CN116875474A - Engineering bacterium for synthesizing resveratrol by utilizing p-coumaric acid, construction and application - Google Patents

Engineering bacterium for synthesizing resveratrol by utilizing p-coumaric acid, construction and application Download PDF

Info

Publication number
CN116875474A
CN116875474A CN202310691519.8A CN202310691519A CN116875474A CN 116875474 A CN116875474 A CN 116875474A CN 202310691519 A CN202310691519 A CN 202310691519A CN 116875474 A CN116875474 A CN 116875474A
Authority
CN
China
Prior art keywords
coa
resveratrol
mutant
acetyl
genetically engineered
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310691519.8A
Other languages
Chinese (zh)
Inventor
吴元庆
杨志彬
冯斌
李迪
胡江林
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hebei Weidakang Biotechnology Co ltd
Original Assignee
Hebei Weidakang Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hebei Weidakang Biotechnology Co ltd filed Critical Hebei Weidakang Biotechnology Co ltd
Priority to CN202310691519.8A priority Critical patent/CN116875474A/en
Publication of CN116875474A publication Critical patent/CN116875474A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/22—Preparation of oxygen-containing organic compounds containing a hydroxy group aromatic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses engineering bacteria for synthesizing resveratrol by utilizing p-coumaric acid, construction and application thereof, and belongs to the technical field of biology. According to the invention, the encoding genes of the 4-coumaroyl-CoA ligase mutant and/or the encoding genes of the resveratrol synthase mutant and the encoding genes of the acetyl-CoA carboxylase and/or the encoding genes of the acetyl-CoA synthase are expressed, and on the basis of obviously improving the catalytic activities of the 4-coumaroyl-CoA ligase and the resveratrol synthase respectively, the obtained yarrowia lipolytica engineering bacteria can efficiently utilize p-coumaric acid to produce resveratrol by enhancing the expression of the acetyl-CoA and malonyl-CoA, the shake flask fermentation yield reaches 2.4g/L, the batch fed fermentation substrate conversion rate reaches 96.3% and the resveratrol yield reaches 47.8g/L in a 5L fermentation tank.

