or uncapped short segments, the peak integration area of the two short segments is calculated, the capping efficiency is measured, wherein x represents the number of the deoxynucleotides generated after the cleavage is equal to the number of the DNAzyme (10-23) and the number of the mRNA can be regulated by the DNAzyme or the whole number of the mRNA can be regulated by the DNAzyme or the number of the mRNA.

Deoxyribozyme (DNAzyme) is a single-stranded DNA fragment with a catalytic function, has high catalytic activity and structure recognition capability, and has the following advantages: (1) The DNA molecule is more stable and less susceptible to damage than Ribozyme (Ribozyme); (2) The molecular weight is relatively small, the synthesis and modification are easy, and the cost is far lower than that of protein nucleases (such as RNaseH) and Ribozyme; (3) The accuracy of pairing the binding arm with the substrate is high, other recognition base sequence parts can be changed according to the base sequence of the substrate besides the core catalytic sequence, and the screenable target cleavage site is more and flexible than the cleavage scheme of RNaseH, and is superior to RNaseH and Ribozyme in the aspect of the comprehensive performance of RNA site-directed cleavage corresponding to an mRNA capping test.

Further, the cleavage site of the mRNA to be detected is selected to be located at the 5' -capped end of the mRNA. In some embodiments, the cleavage site of the mRNA to be detected is selected to be within 100 bases of the 5 '-capped end, as in the examples of the application, the 5' end sequence of the cleavage range is set forth in SEQ ID NO: 1.

SEQ ID NO：1：

5'-AGGAGAAUAAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACCAUGAGGCUGGCAGUGGGCGAUGCCACCAUGGUGAGCAAGGGCGA-3'

This range generally belongs to the 5' -end 100 base UTR region of the mRNA to be detected, and usually, the 5' -UTR and the 3' -UTR of the immobilized sequences which are verified to help stably express the protein are often adopted for the mRNA prepared by in vitro synthesis, so that the UTR regions of the mRNAs are often consistent, and therefore, the deoxyribozymes provided by the application have better cleavage universality for the mRNAs using the same UTR region. For mRNA of other different UTRs, efficient and available DNAzyme can be obtained rapidly according to the design principle and screening strategy provided by the application.

Further, x is selected from any integer from 15 to 51, specifically, x may be 15, 26, 47, 51.

In some embodiments, cleavage is performed at a site on the mRNA molecule to be detected using a modified deoxyribose enzyme DNAzyme (10-23) and the resulting mRNA short fragment nucleotide length after cleavage is 26 nt (x=26).

Further, y is selected from any integer from 35 to 45, and in particular, y may be 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45.

In some embodiments, the deoxyribozymes have equal arms length, y can be 35, 37, 39, 41, 43, 45; in some embodiments, the deoxyribozymes are not equal in length on both arms.

In some embodiments, cleavage is performed at a site on the mRNA molecule to be detected using a modified DNAzyme (10-23), which has a self-nucleotide length of 43 nt (y=43).

In some embodiments, the deoxyribozymes have a length of 11 nt on both arms. In some embodiments, the deoxyribozymes have a length of 12 nt on both arms. In some embodiments, the deoxyribozymes have a length of 13 nt on both arms. In some embodiments, the deoxyribozymes have a length of 14 nt on both arms. In some embodiments, the deoxyribozymes have a length of 15 nt on both arms.

In some embodiments, a modified DNAzyme (10-23) is used to cleave at a site on the mRNA molecule to be detected, resulting in a short mRNA fragment with nucleotide length 26 nt (x=26), a DNAzyme itself with nucleotide length 41 nt (y=41), and a DNAzyme with two arms of 13 nt.

In some embodiments, a modified DNAzyme (10-23) is used to cleave at a site on the mRNA molecule to be detected, resulting in a short mRNA fragment with nucleotide length 26 nt (x=26), a DNAzyme itself with nucleotide length 43 nt (y=43), and a DNAzyme with two arms of 14 nt.

In some embodiments, a modified DNAzyme (10-23) is used to cleave at a site on the mRNA molecule to be detected, resulting in a short mRNA fragment with nucleotide length 26 nt (x=26), a DNAzyme itself with nucleotide length 45 nt (y=45), and dnazymes with two arms each 15 nt.

Further, the capping method of the mRNA to be detected includes enzymatic capping or transcription co-capping of the cap analogue.

In some embodiments, the capping method of the mRNA to be detected is enzymatic capping; in some embodiments, the capping method of the mRNA to be detected transcribes the co-cap for the cap analog.

