CN116855520A - Reporter protein plasmid, cell strain, construction method and application thereof - Google Patents

Abstract

The invention discloses a reporter protein plasmid, a cell strain and a construction method and application thereof, wherein the reporter protein plasmid is pLVX-CMV-mClover3-FHA2-FOXOsig-mRuby3-IRES-Hyg fluorescent protein, AKT activation of an insulin metabolic pathway is used as a report index, after AKT activation, a downstream molecule FOXO signal peptide (FOXOSIG) is phosphorylated, the FOXO signal peptide is combined with FHA2 fragments, fluorescent proteins mClover3 and mRuby3 fused at two ends of the two molecules are mutually close, and fluorescent resonance transfer occurs after excitation illumination of mClover3, so that fluorescent signals of mRuby3 are detected. Through the reporter protein plasmid, the live cell insulin signal can be read in real time by a fluorescent plate reader, or high-throughput cell screening can be performed by using a flow cytometry technology. The mClover3 and mRuby3 fluorescent proteins are used as fluorescent resonance transfer protein combinations, have stronger fluorescent intensity than other fluorescent combinations, and are beneficial to improving the detection sensitivity and the detection precision. The report cell strain constructed by the report protein plasmid is applied to flow cell sorting, can rapidly acquire a large amount of required data, and remarkably improves the research efficiency of screening molecular mechanisms.

Description

Reporter protein plasmid, cell strain, construction method and application thereof

Technical Field

The invention belongs to the technical field of biological detection, and particularly relates to a reporter protein plasmid, a construction method and application thereof.

Background

Flow CytoMetry (FCM) is a biological technique for counting and sorting tiny particles suspended in a fluid, which can be used to perform a continuous multiple parameter analysis of individual cells flowing through an optical or electronic detector. The characteristic is that it can quantitatively determine many important parameters such as cell DNA content, cell volume, protein content, enzyme activity, cell membrane receptor and surface antigen by quick determination of coulter resistance, fluorescence, light scattering and light absorption. Cells of different nature are separated according to these parameters to obtain pure cell populations for biological and medical research.

Reporter genes are genes that are expressed in a specific situation of a cell, tissue/organ or individual and that allow them to be easily detected, and that the experimental material would not otherwise produce a trait, wherein fluorescent proteins are a class of proteins that can be used to observe cell activity by emitting fluorescence, while at the same time, fluorescent proteins can be labeled for further biological detection experiments. In particular, during cancer research, scientists have been able to observe specific activities of tumor cells, such as growth, invasion, metastasis and neogenesis of tumor cells, due to the presence of fluorescent proteins.

Traditional cell insulin signaling pathways are typically identified by western blot detection of phosphorylation of insulin signaling pathway molecules before and after insulin treatment. The method requires 1-2 days, and cannot detect the real-time change of the insulin signal of the living cells in real time, and cannot detect the insulin signal in high flux.

In view of this, it is an urgent technical problem to be solved at present to propose a reporter protein with higher fluorescence intensity.

Disclosure of Invention

Therefore, the technical problems to be solved by the invention are that the traditional fluorescent protein gene has insufficient fluorescent intensity and poor detection sensitivity, so that a reporter protein plasmid and a cell strain with higher fluorescent intensity are provided, and a construction method and application thereof.

In order to solve the technical problems, the technical scheme of the invention is as follows:

the first aspect of the present invention provides a reporter plasmid, which is: pLVX-CMV-mClover3-FHA2-FOXOSIG-mRuby3-IRES-Hyg fluorescent protein.

Preferably, the DNA sequence of the reporter plasmid is SEQ ID NO. 1.

The second aspect of the present invention provides a method for constructing the reporter plasmid, comprising the steps of:

s1, obtaining a mClover3-mRuby3 fragment from a pKanCMV-mClover3-mRuby3 plasmid;

s2, inserting the mClover3-mRuby3 fragment into a pLVX-IRES-Hyg vector plasmid;

s3, obtaining enzyme cutting sites between mClover3 and mRuby3 through point mutation;

s4, designing and synthesizing FHA2-FOXOSIG fragments, wherein elastic hinge regions are arranged at two ends of the FOXOSIG;

s5, assembling the FHA2-FOXOsig fragment between mClover3 and mRuby3 to obtain the pLVX-CMV-mClover3-FHA2-FOXOsig-mRuby3-IRES-Hyg fluorescent protein.

Preferably, the step S1 specifically includes: the pKanCMV-mClover3-mRuby3 plasmid is amplified by PCR to obtain mClover3-mRuby3 fragment, wherein the gene sequence of the forward primer adopted in PCR amplification is SEQ ID NO. 2, and the gene sequence of the reverse primer adopted in PCR amplification is SEQ ID NO. 3.