Description

Engineering bacterium for synthesizing resveratrol by utilizing p-coumaric acid, construction and application
Technical Field
The invention belongs to the technical field of biology, and relates to engineering bacteria for synthesizing resveratrol by utilizing p-coumaric acid, construction and application.
Background
Resveratrol is a natural plant polyphenol compound, has the biological activities of anti-inflammatory, antibacterial, anticancer, anti-aging and the like, and has great potential in the application fields of health care products, foods and cosmetics. At present, the production of resveratrol mainly depends on chemical synthesis and plant extraction. The chemical synthesis is difficult to popularize due to the serious pollution, toxic byproduct residues and other safety problems; the plant extraction is mainly obtained by extracting plants such as peanuts, grapes and the like, but the steps are complicated, the product yield is low, and a large amount of natural resources are consumed. Therefore, microbial production of resveratrol is a very potential alternative, considering environmental and economic benefits.
At present, with the progress of microorganism metabolic engineering and synthetic biology technology, efficient heterologous synthesis approaches are designed and constructed in hosts such as escherichia coli and saccharomyces cerevisiae, and industrial production of plant source rare natural products such as resveratrol can be realized by combining large-scale fermentation of engineering strains. The invention aims to provide engineering bacteria capable of effectively utilizing p-coumaric acid to synthesize resveratrol and application thereof, and provides support for large-scale industrialized production of resveratrol.
Disclosure of Invention
The invention provides construction and application of recombinant genetically engineered bacteria for synthesizing resveratrol by utilizing p-coumaric acid, which can be used for efficiently synthesizing resveratrol by taking p-coumaric acid as a substrate.
In order to achieve the above purpose, the invention adopts the following technical scheme:
in a first aspect, the present invention provides a recombinant genetically engineered bacterium, the recombinant genetically engineered bacterium comprising an expression vector of a gene encoding a 4-coumaroyl-coa ligase mutant and/or a gene encoding a resveratrol synthase mutant and a gene encoding an acetyl-coa carboxylase and/or a gene encoding an acetyl-coa synthase, or having integrated in its genome a gene encoding a 4-coumaroyl-coa ligase mutant and/or a gene encoding a resveratrol synthase mutant and a gene encoding an acetyl-coa carboxylase and/or a gene encoding an acetyl-coa synthase, wherein the gene encoding a 4-coumaroyl-coa ligase mutant and/or the gene encoding a resveratrol synthase mutant may be expressed separately or may be constructed as a fusion protein by fusion expression.
According to the scheme, the recombinant genetically engineered bacteria are yarrowia lipolytica engineering bacteria.
According to the above protocol, the acetyl-CoA carboxylase and acetyl-CoA synthetase are derived from yarrowia lipolytica endogenous enzymes.
According to the scheme, the coding gene sequence of the acetyl-CoA carboxylase is shown as SEQ ID NO. 9; the coding sequence of the acetyl-CoA synthetase is shown as SEQ ID NO. 10.
The amino acid sequence of the 4-coumaroyl-CoA ligase mutant provided by the invention is mutated from the sequence shown in SEQ ID NO.1, and the mutation occurs at one or more amino acid residue sites selected from the group consisting of: 260, 328, 330, 333, 338, 351, 353, 363, 364, 378, 381, 442, 451, 452, 453, 457, 460, 492, 498, i.e., one or more of these sites is mutated to any one of the other amino acids except the original amino acid;
preferably, the mutation mode of each site in the 4-coumaroyl-CoA ligase mutant is as follows: Y260F, S328V, A330 333M, E338R, G351 353C, L363A, A S, S37378P, C381V, I V, L451F, F452D, I453V, L457M, L460M, K492 32498Q.
The resveratrol synthase mutant provided by the invention has an amino acid sequence which is mutated from a sequence shown in SEQ ID NO. 2, and is mutated at one or more amino acid residue sites selected from the following groups: 51, 54, 57, 59, 61, 62, 203, 204, 205, 208, 252, 254, 265, 266, 267, 268, 269, 270, 273, 276, 307, 312, 313, 315.
Preferably, the resveratrol synthase mutant is mutated in the following way: the method comprises the steps of providing the alloy material with the dimensions of E51D, K54E, N57K, I M, D, 62S, E203Q, D S, E4535 5235 205H, S C, G252 5689C, I, V, F265C, H266 267M, W268L, P269K, N270D, T273G, S276 307H, A312Q, V313I, A S.
The 4-coumaroyl-CoA ligase mutant and the resveratrol synthase mutant can be obtained by a plasmid amplification mutagenesis method.
The term "expression vector" in the present invention refers to bacterial plasmids, yeast plasmids or other vectors well known in the art. Those skilled in the art can use well known methods for constructing expression vectors, such as, for example, restriction enzyme ligation, seamless gram Long Fa.
The invention can be used for transforming host cells by using the coding genes of the 4-coumaroyl-CoA ligase mutant and/or the resveratrol synthase mutant and the coding genes of acetyl-CoA carboxylase and/or the coding genes of acetyl-CoA synthetase and an expression vector so as to express the 4-coumaroyl-CoA ligase mutant and/or the resveratrol synthase mutant protein and the acetyl-CoA carboxylase protein and/or the acetyl-CoA synthetase protein.
The host cells of the present invention include host cells comprising the above-described expression vector or the coding sequence for the 4-coumaroyl-CoA ligase mutant and/or resveratrol synthase mutant of the present invention and acetyl-CoA carboxylase and/or acetyl-CoA synthetase integrated into the genome.
The host cell or the strain can efficiently express 4-coumaroyl-CoA ligase and/or resveratrol synthase mutant enzyme with high catalytic performance, and enhance the expression of acetyl-CoA and malonyl-CoA.
The host cell of the invention may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells. The host cell may specifically be a bacterium or a yeast; preferably, the host cell is E.coli (Escherichia coli), saccharomyces cerevisiae (Saccharomyces cerevisiae), pichia pastoris (Pichia pastoris), hansenula polymorpha (Hansenula polymorpha), and yarrowia lipolytica (Yarrowia lipolytica); more preferably, the host cell is yarrowia lipolytica.
In a second aspect, the present invention provides a method for obtaining recombinant genetically engineered bacteria: transferring an expression vector containing the coding gene of the 4-coumaroyl-CoA ligase mutant and/or the coding gene of the resveratrol synthase mutant and the coding gene of the acetyl-CoA carboxylase and/or the coding gene of the acetyl-CoA synthetase into a host cell to obtain the recombinant vector. When the recombinant genetically engineered bacterium contains both the coding gene of the 4-coumaroyl-CoA ligase mutant and the coding gene of the resveratrol synthase mutant, the two genes can be expressed independently or can be obtained by constructing fusion proteins through fusion expression. For example, the 4-coumaroyl-CoA ligase mutant and the resveratrol synthase mutant are connected through a connecting peptide to carry out fusion expression to construct a fusion protein. Preferably, the connecting peptide is GPGPGPGP or GPGPGPGPGPGPGPGP.
According to the above protocol, the host cell is yarrowia lipolytica.
In a third aspect, the invention provides an application of the recombinant genetically engineered bacterium in resveratrol production.