Further, the application designs a series of deoxyribozymes, the sequence of which is shown as SEQ ID NO: 7. SEQ ID NO: 8. SEQ ID NO: 9. SEQ ID NO: 10. SEQ ID NO: 11. In some embodiments, the sequence of the deoxyribose enzyme is set forth in SEQ ID NO: shown at 10.

Further, the method of cleavage in the method of detecting mRNA capping efficiency is: the RNA to be detected is mixed with deoxyribozyme and annealed, the annealing procedure is that the RNA is pre-denatured for 1 min at 85 ℃, and the RNA is reacted for 3 h at 37 ℃.

In another aspect, the application also provides a deoxyribozyme, the sequence of which is shown in SEQ ID NO: 9. SEQ ID NO:10 or SEQ ID NO: 11.

In another aspect, the application also provides an mRNA capping efficiency test kit comprising a nucleic acid sequence as set forth in SEQ ID NO: 9. SEQ ID NO: 10. SEQ ID NO:11, and one or more deoxyribozymes shown in FIG. 11.

The application designs DNAzyme (10-23) according to the sequence of the 5' -end UTR region of mRNA to be detected; then, mRNA molecules were site-directed cleaved using DNAzyme (10-23); finally, the reaction mixture was directly put on a machine, and the molecular weight and the relative proportion of the sheared mRNA product were detected by capillary electrophoresis, thereby determining the capping efficiency. When mRNA is capped, because of the difference of capping efficiency of mRNA, capped mRNA and uncapped mRNA exist in the system, after specific DNAzyme (10-23) is used for site-directed shearing of mRNA, the capped mRNA and uncapped mRNA in the system can generate molecular weight difference through capillary electrophoresis analysis, namely the capped mRNA increases the molecular weight, and the capping efficiency is obtained according to the relative ratio of the capped mRNA to the total mRNA (capped mRNA and uncapped mRNA).

According to the method for detecting mRNA capping efficiency, a deoxyribozyme (10-23) x-y is designed according to an RNA sequence to be detected, the DNA molecule to be detected is cut by the deoxyribozyme, the cut 5' -end RNA capping fragment product can be clearly separated and quantified from other fragment products and the deoxyribozyme on capillary electrophoresis, the mRNA capping efficiency is detected by the capillary electrophoresis apparatus, and the capping efficiency is determined, wherein x represents the number of mRNA short fragment nucleotides generated after cutting, y represents the number of deoxyribozyme self nucleotides, and y is an integer greater than or equal to 37. The method is simpler, the cost is lower, and the detection equipment is easy to obtain.

Examples

The application will be more readily understood by reference to the following examples, which are provided to illustrate the application and should not be construed to limit the scope of the application in any way.

Unless defined otherwise or the context clearly indicates otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. It should be understood that any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application.

All materials or instruments used herein are commercially available unless otherwise defined or the context clearly dictates otherwise.

Although the present application has been described in detail with reference to the embodiments thereof, these embodiments are provided for the purpose of illustration and not limitation of the application. Other embodiments that can be obtained according to the principles of the present application fall within the scope of the application as defined in the claims.

DNAzyme (10-23) enzyme active center is composed of 15 deoxyribonucleotide sequences, namely a 10-23 motif (motif) -5'-GGCTAGCTACAACGA-3', the active center is provided with substrate binding regions at two ends, the length of the active center is generally 7-12 nt, the active center and target mRNA are specifically bound through Watson-Crick base pairing, the sequence of the active center can be changed according to the difference of substrate mRNA, cleavage sites are positioned in phosphodiester bonds between unpaired purine and paired pyrimidine on the mRNA molecules, and the yield of the active center can be calculated according to the peak area of the active center due to the difference of molecular weight of single nucleotide between small fragment products after 5' -end cleavage in capped mRNA and uncapped mRNA cleavage products. The cutting principle is shown in figure 1.

The experimental materials and the instruments in the embodiment of the application comprise:

1. t7 HighYield RNATranscription Kit, vazyme (south genitals biotechnology Co., ltd.);

2、GTP，Vazyme；

3、10×Capping Buffer ;

4、Vaccinia Capping Enzyme，Vazyme；

5、mRNA Cap 2’-O-Methyltransferase，Vazyme；

6. SAM (S-adenosylmethionine), vazyme;

7. DNase I (DNase 1), vazyme;

8. co-transcribed capped T7 in vitro transcription reagent (Cap GAG) WHan Han Hai New enzyme Biotechnology Co., ltd;

9、 CleanCap@ AG，TriLink；

10. UltraPure ™ is DNase/RNase free distilled water, invitrogen ™;

11. Tris-HCl (Tris (hydroxymethyl) aminomethane), invitrogen ™;

12. LiCl precipitation solution (7.5M), invitrogen ^TM ；

13、MgCl ₂ ，Ambion™；

14. High resolution clip (S1), cat No. C105202, optical ancient cooking vessel biotechnology (Jiangsu) limited;

15. qsep1 Plus portable capillary electrophoresis apparatus, optical tripod biotechnology (Jiangsu) Co., ltd;

materials and instruments, if not specifically identified, are commercially available, and all DNAzyme and oligonucleotides are synthesized by general biosystems (anhui) inc.