Preferably, the step S4 specifically includes: the FHA2-FOXOSIG fragment is obtained through PCR amplification, wherein the gene sequence of a forward primer adopted in the PCR amplification is SEQ ID NO. 4, and the gene sequence of a reverse primer adopted in the PCR amplification is SEQ ID NO. 5.

Preferably, the FHA2-FOXOSIG fragment is formed by fusion expression of AKT downstream molecule FOXO signal polypeptide and FHA 2.

In a third aspect the invention provides a reporter cell strain comprising said reporter plasmid.

In a fourth aspect, the present invention provides a method of constructing the reporter cell strain, comprising the steps of:

s1, packaging reporter protein plasmid lentivirus: extracting the reporter protein plasmid and carrying out Cas9 lentivirus packaging;

s2, constructing a cell strain expressing the AKT reporter protein and the Cas 9.

The fifth aspect of the invention provides an application of the report cell strain in flow cytometry detection and fluorescence plate detection.

Preferably, the use further comprises the step of treating the reporter plasmid with insulin.

Compared with the prior art, the technical scheme of the invention has the following advantages:

the reporter protein plasmid provided by the invention is pLVX-CMV-mClover3-FHA2-FOXOsig-mRuby3-IRES-Hyg fluorescent protein, the reporter protein plasmid uses AKT activation of an insulin metabolic pathway as a report index, after AKT activation, a downstream molecule FOXO signal peptide (FOXOsig) is phosphorylated, so that the FOXO signal peptide is combined with FHA2 fragments, fluorescent proteins mClover3 and mRuby3 fused at two ends of the two molecules are mutually close, and fluorescent resonance transfer occurs after excitation illumination of mClover3, so that fluorescent signals of mRuby3 are detected. The reporter protein plasmid provided by the invention can be used for reading live cell insulin signals in real time by using a fluorescent plate reader or performing high-throughput cell screening by using a flow cytometry technology. Meanwhile, the fluorescent protein using mClover3 and mRuby3 has stronger fluorescence intensity than other fluorescent combinations as fluorescent resonance transfer protein combination, which is beneficial to improving the detection sensitivity and the detection precision. The report cell strain constructed by the report protein plasmid is applied to flow cell sorting, can rapidly acquire a large amount of required data, and remarkably improves the research efficiency of screening molecular mechanisms.

Drawings

In order that the invention may be more readily understood, a more particular description of the invention will be rendered by reference to specific embodiments thereof that are illustrated in the appended drawings, in which

FIG. 1 is a schematic diagram of the structure of a reporter plasmid provided in example 1 of the present invention;

FIG. 2 is a step diagram of the method for constructing reporter plasmid provided in example 1 of the present invention;

FIG. 3 is a graph of fluorescence intensity of reporter cell lines provided in example 2 for insulin treatment at different times tested by a fluorescence plate reader;

FIG. 4 is a graph of fluorescence intensity of reporter cell lines provided in example 2 of fluorescent plate reader testing insulin at different concentrations;

FIG. 5 is a graph of fluorescence intensity of reporter cell lines provided in fluorescent plate reader test glucose treatment example 2;

FIG. 6 is a test chart of flow cytometry to detect a reporter cell strain provided in insulin treatment example 2;

FIG. 7 is a test chart of flow cytometry detection control report cell lines.

Detailed Description

Example 1

This example provides a reporter plasmid, shown in FIG. 1, which is a pLVX-CMV-mClover3-FHA2-FOXOSIG-mRuby3-IRES-Hyg fluorescent protein. Wherein pLVX is a lentiviral vector, CMV is a cytomegalovirus promoter, mClover3, mriby 3 are fluorescent proteins, FOXOsig is a fork-box protein O signal peptide (Forkhead Box Protein O), IRES is an internal ribosome entry point (Internal Ribosome Entry Site), FHA2 is a fork-related protein (Forkhead-associated Domain 2), hyg is a hygromycin resistance gene.

The DNA sequence of the reporter plasmid provided in this example is shown in SEQ ID NO. 1.