Compared with the prior art, the invention has the following advantages:
according to the invention, the coding genes of the 4-coumaroyl-CoA ligase mutant and/or the resveratrol synthase mutant and the coding genes of the acetyl-CoA carboxylase and/or the coding genes of the acetyl-CoA synthase are expressed, and the substrate conversion rate and the final yield of resveratrol are obviously improved by enhancing the expression of the acetyl-CoA and the malonyl-CoA on the basis of obviously improving the catalytic activities of the 4-coumaroyl-CoA ligase and the resveratrol synthase respectively, and the yield of the resveratrol by the engineering bacterium bioconversion is up to 47.8g/L, and the substrate conversion rate can be up to 96.3%.
Drawings
FIG. 1 is a graph showing the results of whole cell catalytic production of resveratrol by 4CL1 mutant strain.
FIG. 2 is a graph showing the results of whole cell catalytic production of resveratrol by VST1 mutant strain.
FIG. 3 is a diagram of pINA1312-4CL1 (M4) -8GP-VST1 (N3) plasmid vector.
FIG. 4 is a graph showing the results of fermentation of yarrowia lipolytica engineering bacteria to produce resveratrol.
FIG. 5 is a graph showing the results of resveratrol production by strains expressing acetyl-CoA carboxylase.
FIG. 6 is a graph showing the results of resveratrol production by strains expressing acetyl-CoA synthetase.
FIG. 7 is a graph showing the results of batch fed-batch fermentation of yarrowia lipolytica engineering bacteria to produce resveratrol.
Detailed Description
A first part: construction of engineering strains of yarrowia lipolytica with high resveratrol yield without enhanced intracellular acetyl-CoA, malonyl-CoA supply
EXAMPLE 14 construction of high-efficiency mutant of coumaroyl-CoA ligase (4 CL 1)
(1) PCR was performed using pRSFDuet-1 vector as a template and primers P1-F and P1-R, the sequences of which are shown in Table 1. The pRSFDuet-1 vector was a commercial vector purchased from Novagen. Obtaining a linearization vector pRSFDuet-1 after the PCR product is recovered, wherein the size of a linearization vector fragment is 3471bp;
(2) The artificially synthesized 4CL1 gene after codon optimization is used as a template, and PCR amplification is performed by using primers 4CL1-F and 4CL1-R, wherein the sequences of the primers are shown in Table 1. The amplification product is recovered to obtain a target fragment of the 4CL1 gene, the fragment size is 1716bp, and the nucleotide sequence of the 4CL1 gene is shown as SEQ ID NO. 3;
(3) The artificially synthesized VST1 gene after codon optimization is used as a template, and primers VST1-F and VST1-R are used for PCR amplification, wherein the sequences of the primers are shown in Table 1. Recovering the amplification product to obtain a target fragment of the VST1 gene, wherein the fragment size is 1209bp, and the nucleotide sequence of the VST1 gene is shown as SEQ ID NO. 4;
(4) PCR was performed using pRSFDuet-1 vector as a template and primers P2-F and P2-R, the sequences of which are shown in Table 1. The target fragment T7pro is obtained after the PCR product is recovered, and the fragment size is 171bp;
(5) Connecting the 4CL1, VST1 and T7pro target fragment with a linearization vector pRSFDuet-1 by using a ClonExpress II one-step cloning kit to obtain a recombinant plasmid pRSFDuet-4CL1-VST1, and obtaining a recombinant plasmid successfully constructed by sequencing and verifying to be correct;
(6) Transforming plasmid pRSFDuet-4CL1-VST1 into escherichia coli expression host bacterium BL21 (DE 3) by using an electrotransformation method, coating the plasmid pRSFDuet-4CL1-VST1 on an LB solid culture medium containing kanamycin, culturing an LB plate at 37 ℃ until a transformant grows out, and picking a positive transformant to obtain wild type engineering bacteria (WT);
(7) The constructed pRSFDuet-4CL1-VST1 plasmid is used as a template, primers are designed to carry out plasmid amplification mutagenesis to obtain a linearized plasmid vector with base mutation, the linearized plasmid vector is transformed into escherichia coli BL21 (DE 3), and the plasmid with the base mutation is obtained after in vivo repair cyclization, specifically comprising the following steps: PCR amplification was performed using primers 4CL1-M1-F and 4CL1-M1-R, the primer sequences being shown in Table 1, and mutant sequences were obtained. The mutation mode is as follows:
Y260F/S328V/A330S/L333M/E338R. The plasmid of the obtained expression mutant is named pRSFDuet1-4CL1 (M1) -VST1, and the obtained mutant engineering bacterium is named M1;
(8) PCR was performed using the constructed pRSFDuet1-4CL1 (M1) -VST1 plasmid as a template and primers 4CL1-M2-F and 4CL1-M2-R, the sequences of which are shown in Table 1, to obtain mutant sequences. The mutation mode is as follows: L363A/A364S/S378P/C381V. The plasmid of the obtained expression mutant is named pRSFDuet1-4CL1 (M2) -VST1, and the obtained mutant engineering bacterium is named M2;
(9) As in step 8, PCR amplification was performed using the constructed pRSFDuet1-4CL1 (M2) -VST1 plasmid as a template and the primers 4CL1-M3-F and 4CL 1-M3-R. The mutation mode is as follows:
G351S/G353C/L451F/F452D/I453V/L457M/L460M. Obtaining mutant plasmids
pRSFDuet1-4CL1 (M3) -VST1, mutant engineering bacterium M3;
(10) As in step 8, PCR amplification was performed using the constructed pRSFDuet1-4CL1 (M3) -VST1 plasmid as a template and the primers 4CL1-M4-F and 4CL 1-M4-R. The mutation mode is as follows: I442V/K492P/E498Q. Mutant plasmid pRSFDuet1-4CL1 (M4) -VST1, mutant engineering bacterium M4 was obtained. The amino acid sequence of the 4CL1 (M4) is shown as SEQ ID NO. 5;
(11) Culturing wild type engineering bacteria and mutant engineering bacteria overnight in a seed culture medium containing 50 mug/mL kanamycin to obtain a seed solution, wherein the seed culture medium (mass percent) comprises 1% tryptone, 1% sodium chloride and 0.5% yeast extract, and the culture condition of the seed solution is 37 ℃ and 220rpm;
(12) Inoculating the seed solution to a solution containing 1.2% tryptone, 2.4% yeast extract, 0.4% glycerol, and 0.231% KH at 2% 2 PO 4 And 1.254% K 2 HPO 4 In the protein expression medium (mass percent) of (B), the culture conditions were 37℃and 220rpm. After 3h of culture, adding IPTG with the final concentration of 0.5mM for induction expression, wherein the induction expression condition is 25 ℃,220rpm, and the induction time is 16h;
(13) After the protein induction expression is finished, centrifuging at 4000rpm for 20min at room temperature to collect thalli, washing thalli with sterile 0.9% physiological saline, and centrifuging again; suspending the cells with a volume of the transformation solution to a resuspension OD 600 10. 10mL of the system was taken for whole cell catalysis. The reaction conditions were 30℃and 150rpm, and the reaction time was 3 hours. The conversion liquid comprises the following components: 10g/L glucose, 10g/L glycerol, 6g/L Na 2 HPO 4 ，0 5g/L NaCl，3g/L KH 2 PO 4 ，1g/LNH 4 Cl，246.5mg/L MgSO 4 ·7H 2 O，14.7mg/L CaCl 2 ·2H 2 O，27.8mg/L FeSO 4 ·7H 2 O,200mg/L p-coumaric acid;
(14) After the reaction, 0.5mL of reaction solution is fully mixed with 1mL of methanol, and the mixture is centrifuged for 2min at 12000rpm and filtered into a liquid phase bottle by using a 0.22 mu m filter membrane for high performance liquid chromatography detection;