Example 1: synthesis of uncapped mRNA

This example utilizes in vitro transcription to synthesize uncapped mRNA. After linearizing the transcription template plasmid using a restriction endonuclease, in vitro transcription of the RNA was initiated by T7 RNA polymerase, yielding uncapped mRNA. The reaction system is shown in Table 1. Using T7 High Yield RNA Transcription Kit, vazyme (south genipran biotechnology, inc.), cat No.: DD4201 is transcribed and specific procedures are described herein.

。

After the reagents in Table 1 were mixed uniformly, incubated at 37℃for 2 h, and after the reaction was completed, 1. Mu.l of the kit-carrying DNase I was added thereto and digested at 37℃for 30 minutes to remove the template.

The post-transcriptional purification was performed as follows;

(1) According to 1: adding 7.5M LiCl according to a volume ratio, uniformly mixing, standing at-20 ℃ for 30 min, centrifuging at 12000 rpm for 10 min, observing the sediment at the bottom, and removing the supernatant;

(2) The precipitate was blown down to suspension by adding 1 ml pre-chilled 70% ethanol. 12000 Centrifuging at rpm for 5 min, and removing supernatant;

(3) Repeating the previous step;

(4) Removing supernatant completely, uncovering, air drying at 37deg.C for 5 min, adding RNase-free ddH after precipitation and drying ₂ O dissolves the precipitate sufficiently to give uncapped mRNA.

Example 2: enzymatic two-step capping process for preparing capped mRNA

This example utilizes an enzymatic two-step capping process to prepare capped mRNA. Capped mRNA was obtained by co-capping with Vaccinia Capping Enzyme (Vazyme, cat# 10615) and mRNA Cap 2' -O-methyl transfer ferase (Vazyme, cat# DD 4110-PC-01).

10. Mu.g of the mRNA purified in the above example 1 was denatured at 65℃for 5 min, immediately placed on ice for 5 min, and then a capping reaction system was prepared as shown in Table 2.

。

After mixing the reagents in Table 2 above, each incubation was performed at 37℃for 30 min,60 min,120 min and DNase I1. Mu.l (Vazyme, cat# DD 4104-PC-03) was added thereto

37. Digestion is carried out at the temperature of 30 min to remove the template.

And then carrying out post-transcriptional purification according to the following steps:

(3) Repeating the previous step;

(4) Removing supernatant completely, uncovering, air drying at 37deg.C for 5 min, adding RNase-free ddH after precipitation and drying ₂ O is fully dissolved and precipitated, and capped mRNA with different capping rates is obtained.

Example 3: co-transcription process for preparing capped mRNA

This example uses a co-transcription method to prepare capped mRNA. After linearizing the transcription template plasmid using restriction enzymes, in vitro transcription of the RNA was initiated by T7 RNA polymerase, following the co-transcription reaction system of table 3, cap analogues were additionally supplemented to obtain co-transcribed capped mRNA. The use of co-transcriptional capped T7 in vitro transcription reagent (Cap GAG) Wuhan Han New enzyme Biotechnology Co., ltd.: HBP001510 is capped, and specific operation is shown in the specification.

。

Each of the samples was prepared at Cap analog final concentrations of 1,2,4, and 8 mM.

After the reagents in Table 3 above were mixed well, incubated at 37℃for 2 h, and after the reaction was completed, the kit was digested from 2. Mu.l of DNase I at 37℃for 30 min to remove the DNA plasmid template. And then carrying out post-transcriptional purification according to the following steps:

(3) Repeating the previous step;

(4) Removing supernatant completely, uncovering, air drying at 37deg.C for 5 min, adding RNase-free ddH after precipitation and drying ₂ O is fully dissolved and precipitated, and mRNA samples with different capping rates are obtained.

Example 4: DNAzyme (10-23) cleavage site design

The cleavage site selected in this example is located within 100 bases of the 5' -end (SEQ ID NO: 1).