The reporter plasmid provided in this example uses AKT activation of insulin metabolic pathway as a report index, after AKT activation, phosphorylates downstream molecule FOXO signal peptide (FOXOsig) to combine FOXO signal peptide with FHA2 fragment, so that fluorescent proteins mcover3 and mriby 3 fused at both ends of these two molecules are close to each other, and when mcover3 is excited to light, fluorescence resonance transfer occurs, and a fluorescent signal of mriby 3 is detected. The reporter protein plasmid provided by the invention can be used for reading live cell insulin signals in real time by using a fluorescent plate reader or performing high-throughput cell screening by using a flow cytometry technology. Meanwhile, the fluorescent protein using mClover3 and mRuby3 has stronger fluorescence intensity than other fluorescent combinations as fluorescent resonance transfer protein combination, which is beneficial to improving the detection sensitivity and the detection precision. The report cell strain constructed by the report protein plasmid is applied to flow cell sorting, can rapidly acquire a large amount of required data, and remarkably improves the research efficiency of screening molecular mechanisms.

As shown in fig. 2, the reporter plasmid provided in this example was constructed by the following method:

s1, obtaining mClover3-mRuby3 fragments from pKanCMV-mClover3-mRuby3 plasmids through PCR amplification, wherein forward primers adopted in the PCR amplification process are as follows: the DNA sequence of mClover-mRuby3 fw is:

CTCGAGACTAGTTCTAGAGCATGCATCATCACCATCAC (SEQ ID NO: 2), the reverse primer mClover-mRuby3 bw has the DNA sequence:

GGGAGAGGGGCGGGATCCGCTTACTTGTACAGCTCGTC(SEQ ID NO:3)。

s2, inserting the mClover3-mRuby3 fragment into a pLVX-IRES-Hyg vector plasmid by a Gibson assembly method, wherein the Gibson assembly method adopts GibsonMaster Mix (E2611, NEB) was performed according to the reagent instructions.

S3, obtaining a Not1 enzyme cutting site between mClover3 and mRuby3 through point mutation, wherein the forward primer CR-P-Not1 fw adopted by the point mutation has a DNA sequence as follows:

GGAAAGCGGCCGCGAAGATCCGATG (SEQ ID NO: 6), the reverse primer CR-P-Not1 bw has the DNA sequence: AGGGCGGCGGTCACGAAC (SEQ ID NO: 7), wherein the point mutation reaction is carried out by using KLD enzyme mixed kit (M0554, NEB) according to the reagent instructions.

S4, designing and synthesizing FHA2-FOXOSIG fragments, wherein elastic hinge regions are arranged at two ends of the FOXOSIG, firstly customizing the FHA2-FOXOSIG fragments, and amplifying the FHA2-FOXOSIG fragments by PCR, wherein the DNA sequence of a forward primer FHA-CR fw adopted in the PCR amplification process is as follows: TGACCGCCGCCCTGGAAAGCTTAACTTTAAAACCATTGCCTGAC (SEQ ID NO: 4), the DNA sequence of the reverse primer FHA-CR bw is:

GCTCACCATCGGATCTTCGCTTCCTCCTGATCCTCCCTTC (SEQ ID NO: 5). FHA2-FOXOSIG fragment is obtained by adopting two ends of AKT downstream molecule forkhead box O (FOXO) signal polypeptide to respectively access a small section of linking sequence (flank) and fusion expression of forkhead-associated domain (FHA 2), and after the FOXO signal peptide is phosphorylated, the FOXO signal peptide is combined with the FHA2 fragment, so that the conformation of the fusion protein is changed.

S5, inserting the FHA2-FOXOsig fragment obtained after PCR amplification obtained in the step S4 between mClover3 and mRuby3 through Gibson assembly to obtain the pLVX-CMV-mClover3-FHA2-FOXOsig-mRuby3-IRES-Hyg fluorescent protein, and confirming that the protein plasmid is successfully constructed through sanger sequencing.

After being phosphorylated, the FOXO signal peptide is combined with FHA2 fragment to change the conformation of the fusion protein, so that the fusion protein at two ends of the protein is close to each other, mRuby3 is excited by using excitation light of mClover3 (wavelength is 488 nm), fluorescence resonance energy transfer is generated, mRuby3 emits fluorescence at 592nm, and a fluorescence signal can be detected.

In the protein patent construction method provided in this example, the PCR amplification reaction used in steps S1 and S4 was performed by Herculase II Fusion DNA polymerase (Agilent 600677) according to the reaction system of Table 1.

TABLE 1 50. Mu.l PCR reaction System

5XHevcⅡRxn Buffer 10μl
	Deoxyribonucleoside triphosphates (dNTPs) (10. Mu.m each) 1. Mu.l
PCR Forward primer (10. Mu.m) 2. Mu.l
	PCR reverse primer (10. Mu.m) 2. Mu.l
Plasmid 0.2. Mu.l
	HerII DNA polymerase (polymerase) 1. Mu.l
H 2 O 33.8μl

The conditions for the PCR reaction were: 95 ℃ for 5 min, (95 ℃ for 40 sec, 65 ℃ for 50 sec, 72 ℃ for 1 min) 39 cycles, 72 ℃ for 5 min, 4 ℃ hold.