(15) High performance liquid chromatography detects resveratrol: the chromatographic column is C18 (250 mm 4.6mm,5 μm) or equivalent chromatographic column, the mobile phase is acetonitrile and 1% acetic acid solution (gradient elution condition: 5% acetonitrile 5min,5-50% acetonitrile 15min,50% acetonitrile 5min,50-5% acetonitrile 2 min), the flow rate is 1mL/min, the sample injection amount is 10 μL, resveratrol is detected at the temperature of a column temperature box of 25 ℃, and the content is determined by an external standard method;
(16) As shown in FIG. 1, compared with the Wild Type (WT) strain, the capacity of the 4CL1 mutant strain for producing resveratrol is improved by 249.6%, and the yield reaches 81.1mg/L;
the single mutant of 4-coumaroyl-CoA ligase is not limited to any of the mutations at positions 260, 328, 330, 333, 338, 351, 353, 363, 364, 378, 381, 442, 451, 452, 453, 457, 460, 492 and 498, and has an effect of improving the enzyme activity. The multiple mutants of the 4-coumaroyl-CoA ligase are not limited to mutants M1, M2, M3 and M4 and the multiple mutants of the 4-coumaroyl-CoA ligase in Table 3, and the multiple 4-coumaroyl-CoA ligase mutant engineering bacteria constructed based on the sites can also have the effect of improving the catalytic activity.
Table 1.4CL1 mutant construction primer sequences
EXAMPLE 2 construction of resveratrol synthase (VST 1) high-efficiency mutant
The constructed pRSFDuet-4CL1 (M4) -VST1 plasmid is taken as a template, primers are designed to carry out plasmid amplification mutagenesis to obtain a linearized plasmid vector with base mutation, the linearized plasmid vector is transformed into escherichia coli BL21 (DE 3), and the plasmid with the base mutation is obtained after in vivo repair cyclization, specifically comprising the following steps:
(1) PCR was performed using the constructed pRSFDuet1-4CL1 (M4) -VST1 plasmid as a template and primers VST1-N1-F and VST1-N1-R, the primer sequences being shown in Table 2, to obtain mutant sequences. The mutation mode is as follows: E51D/K54E/N57K/I59M/D61Q/K62S/P307H/A312Q/V313I/A315S. The plasmid of the obtained expression mutant is named pRSFDuet1-4CL1-VST1 (N1), and the obtained mutant engineering bacterium is named N1;
(2) PCR was performed using the constructed pRSFDuet1-4CL1-VST1 (N1) plasmid as a template and primers VST1-N2-F and VST1-N2-R, the sequences of which are shown in Table 2, to obtain mutant sequences. The mutation mode is as follows: G252C/I254V/F265C/H266D/L267M/W268L/P269K. The plasmid of the obtained expression mutant is named pRSFDuet1-4CL1-VST1 (N2), and the obtained mutant engineering bacterium is named N2;
(3) In the same manner as in step 2, PCR amplification was performed using the constructed pRSFDuet1-4CL1-VST1 (N2) plasmid as a template and the primers VST1-N3-F and VST 1-N3-R. The mutation mode is as follows: E203Q/D204T/A205H/S208C/N270D/T273G/S276D. The mutant plasmid pRSFDuet1-4CL1-VST1 (N3), mutant engineering bacterium N3 was obtained. The amino acid sequence of VST1 (N3) is shown as SEQ ID NO. 6;
(4) The activity of the VST1 mutant engineering bacteria is detected by using a whole-cell catalysis mode, the specific method is shown in the example 1 (steps 11-15), and the result is that compared with a control strain M4, the capacity of the VST1 mutant engineering strain for producing resveratrol is improved by 117.4%, and the yield is up to 176.3mg/L;
the resveratrol synthase single mutant is not limited to any of the above-mentioned mutations at positions 51, 54, 57, 59, 61, 62, 203, 204, 205, 208, 252, 254, 265, 266, 267, 268, 269, 270, 273, 276, 307, 312, 313 and 315, and has an effect of improving the enzyme activity. The resveratrol synthase multiple mutants are not limited to the mutants N1, N2 and N3 and the resveratrol synthase multiple mutants in the table 3, and the multiple resveratrol synthase mutant engineering bacteria constructed based on the sites can also have the effect of improving the catalytic activity.
TABLE 2 construction of the primers sequences for the VST1 mutants
Table 3.4CL1, yield of resveratrol by other mutant strains of VST1
EXAMPLE 3 Co-expression of the 4CL1 (M4) and VST1 (N3) genes in yarrowia lipolytica
1) Construction of pINA1312-4CL1 (M4) -VST1 (N3) integration plasmid
The nucleotide codon preference of the 4-coumaroyl-coa ligase mutant 4CL1 (M4) gene and the resveratrol synthase mutant VST1 (N3) gene of examples 1 and 2 was e.coli, and the 4CL1 (M4) gene nucleotide described in example 1 was subjected to yarrowia lipolytica codon optimization to give a 4CL1 (M4) nucleotide sequence as shown in SEQ ID No.7, taking into account the codon suitability; the VST1 (N3) mutant nucleotide described in example 2 was codon-optimized to a VST1 (N3) nucleotide sequence as shown in SEQ ID NO.8, and the optimized 2 genes were synthesized by Wohan Jin Kairui bioengineering Co.
A) Amplifying a 4CL1 (M4) nucleotide fragment carrying 20bp homologous sequences of a pINA1312 vector skeleton at both ends by using hp4d-4CL1-F/xpr2-4CL1-R as a primer and taking 4CL1 (M4) nucleotide subjected to yarrowia lipolytica codon optimization as a template; similarly, using xpr2-F/hp4d-R as a primer and pINA1312 plasmid as a template to amplify to obtain a pINA1312-vector skeleton fragment, and using a ClonExpress II one-step cloning kit to connect the two fragments into a vector to construct the pINA1312-4CL1 (M4) plasmid.
B) In the same example, using hp4d-VST1-F/xpr2-VST1-R as primer, VST1 (N3) nucleotide after yarrowia lipolytica codon optimization as template was used to amplify a VST1 (N3) fragment carrying 20bp homologous sequence of pINA1312 vector backbone at both ends; the pINA1312-vector backbone fragment and the VST1 (N3) fragment are connected into a vector by using a ClonExpII one-step cloning kit, and the pINA1312-VST1 (N3) plasmid is constructed.
C) Amplifying with Xpr-1312-yz-up/Xpr2-Zeta-R as a primer and pINA1312-VST1 (N3) plasmid as a template to obtain an operon fragment containing hp4d-VST1-Xpr2, wherein both ends of the fragment respectively contain homologous sequences of 20bp at the ends of the carrier skeleton fragment; meanwhile, using Zeta-F1/Xpr2-R1 as a primer and pINA1312-4CL1 (M4) plasmid as a template, amplifying a skeleton fragment containing the full length of the pINA1312-4CL1 (M4) plasmid, and connecting the fragments by using a ClonExpress II one-step cloning kit to obtain the pINA1312-4CL1 (M4) -VST1 (N3) plasmid. The primers used above are shown in the following table:
primer name Sequence 5 '. Fwdarw.3'
hp4d-4CL1-F TACAACCACACACATCCACAATGGCACCCCAAGAACAAGC
xpr2-4CL1-R GGGACAGGCCATGGAGGTACTTAGAGACCATTCGCCAGCT
xpr2-F TAAGTACCTCCATGGCCTGTCC
hp4d-R TGTGGATGTGTGTGGTTGTATGTG
hp4d-VST1-F TACAACCACACACATCCACAATGGCATCAGTAGAGGAATT
xpr2-VST1-R GGGACAGGCCATGGAGGTACTTAATTGGTAACCGTCGGCA
Xpr-1312-yz-up CCCGTGTCCGAATTCCATGTGCTAGCTTATCGATACGCGT
xpr2-Zeta-R CTCTCCAGAGCGAGTGTTACCATCTCACTTGCGTATGTATGGAA
Zeta-F1 GTAACACTCGCTCTGGAGAG
Xpr2-R1 ACATGGAATTCGGACACGGG
2) Gene 4CL1 (M4) and VST1 (N3) transformed yarrowia lipolytica
Transformation of yarrowia lipolytica strains was performed essentially according to the Zymo Frozen-EZ Yeast Transformation kit II kit instructions, briefly described below:
linearization of the transformation fragment vector: the pINA1312-4CL1 (M4) -VST1 (N3) plasmid constructed in example 3 (1) was digested with NEB restriction enzymes, and the digestion system was as follows:
placing the prepared enzyme digestion system in a water bath of a water bath kettle at 37 ℃ for water bath treatment for 4 hours to obtain a plasmid linearization fragment, and reserving the plasmid linearization fragment for standby;
competent preparation: picking po1f monoclonal from a resuscitating plate, culturing in 1ml YPD culture medium at 30 ℃ under shaking at 250rpm overnight, removing supernatant when the OD value of bacterial liquid is as high as 1.0 and 500g of centrifugal cells are 4min, adding 1ml Solution 1 to resuspend cells, centrifuging and removing supernatant; 100ul of Solution 2 resuspended cells were added, and the yarrowia lipolytica competent cells obtained at this time were used directly for transformation.