SEQ ID NO：1：

The binding arms at the x-y ends of DNAzyme (10-23) were designed according to different cleavage sites, and y was fixed at 35 (y=35), i.e. 35 bases or nucleotides of DNAzyme itself were fixed, in order to compare qualitatively the differences of different cleavage sites. Since the DNAzyme (10-23) catalytic core was immobilized 15 nt, the total arm length of the two ends of DNAzyme (10-23) x-35 designed in this example was 20 nt, and the specifically designed DNAzyme (10-23) x-35 sequence is shown in Table 4.

。

Uncapped mRNA from example 1 was cleaved using DNAzyme (10-23) x-35 shown in Table 4, respectively, and the specific annealing reaction system is shown in Table 5, and the annealing procedure was 85℃for 1 min and 37℃for 3 h. After the reaction was completed, the apparatus was set to maintain 4 ℃.

。

As a result, as shown in FIG. 2 (capillary electrophoresis chart), when the same mass of mRNA substrate and DNAzyme (10-23) x-35 were dosed, only DNAzyme (10-23) 26-35 was able to detect a small amount of 5' -end cleavage product peak, but since it was too close to the peak of DNAzyme (10-23) 26-35 ribozyme itself, the 5' -end cleavage product peak was difficult to distinguish from the peak of DNAzyme (10-23) 26-35 ribozyme itself, the 5' -end cleavage product peak was difficult to read, and was unfavorable for quantitative analysis, and thus further optimization was emphasized.

Example 5: design of DNAzyme (10-23) 26-y

This example further designed the two arms of the deoxyribose enzyme on the basis of the determination of x=26. Comprising the following steps: DNAzyme (10-23) 26-35, namely the number of mRNA short fragment nucleotides generated after cutting is 26, the number of deoxyribose nucleic acid itself is 35, and the arm lengths of two ends are 10 nt; DNAzyme (10-23) 26-37, namely, the number of mRNA short fragment nucleotides generated after cutting is 26, the number of deoxyribose nucleic acid itself is 37, and the arm lengths of two ends are 11 nt: DNAzyme (10-23) 26-39, namely the number of mRNA short fragment nucleotides generated after cutting is 26, the number of deoxyribose nucleic acid per se is 39, and the arm lengths of two ends are 12 nt; DNAzyme (10-23) 26-41, namely the number of mRNA short fragment nucleotides generated after cutting is 26, the number of deoxyribose nucleic acid itself is 41, and the arm lengths of two ends are 13 nt; DNAzyme (10-23) 26-43, namely the number of mRNA short fragment nucleotides generated after cutting is 26, the number of deoxyribose nucleic acid itself is 43, and the arm lengths of two ends are 14 nt; and DNAzyme (10-23) 26-45, namely, the number of mRNA short fragment nucleotides generated after cleavage is 26, the number of deoxyribose nucleic acid itself is 45, and the arm lengths of two ends are 15 nt. Uncapped mRNA generated in example 1 was cleaved using DNAzyme (10-23) x-35 shown in Table 6, respectively, and the experimental procedure was as described in example 4. The ribozyme sequences are shown in Table 6. The effect of each DNAzyme (10-23) 26-y on mRNA cleavage efficiency is shown in FIG. 3, and the normalized peak area of each DNAzyme (10-23) 26-y in FIG. 3 is shown in Table 7.

。

With the same mass of mRNA substrate addition and DNAzyme (10-23) addition as shown in fig. 3, when y=37, i.e., when DNAzyme (10-23) has a homology arm length of 11 nt, the primer dimer (by-product) is also gradually reduced as compared with the separation of the y= 35,5' -end cleavage product peak from DNAzyme (10-23) peak, within a certain range, as DNAzyme (10-23) has a homology arm length of 12 nt, the distance between the 5' -end cleavage product peak and DNAzyme (10-23) peak is further and further increased, facilitating the discrimination and reading of the 5' -end cleavage product peak, and as DNAzyme (10-23) has a homology arm length of 12 nt, the primer dimer is also gradually reduced. It can be seen from table 7 that when y=37, i.e. when DNAzyme (10-23) has a homology arm length of 11 nt, the integral area of the peak of the cleavage product at the 5 '-end is significantly increased compared with y= 35,5', i.e. the cleavage product at the 5 '-end is significantly increased, whereas DNAzyme (10-23) 26-43 can be clearly separated on a capillary electrophoresis apparatus, can be subjected to subsequent quantitative analysis, and has a peak area of the cleavage product at the 5' -end of the peak of the DNAzyme of maximum, and has higher cleavage activity, so that the DNAzyme is selected for further capping rate test.