The reporter protein plasmid provided by the embodiment has stronger fluorescent signal, is particularly suitable for flow cell detection and fluorescent plate reader detection, and can obviously improve the detection sensitivity.

Example 2

This example provides a reporter cell strain comprising the reporter plasmid provided in example 1.

The reporter cell line is constructed by the following method:

s1, packaging reporter protein plasmid lentivirus: the second-generation lentiviral packaging plasmids psPAX2 (# 12260, addgene) and pMD2.G (# 12259, addgene) were extracted, and after removal of cell debris by pLVX-CMV-mClover3-FHA2-FOXOsig-mRuby3-IRES-Hyg (15 ug/15cm dis), the amount of psPAX2 (7.5 ug/15cm dis), pMD2.G (7.5 ug/15cm dis), 293FT cells were transfected with PEI (90 ul/15cm dis), the medium supernatant was harvested for 6-16 hours, centrifuged and the cell debris was removed by a 0.45 μm filter, virus was precipitated by PEG6000 (5X), washed 1 time with PEG6000 (1X), dissolved in 4% sucrose solution, sub-packaged with a tube and stored at-80 ℃.

Cas9 lentiviral packaging: 293FT cells were transfected according to the amount of Lenti-Cas9-blast (# 52962, addgene) (15 ug/15cm dis), psPAX2 (7.5 ug/15cm dis), pMD2.G (7.5 ug/15cm dis), the procedure was the same as the reporter plasmid lentiviral package described above.

S2, constructing a cell strain expressing the ATK reporter protein and Cas 9: hepG2 cells are infected by the Cas9 lentivirus, meanwhile, cells without virus are used as a control, and Blastidin (5 mug/ml) is added into a culture medium for changing liquid every other day, and after 7 days, all cells of the control group are observed to die, and a large number of cells of the virus group survive, so that the cell strain expressing Cas9 is proved to be obtained.

And (3) infecting the Cas9 cell strain by using the packaged ATK protein plasmid lentivirus, setting a virus-free group as a control, and changing the cell of the control group by using hydro mycin B (200 mug/mL) and Bletidins (5 mug/mL) every other day, wherein the cells of the control group are all dead, and when a large number of cells of the virus group survive, screening out the cell strain of the AKT reporter protein and the Cas9 which are stably expressed.

The reporter protein plasmid provided in the embodiment 1 is applied to the cell strain provided in the embodiment, and the fluorescent combined signals of mClover3 and mRuby3 are stronger, so that the cell strain has higher sensitivity when being used for flow cell detection and fluorescent plate reader detection, and the reporter cell strain can quickly obtain a large amount of required data when being used for flow cell sorting combined with CRSPR/Cas9 screening, thereby greatly improving the research efficiency of screening molecular mechanisms.

The report cell strain provided by the embodiment can be applied to flow cell detection and fluorescence plate detection, and when the report cell strain is applied, the report cell strain can be processed through insulin, so that a fluorescence signal is further improved.

Experimental example

1. Fluorescent plate reader test for AKT Signal after insulin treatment of reporter cell lines provided in example 2

The reporter cell strain obtained in example 2 was inoculated into a 96-well cell culture plate with a black flat bottom and a cover, while another set of reporter cell strains was also inoculated into a transparent 96-well cell culture plate to facilitate observation of cell state and cell concentration. Report cell lines were placed in 5% CO with 10% FBS DMEM medium ₂ To a cell density of 50% -70%, insulin was added to the cell culture at various time points (5,10,15,20,30,45,90 minutes each) in advance, at a final concentration of 10nM, and a group of cells without insulin was kept as a control. The detection results are shown in FIG. 3.

Insulin was added to the cell culture medium at various concentrations, and after 10 minutes, fluorescence resonance energy transfer was generated by excitation with light of 488nm wavelength (excitation light of donor fluorescence mClover 3), and fluorescence signal was detected at 592nm wavelength (emission light of acceptor fluorescence mRuby 3), and the detection result is shown in FIG. 4.

The test results show that: when the reporter cell line was treated with insulin at a concentration of 10nM, the FRET fluorescence signal of the reporter cell line was significantly enhanced and the 10 minute FRET fluorescence value peaked before no further increase (FIG. 3). Whereas increasing concentrations of insulin treatment resulted in increasing FRET fluorescent signal following reporter cell lines (fig. 4).