Transformation of competent cells: mixing 50ul of competent cells with the linearized plasmid fragments, adding 500ul of Solution 3, completely mixing, placing in a water bath at 30deg.C, incubating for 45min, and mixing with light flick or low-speed vortex for 2-3 times during incubation; the incubation liquid is coated with a corresponding SD defect plate, the plate is placed to a 30 ℃ incubator for standing culture for 2-4 days to obtain the growth of the transformant, and the correct transformant is named as VST1-01.
Strain Genotype of the type
Po1f Wild type
VST1-01 Po1f，pINA1312-4CL1(M4)-VST1(N3)
3) Conversion of VST1-01 strain to coumaric acid to resveratrol
The VST1-01 strain constructed in example 3 (2) was selected for shaking fermentation of resveratrol strain, and the strain was selected for monoclone into a 3ml tube of YPD liquid medium (20 g/L peptone, 10g/L yeast powder, 20g/L glucose), cultured at 30℃overnight at 220rpm, and transferred to 50ml of YPD liquid medium (250)
A ml triangular flask) for 24 hours, 3g/L p-coumaric acid is added, fermentation is carried out for 72 hours after the addition, a fermentation liquid is taken for liquid phase analysis, a liquid phase method is shown in the example 1, and the fermentation result is shown in the following table:
strain Residual amount of p-coumaric acid Resveratrol yield
VST1-01 2234.1mg/L 724.6mg/L
Example 4 fusion expression of 4CL1 (M4) and VST1 (N3) to increase resveratrol yield
Fusion expression of proteins is often used to reduce consumption of potentially unstable intermediates to increase the yield of the final product. Resveratrol production was increased by using (GP) x 4, gpgpgp, and (GP) x 8, GPGPGPGGPGPGPG, rigid peptide. The specific construction method is as follows:
amplifying by using 4GP-4CL1-R/4GP-VST1-F as a primer and pINA1312-4CL1 (M4) -VST1 (N3) as a template to obtain an operon fragment containing hp4d-4CL1-VST1-Xpr, wherein the fragment carries (GP) rigid peptide of 4, then carrying out self-ligation on a vector by using a ClonExpress II one-step cloning kit, and constructing the obtained vector plasmid as pINA1312-4CL1 (M4) -GP4-VST1 (N3), wherein the plasmid vector is shown in figure 3; the primer sequences used for constructing the obtained vector plasmids pINA1312-4CL1 (M4) -GP8-VST1 (N3) are shown in the following table by using 8GP-4CL1-R/8GP-VST1-F as a primer and pINA1312-4CL1 (M4) -VST1 (N3) as a template to amplify an operon fragment containing hp4d-4CL1-VST1-Xpr, which carries (GP) x 8 rigid peptide, and then using a ClonExpII one-step cloning kit to carry out self-ligation on the vector:
the pINA1312-4CL1 (M4) -GP4-VST1 (N3) and pINA1312-4CL1 (M4) -GP8-VST1 (N3) plasmids thus constructed were transformed into the po1f strain according to the yeast transformation method of example 3 (2), and a new strain was constructed as follows:
strain Genotype of the type
VST1-10 Po1f，pINA1312-4CL1(M4)-GP4-VST1(N3)
VST1-11 Po1f，pINA1312-4CL1(M4)-GP8-VST1(N3)
The newly constructed strain was fermented in the fermentation manner of example 3 (3), and the fermentation yield of resveratrol is shown in the following table:
strain Residual amount of p-coumaric acid Resveratrol yield
VST1-10 1982.3mg/L 896.3mg/l
VST1-11 1952.2mg/L 1003.45mg/L
Example 5 batch fed fermentation of VST1-11 Strain to resveratrol
The VST1-11 monoclonal was picked up from the plate, inoculated into a YPD medium tube containing 2ml and cultured with shaking at 30℃and 220rpm for 24 hours, transferred into a 500ml flask containing 100ml YPD medium and cultured with shaking for 24 hours to obtain a seed solution required for batch fermentation. All 100ml of seed liquid is transferred into 3L of fermentation medium, wherein the fermentation medium comprises the following components: glucose 60g/L, glucose 15g/L (NH 4 ) 2 SO 4 ，8g/L KH 2 PO 4 ,6.15g/L MgSO 4 12ml/L vitamin, 10ml/L trace metal salt, 0.5g/L leucine, 10g/L p-coumaric acid. Wherein the trace metal salt solution comprises the following components: 5.75g/L ZnSO 4 ·7H 2 O，0.32g/L MnCI 2 ，0.32g/L CuSO 4 ，0.47g/L CoCl 2 ，0.48g/L Na 2 MoO 4 ，2.9g/L CaCl 2 ·2H 2 O，2.8g/L FeSO 4 ·7H 2 O,0.5M EDTA. Wherein the vitamin solution comprises the following components: 0.05g/L biotin, 1g/L calcium pantothenate, 1g/L nicotinic acid, 25g/L inositol, 1g/L thiamine hydrochloride, 1g/L pyridoxal phosphate, 0.2g/L p-aminobenzoic acid.
Feed medium: 700g/L glucose, 120g/L p-coumaric acid, 10mL/L trace metal salt, 10mL/L vitamin and 680mL supplementary material;
the batch fermentation temperature was 30℃and the pH was controlled to 6.0 using NaOH, the fed-batch glucose was controlled to a concentration of 30g/L, and the fermentation process was checked for product formation.
The final VST1-11 strain is fermented to generate 35.8g/L resveratrol, the conversion rate reaches 92.3%, and the fermentation schematic diagram is shown in figure 4.
A second part: construction of engineering strain of yarrowia lipolytica for high yield resveratrol for enhancing intracellular acetyl-CoA and malonyl-CoA supply
By expressing endogenous acetyl-CoA carboxylase gene and acetyl-CoA synthetase gene, the supply of intracellular acetyl-CoA and malonyl-CoA is enhanced, and the engineering strain of yarrowia lipolytica for high-yield resveratrol is constructed. Taking a VST1-11 strain as an example, taking the VST1-11 strain as an initial strain, and specifically constructing the strain as follows:
EXAMPLE 6 expression of acetyl-CoA carboxylase (ACC) to increase resveratrol yield
Construction of pINA1269-ACC plasmid vector
(1) Yeast Po1f total RNA was extracted using a Yeast total RNA flash extraction kit (available from Biotechnology Co., ltd.) according to the instructions. cDNA was synthesized using the total RNA extracted as a template using a one-step reverse transcription kit (available from full gold Biotechnology Co., ltd.). PCR amplification was performed using the synthesized cDNA as a template and primers ACC-F and ACC-R, the sequences of which are shown in Table 1. Recovering the amplification product to obtain a target fragment of the ACC gene, wherein the fragment size is 6801bp, and the nucleotide sequence of the ACC gene is shown as SEQ ID NO. 9;
(2) PCR was performed using the plasmid vector pINA1269 as a template and the primers P1-F and P1-R, the sequences of which are shown in Table 1. Obtaining a linearization vector pINA1269 after the PCR product is recovered, wherein the size of the linearization vector fragment is 7279bp;
(3) And connecting the ACC target fragment with a linearization vector pINA1269 by using a ClonExpII one-step cloning kit to obtain a recombinant plasmid pINA1269-ACC, and obtaining the recombinant plasmid with successful construction by sequencing verification.
TABLE 1 construction of ACC plasmid primer sequences
2. Construction of yarrowia lipolytica engineering bacteria and shake flask fermentation
(1) The obtained plasmid pINA1269-ACC is digested by a restriction enzyme NotI, linearized and transferred into yarrowia lipolytica engineering bacteria VST1-11 by a LiAC transformation method, and coated on an SC-Leu yeast defect type culture medium, cultured at 30 ℃ until transformants grow, 5 positive transformants are selected, and engineering strains R1, R2, R3, R4 and R5 for expressing acetyl-CoA carboxylase are respectively obtained;