Example 6: capping efficiency test for two-step enzymatic capping for different times

Cleavage of mRNA obtained in example 2 after two-step enzymatic capping for various times using DNAzyme (10-23) 26-43, cleavage procedure was performed with reference to example 4 and detection was performed using capillary electrophoresis patterns, which are shown in FIG. 4, indicating peak of DNAzyme (10-23) 26-43, and the uncapped mRNA was treated with DNAzyme and cleaved at the 5' -UTR end to give a short fragment product (-gapped); the Capped mRNA was treated with DNAzyme and its 5' -UTR end was cleaved to give a short fragment (+gapped); the capping efficiency tended to increase with capping time (0 min, 30 min,60 min,120 min) with the same amount of mRNA substrate added as shown in table 8 below, with an increase in molecular weight of one Cap1 structure compared to uncapped mRNA.

。

Example 7: capping efficiency test for co-transcribing different cap analogue concentrations

Cleavage of mRNA obtained in example 3, which was co-transcribed and Capped by different cap analogue concentrations, using DNAzyme (10-23) 26-43, the cleavage procedure was described in example 4 and examined by capillary electrophoresis, when the starting base of mRNA used was GG-headed and co-transcribed and Capped by AG cap analogue, the capping efficiency was generally around 50%, the profile of which is shown in FIG. 5, indicating DNAzyme (10-23) 26-43 peaks, and the uncapped mRNA was cleaved at the 5' -UTR end (-Capped) after DNAzyme treatment; the Capped mRNA was DNAzyme treated to cleave the short fragment product (+gapped) at its 5' -UTR end; as shown in table 9 below, the capping efficiency increased with increasing Cap analogue concentration (0 mM, 1 mM, 2 mM, 4 mM, 8 mM) with the same mass of uncapped mRNA substrate loading, by increasing the molecular weight of one Cap1 structure compared to uncapped mRNA. Under the condition of the same mass substrate and dosage, the capping efficiency is calculated according to the proportion of the peak area of the short-segment product after the 5 '-end of the capped mRNA is cut to the peak area of the short-segment product after the 5' -end of the capped mRNA (capped mRNA and uncapped mRNA) to the peak area of the total mRNA. When the mRNA starting base used was AG at the beginning and co-transcribed capping was performed with AG cap analogues, the capping efficiency reached 100% as shown in Table 10 below.

。/>

。

In summary, the application designs and screens optimal DNAzyme (10-23) x-y according to the mRNA sequence to be detected, uses DNAzyme (10-23) x-y to efficiently cut mRNA molecules in the 5'-UTR region at fixed points, detects the molecular weight of the short mRNA fragments at the 5' end after cutting and the relative proportion of capping fragments to uncapped fragments by using a capillary electrophoresis method, thereby calculating the capping efficiency, realizing quantitative detection of the mRNA capping efficiency, avoiding radioactive labeling, avoiding radioactive pollution, avoiding expensive mass spectrometry equipment, and having simple operation, low cost and easy realization.

Claims

1. A method of detecting RNA capping efficiency comprising the steps of:

1) Processing the RNA with a deoxyribozyme 10-23DNAzyme to generate an RNA fragment with a cap structure and a corresponding RNA fragment without the cap structure; and

wherein the two binding arm lengths of the deoxyribozymes 10-23DNAzyme are independently selected from 11, 12, 13, 14 and 15 nt.

2. The method of claim 1, wherein the RNA is mRNA.

3. The method of claim 1, wherein the two binding arms of the deoxyribose nucleic acid 10-23DNAzyme are equal in length.

4. The method of claim 1, wherein the RNA fragment is 26 nt in length.

5. The method of claim 1, wherein whether the RNA fragment carries the cap structure is determined by a molecular weight difference.

6. The method of claim 1, wherein the proportional relationship is determined by capillary electrophoresis.

7. The method of claim 1, wherein the cap structure is located at the 5' end of the RNA.

8. The method of claim 7, wherein the Cap structure is selected from the group consisting of Cap O, cap I, and Cap II type structures.

9. The method of claim 1, wherein the mRNA comprises SEQ ID NO:1, and the deoxyribozyme 10-23DNAzyme comprises a sequence shown in SEQ ID NO: 7. 8, 9, 10 and 11.

10. The method of claim 9, wherein step 1) comprises pre-denaturing the RNA with the deoxyribose nucleic acid 10-23DNAzyme at 85 ℃ for 1 min followed by reaction at 37 ℃ for 3 h.