2. Fluorescent plate reader test for AKT Signal after glucose treatment of reporter cell lines provided in example 2

The reporter cell strain provided in example 2 was inoculated into a black flat-bottomed capped 96-well cell culture plate, and simultaneously a set of cells was inoculated into a transparent 96-well cell culture plate for observing cell status and cell concentration, the reporter cell strain was cultured in 10% FBS 1640 medium (glucose concentration 11 mM), glucose was added to a final concentration of 25mM, and 5% CO was added ₂ Is cultured for 24 hours. Insulin was added for 10 minutes and then read with a fluorescence plate reader.

The detection results are shown in fig. 5, and the detection results indicate that: FRET fluorescence signal is closely related to the sugar concentration of the medium. The fluorescence reporter cell line has a lower FRET fluorescence value in the 11mM glucose-treated group than in the 25mM glucose-treated group. The FRET fluorescence value increased after the addition of insulin to the 11mM glucose treated cells, whereas the FRET fluorescence value increased no longer after the addition of insulin to the 25mM glucose treated cells had reached the peak.

3. Flow cytometry detection of AKT Signal from reporter cell lines provided in example 2

The reporter cell strain obtained in example 2 was inoculated into a cell culture plate, cultured to a cell density of 50% -70%, and after 10 minutes, the cells were immediately washed 3 times with cold PBS, and after addition of pancreatin cell digest, the plate was tapped to suspend the cells, immediately added with 4% PFA for 5 minutes, and after 3 times with PBS, resuspended with PBS, and the cell concentration was 107/ml. The fluorescence of mClover3 was detected by flow cytometry (BD FACSAriaFusion Flow Cytometers) with excitation light of 488nm, grating 585/42nm for FRET and 530/30 nm.

The test results are shown in fig. 6-7, and the test results show that the FRET signal is significantly improved by the insulin-treated reporter cell strain.

It is apparent that the above examples are given by way of illustration only and are not limiting of the embodiments. Other variations or modifications of the above teachings will be apparent to those of ordinary skill in the art. It is not necessary here nor is it exhaustive of all embodiments. While still being apparent from variations or modifications that may be made by those skilled in the art are within the scope of the invention.

Claims (10)

1. A reporter plasmid, characterized in that the reporter plasmid is:

pLVX-CMV-mClover3-FHA2-FOXOSIG-mRuby3-IRES-Hyg fluorescent protein.

2. The reporter plasmid of claim 1, wherein the reporter plasmid has a DNA sequence of SEQ ID NO. 1.

3. A method of constructing a reporter plasmid according to claim 1 or 2, comprising the steps of:

s1, obtaining a mClover3-mRuby3 fragment from a pKanCMV-mClover3-mRuby3 plasmid;

s2, inserting the mClover3-mRuby3 fragment into a pLVX-IRES-Hyg vector plasmid;

s3, obtaining enzyme cutting sites between mClover3 and mRuby3 through point mutation;

s4, designing and synthesizing FHA2-FOXOSIG fragments, wherein elastic hinge regions are arranged at two ends of the FOXOSIG;

s5, assembling the FHA2-FOXOsig fragment between mClover3 and mRuby3 to obtain the pLVX-CMV-mClover3-FHA2-FOXOsig-mRuby3-IRES-Hyg fluorescent protein.

4. A method of construction according to claim 3, wherein step S1 is specifically: the pKanCMV-mClover3-mRuby3 plasmid is amplified by PCR to obtain mClover3-mRuby3 fragment, wherein the gene sequence of the forward primer adopted in PCR amplification is SEQ ID NO. 2, and the gene sequence of the reverse primer adopted in PCR amplification is SEQ ID NO. 3.

5. The construction method according to claim 4, wherein the step S4 is specifically: the FHA2-FOXOSIG fragment is obtained through PCR amplification, wherein the gene sequence of a forward primer adopted in the PCR amplification is SEQ ID NO. 4, and the gene sequence of a reverse primer adopted in the PCR amplification is SEQ ID NO. 5.

6. The method according to claim 5, wherein the FHA2-FOXOsig fragment is expressed by fusion of a FOXO signal polypeptide, a molecule downstream of AKT, with FHA 2.

7. A reporter cell strain comprising the reporter plasmid of claim 1 or 2.

8. A method of constructing the reporter cell strain of claim 7, comprising the steps of:

s1, packaging reporter protein plasmid lentivirus: extracting the reporter protein plasmid and carrying out Cas9 lentivirus packaging;

s2, constructing a cell strain expressing the AKT reporter protein and the Cas 9.

9. Use of the reporter cell strain of claim 7 in flow cytometric assays, fluorescence plate assays.

10. The use of claim 9, further comprising the step of treating the reporter cell strain with insulin.