(2) Streaking engineering strains R1, R2, R3, R4 and R5 and control strains VST1-11 on a YPD culture solid medium to grow single colonies, picking the single colonies to inoculate the single colonies into a seed culture medium, and culturing for 15h to obtain seed liquid, wherein the seed culture medium is the YPD culture medium: 20g/L glucose is used as a carbon source, 10g/L yeast extract and 20g/L peptone are contained, the culture condition of the seed solution is 30 ℃,220rpm, and the OD of the seed solution is equal to that of the seed solution 600 ＝10；
(3) 2% of the seed liquid is inoculated into a shake flask containing 50mL of YPD culture medium, and shake flask fermentation culture is carried out;
(4) After culturing for 24 hours, adding 5g/L substrate to carry out bioconversion on coumaric acid and 3g/L sodium acetate, and after finishing conversion for 72 hours, taking fermentation liquor and detecting the yield of resveratrol by utilizing High Performance Liquid Chromatography (HPLC);
(5) High performance liquid chromatography detects resveratrol: the chromatographic column is C18 (250 mm 4.6mm,5 μm) or equivalent chromatographic column, the mobile phase is acetonitrile and 1% acetic acid solution (gradient elution condition: 5% acetonitrile 5min,5-50% acetonitrile 15min,50% acetonitrile 5min,50-5% acetonitrile 2 min), the flow rate is 1mL/min, the sample injection amount is 10 μL, resveratrol is detected at the temperature of a column temperature box of 25 ℃, and the content is determined by an external standard method.
(6) The results are shown in FIG. 5. Compared with the original strain VST1-11, the capacity of the engineering strain expressing acetyl-CoA carboxylase for producing resveratrol is greatly improved. Taking the positive transformant R4 of the engineering strain expressing acetyl-CoA carboxylase as an example, compared with the original strain VST1-11, the capacity of producing resveratrol is improved by 40.3 percent, and the highest yield reaches 1.8g/L.
EXAMPLE 7 expression of acetyl-CoA synthetase (ACS) to increase resveratrol yield
Construction of pINA1269-ACC-ACS plasmid vector
(1) PCR was performed using the cDNA synthesized in example 6 as a template and primers ACS-F and ACS-R, the sequences of which are shown in Table 2. The amplification product is recovered to obtain ACS gene target fragment, the fragment size is 1974bp, and the nucleotide sequence of the ACS gene is shown as SEQ ID NO. 10;
(2) The plasmid vector pINA1269-ACC was used as template for PCR amplification using primers Hp4d-F and Hp4d-R, XPR t-F and XPR2t-R, respectively, the primer sequences are shown in Table 2. The target fragments Hp4d and XPR2t are respectively obtained after the PCR products are recovered, and the sizes of the fragments are 612bp and 569bp respectively;
(3) Taking target fragments ACS, hp4d and XPR2t as templates, and performing overlay PCR by using primers Hp4d-F and XPR2t-R, wherein the target fragment Hp4d-ACS-XPR2t is obtained after the PCR product is recovered, and the fragment size is 3135bp;
(4) PCR was performed using the plasmid vector pINA1269-ACC as a template and the primers P2-F and P2-R, the primer sequences being shown in Table 2. Obtaining a linearization carrier pINA1269-ACC after the PCR product is recovered, wherein the size of the linearization carrier fragment is 14060bp;
(5) The Hp4d-ACS-XPR2t target fragment is connected with linearization vector pINA1269-ACC by using ClonExpII one-step cloning kit to obtain recombinant plasmid pINA1269-ACC-ACS, and the recombinant plasmid is successfully constructed by sequencing and verifying the correctness.
TABLE 2 construction of ACS plasmid primer sequences
2. Construction of yarrowia lipolytica engineering bacteria and shake flask fermentation
(1) The obtained plasmid pINA1269-ACC-ACS is digested by restriction enzyme NotI, linearized and transferred into yarrowia lipolytica engineering bacteria VST1-11 by using LiAC transformation method, and coated on SC-Leu yeast defect culture medium, cultured at 30 ℃ until transformants grow, 5 positive transformants are selected, and engineering strains R6, R7, R8, R9 and R10 expressing acetyl-CoA synthetase are obtained respectively;
(2) Streaking engineering strains R6, R7, R8, R9 and R10 and a control strain R4 on a YPD culture solid medium to grow single colonies, picking the single colonies to inoculate the single colonies into a seed culture medium, and culturing for 15h to obtain seed liquid, wherein the seed culture medium is the YPD culture medium: 20g/LGlucose is used as a carbon source, 10g/L of yeast extract and 20g/L of peptone are contained, the culture condition of the seed solution is 30 ℃,220rpm, and the OD of the seed solution is equal to that of the yeast extract 600 ＝10；
(3) 2% of the seed liquid is inoculated into a shake flask containing 50mL of YPD culture medium, and shake flask fermentation culture is carried out;
(4) After culturing for 24 hours, adding 5g/L substrate to carry out bioconversion on coumaric acid and 3g/L sodium acetate, and after finishing conversion for 72 hours, taking fermentation liquor and detecting the yield of resveratrol by utilizing High Performance Liquid Chromatography (HPLC);
(5) High performance liquid chromatography detects resveratrol: the chromatographic column is C18 (250 mm 4.6mm,5 μm) or equivalent chromatographic column, the mobile phase is acetonitrile and 1% acetic acid solution (gradient elution condition: 5% acetonitrile 5min,5-50% acetonitrile 15min,50% acetonitrile 5min,50-5% acetonitrile 2 min), the flow rate is 1mL/min, the sample injection amount is 10 μL, resveratrol is detected at the temperature of a column temperature box of 25 ℃, and the content is determined by an external standard method.
As a result, as shown in FIG. 6, the ability of the engineered strain expressing acetyl-CoA synthetase to produce resveratrol was greatly improved as compared with the control strain R4. Taking the positive transformant R7 of the engineering strain expressing acetyl-CoA synthetase as an example, the capacity of producing resveratrol is improved by 30.3 percent, and the highest yield reaches 2.4g/L.
Example 8 fed-batch fermentation high yield of resveratrol
(1) R7 monoclonal is selected from the plate and inoculated into a YPD culture medium test tube containing 2mL for shake culture at 30 ℃ and 220rpm for 24 hours;
(2) Transferring into 500mL triangular flask containing 100mL YPD culture medium, and shake culturing for 24 hr to obtain seed solution required by batch fermentation;
(3) All 100mL of seed liquid is transferred into an initial volume of 2L of fermentation medium, wherein the fermentation medium comprises the following components: glucose 60g/L, glucose 15g/L (NH 4 ) 2 SO 4 ，8g/L KH 2 PO 4 ，6.15g/L MgSO 4 12mL/L vitamin solution, 10mL/L trace metal salt solution, 0.5g/L leucine, 3g/L sodium acetate, 15g/L p-coumaric acid. Wherein the trace metal salt solution comprises the following components: 5.75g/L ZnSO 4 ·7H 2 O，0.32g/L MnCl 2 ，0.32g/LCuSO 4 ，0.47g/L CoCl 2 ，0.48g/L Na 2 MoO 4 ，2.9g/L CaCl 2 ·2H 2 O，2.8g/L FeSO 4 ·7H 2 O,0.5MEDTA. Wherein the vitamin solution comprises the following components: 0.05g/L biotin, 1g/L calcium pantothenate, 1g/L nicotinic acid, 25g/L inositol, 1g/L thiamine hydrochloride, 1g/L pyridoxal phosphate, 0.2g/L para-aminobenzoic acid;
(4) Feed medium: 700g/L glucose, 120g/L p-coumaric acid, 20g/L sodium acetate, 10mL/L trace metal salt solution, 10mL/L vitamin solution and 910mL of feed supplement;
(5) The batch fermentation temperature was 30℃and the pH was controlled to 6.0 using NaOH, the fed-batch glucose was controlled to a concentration of 30g/L, and the fermentation process was checked for product formation.
As shown in FIG. 7, the yield of resveratrol is up to 47.8g/L when the R7 strain is fermented for 168 hours, and the conversion rate is 96.3%.

Claims (9)

1. A recombinant genetically engineered bacterium is characterized in that: the recombinant genetically engineered bacterium comprises a coding gene of a 4-coumaroyl-CoA ligase mutant and/or a coding gene of a resveratrol synthase mutant and an expression vector of a coding gene of acetyl-CoA carboxylase and/or a coding gene of acetyl-CoA synthase, or a coding gene of the 4-coumaroyl-CoA ligase mutant and/or a coding gene of the resveratrol synthase mutant and a coding gene of acetyl-CoA carboxylase and/or a coding gene of acetyl-CoA synthase are integrated in a genome of the recombinant genetically engineered bacterium.
2. The recombinant genetically engineered bacterium of claim 1, wherein: the recombinant genetically engineered bacteria are yarrowia lipolytica engineering bacteria.
3. The recombinant genetically engineered bacterium of claim 1, wherein: the acetyl-CoA carboxylase and acetyl-CoA synthetase are derived from yarrowia lipolytica endogenous enzymes.
4. The recombinant genetically engineered bacterium of claim 1, wherein: the coding gene sequence of the acetyl-CoA carboxylase is shown as SEQ ID NO. 9; the coding sequence of the acetyl-CoA synthetase is shown as SEQ ID NO. 10.
5. The recombinant genetically engineered bacterium of claim 1, wherein: the amino acid sequence of the 4-coumaroyl-CoA ligase mutant is obtained by mutating the sequence shown in SEQ ID NO.1 at one or more amino acid residue sites selected from the following groups: 260, 328, 330, 333, 338, 351, 353, 363, 364, 378, 381, 442, 451, 452, 453, 457, 460, 492, 498;
the resveratrol synthase mutant has an amino acid sequence obtained by mutating a sequence shown in SEQ ID NO. 2 at one or more amino acid residue sites selected from the following groups: 51, 54, 57, 59, 61, 62, 203, 204, 205, 208, 252, 254, 265, 266, 267, 268, 269, 270, 273, 276, 307, 312, 313, 315.
6. The recombinant genetically engineered bacterium of claim 1, wherein: the mutation modes of each amino acid residue site in the 4-coumaroyl-CoA ligase mutant are respectively as follows: Y260F, S328V, A330 333M, E338R, G351 353C, L363A, A S, S37P, C381V, I V, L451F, F452D, I453V, L457M, L460M, K492 32498Q.
The mutation modes of each amino acid residue site in the resveratrol synthase mutant are respectively as follows: the method comprises the steps of providing the alloy material with the dimensions of E51D, K54E, N57K, I M, D, 62S, E203Q, D S, E4535 5235 205H, S C, G252 5689C, I, V, F265C, H266 267M, W268L, P269K, N270D, T273G, S276 307H, A312Q, V313I, A S.
7. The method for obtaining recombinant genetically engineered bacteria of claim 1, characterized by: transferring an expression vector comprising a gene encoding a 4-coumaroyl-coa ligase mutant and/or a gene encoding an acetyl-coa carboxylase and/or a gene encoding an acetyl-coa synthase mutant into a host cell, wherein: the coding genes of the 4-coumaroyl-CoA ligase mutant and/or the resveratrol synthase mutant are expressed independently or fusion proteins are constructed through fusion expression.
8. The method for obtaining recombinant genetically engineered bacteria according to claim 7, wherein: the host cell is yarrowia lipolytica.
9. The use of the recombinant genetically engineered bacterium of claim 1 in the production of resveratrol.
CN202310691519.8A 2023-06-12 2023-06-12 Engineering bacterium for synthesizing resveratrol by utilizing p-coumaric acid, construction and application Pending CN116875474A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310691519.8A CN116875474A (en) 2023-06-12 2023-06-12 Engineering bacterium for synthesizing resveratrol by utilizing p-coumaric acid, construction and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310691519.8A CN116875474A (en) 2023-06-12 2023-06-12 Engineering bacterium for synthesizing resveratrol by utilizing p-coumaric acid, construction and application

Publications (1)

Publication Number Publication Date
CN116875474A true CN116875474A (en) 2023-10-13

Family

ID=88267014

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310691519.8A Pending CN116875474A (en) 2023-06-12 2023-06-12 Engineering bacterium for synthesizing resveratrol by utilizing p-coumaric acid, construction and application

Country Status (1)

Country Link
CN (1) CN116875474A (en)

Similar Documents

Publication Publication Date Title
CN112226398B (en) Recombinant escherichia coli for efficiently producing glutaric acid and construction method thereof
CN113755354B (en) Recombinant saccharomyces cerevisiae for producing gastrodin by utilizing glucose and application thereof
CN112063572B (en) Recombinant escherichia coli capable of highly producing O-acetyl-L-homoserine and application thereof
CN114621968A (en) Tetrahydropyrimidine biosynthesis gene cluster, mutant and method for preparing tetrahydropyrimidine
WO2022174597A1 (en) Genetically engineered bacterium for producing l-sarcosine, construction method therefor and use thereof
CN107201374B (en) Construction method and application of optical pure meso-2, 3-butanediol high-yield engineering strain
CN113564090B (en) Construction method for recombinant bacteria producing tetrahydropyrimidine and application thereof
WO2024099089A1 (en) Genetically engineered strain for producing pseudouridine, construction method therefor and use thereof
CN108359626B (en) Engineering bacterium and application thereof in preparation of (R) -3-hydroxy-5-hexenoic acid ester
CN109112090B (en) Total biosynthesis method of glutaric acid
CN113249239A (en) Saccharomyces cerevisiae for high yield of crocetin and construction method and application thereof
CN108103049B (en) Thermophilic L-asparaginase mutant and screening and fermenting method thereof
CN116875474A (en) Engineering bacterium for synthesizing resveratrol by utilizing p-coumaric acid, construction and application
CN107201375B (en) Construction method and application of genetic engineering strain for producing (R, R) -2, 3-butanediol
CN112375725B (en) Metabolic engineering strain for producing vitamin B6 and construction method and application thereof
CN106086082B (en) A method of improvement recombination bacillus coli produces 9- decenol
CN114854659A (en) Ergothioneine production process and application thereof
CN114606149A (en) Saccharomyces cerevisiae engineering strain for producing ergosterol and application thereof
CN116426492A (en) Engineering strain for synthesizing resveratrol by taking p-coumaric acid as substrate, construction and application thereof
CN107338263B (en) Construction method for producing itaconic acid by fermenting xylose based on pichia stipitis synthetic strain
CN111575258B (en) Carbonyl reductase EbSDR8 mutant and construction method and application thereof
CN114958703B (en) Recombinant bacterium for synthesizing succinic acid by utilizing grease, construction method and application thereof
WO2024140379A1 (en) Enzyme, strain for producing salidroside, and production method
CN110343653B (en) Method for improving yield of 1,2,4-butanetriol by knocking out aldehyde dehydrogenase gene of escherichia coli
CN116904416A (en) Recombinant escherichia coli for efficiently producing tetrahydropyrimidine and construction method thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination