CN116855501A

CN116855501A - Tetranychus gene editing system based on CRISPR-Cas9 and application

Info

Publication number: CN116855501A
Application number: CN202311063780.XA
Authority: CN
Inventors: 赵伊英; 崔丹丹
Original assignee: Shihezi University
Current assignee: Shihezi University
Priority date: 2023-08-23
Filing date: 2023-08-23
Publication date: 2023-10-10

Abstract

The invention discloses the technical field of biology, and particularly relates to a spider mite gene editing system based on CRISPR-Cas9 and application thereof. The invention designs the SgRNA of the gene related to targeting carotenoid synthesis and juvenile hormone gene mutation, constructs a Cas9-SgRNA complex, and injects the Cas9-SgRNA complex into female bodies. Albino males were found in the offspring, and the albino male offspring were mated with wild-type females and their characterization and gene sequences were studied. After sequencing, mutations were found at positions near the PAM site in the target gene. The albino phenotype is shown to be the result of CRISPR-Cas9 induced carotenoid synthesis gene mutation, which causes mite growth to be affected. The method provides a theoretical basis for the feasibility of CRISPR-Cas9 mediated mite genetic modification, provides a new potential target for agricultural pest mite control, and has good application prospect.

Description

Tetranychus gene editing system based on CRISPR-Cas9 and application

Technical Field

The invention relates to the technical field of biology, in particular to a spider mite gene editing system based on CRISPR-Cas9 and application thereof.

Background

Agricultural pest mites belong to the phylum arthropoda, arachnidae, acaridae, and the order of the phylum real mites, are widely distributed on various agricultural and forestry crops, are main pests on agricultural and forestry crops in the world today, and in Xinjiang, the damage is mainly represented on the damage to crops such as cotton, forest fruits, corn and the like.

For many years, the control of agricultural mites in China has been mainly chemical control. Insects generally develop resistance to certain pesticides for about 3-4 years, but have a short life cycle, strong reproductive capacity, high population density, only 1-2 years for certain pesticides, and may develop cross resistance as compared to mites. Therefore, there is an urgent need to develop new, safe, and efficient methods for controlling the hazards of mites.

RNA interference (RNAi) has greatly accelerated the scientific progress of different insect populations, linking genes to phenotypes, but this technology is not always applied directly to mites at present. A recent technique, known as regularly spaced short palindromic repeats (CRISPR-Cas 9), has completely altered the functional genetic work of many organisms. CRISPR-Cas9 mediated gene manipulation has been reported to be applied to an increasing number of organisms including diptera, hymenoptera, hemiptera, coleoptera, orthoptera and various lepidoptera, but not spider mites. It is clear that this targeted, heritable gene editing approach is also critical for the study of spider mites.

CRISPR-Cas9 mediated gene knockout is to cut a target sequence of a target gene by SgRNA guiding Cas9 protein to form double-strand break of the gene and destroy a genome sequence of the gene. Currently, the Cas protein widely used is a Cas9 protein derived from streptococcus thermophilus, and plays a high-efficiency role in different species after codon optimization. Injection of synthetic different forms of Cas9 and sgrnas into embryos or transfected cells of organisms to obtain the desired gene knockout individuals or cells has become a powerful tool for gene function research.

At present, some technical problems of the CRISPR-Cas system are to be further improved and discussed: such as off-target phenomenon, restriction of PAM region, editing efficiency, etc. Especially off-target phenomena, severely limits the application of this technique.

Disclosure of Invention

The invention aims to provide a CRISPR-Cas 9-based spider mite gene editing system and application thereof, which are used for solving the problems in the prior art, and a gene editing system is constructed by designing SgRNA of targeted tetur01g11260 and tetur13g03250 genes, so that genes for regulating and controlling albino spider mites and affecting larva growth and development are determined, and a scientific theoretical basis is provided for preventing spider mites in agriculture.

In order to achieve the above object, the present invention provides the following solutions:

the invention provides an SgRNA, which comprises any one of the following (1) - (2):

(1) The nucleotide sequence of the SgRNA of the targeted disruption tetur01g11260 gene is shown as SEQ ID NO: 1-2;

(2) The nucleotide sequence of the SgRNA of the targeted disruption tetur13g03250 gene is shown as SEQ ID NO: 3-4.

The invention also provides a spider mite gene editing system based on CRISPR-Cas9, which comprises the SgRNA.

The invention also provides a method for constructing a spider mite mutant based on the CRISPR-Cas9 spider mite gene editing system, which comprises the following steps: cas9 and the SgRNA of claim 1 are mixed in a molar ratio of 1:2 to obtain a Cas9-SgRNA complex, the Cas9-SgRNA complex is transferred into spider mites, and spider mite mutants are obtained through screening.

Preferably, when the sequence set forth in SEQ ID NO:1-2, mixing SgRNA shown in the formula 1-2 with Cas9 to form a Cas9-SgRNA compound, transferring the Cas9-SgRNA compound into the spider mites, and screening to obtain albino spider mite mutants;

when the sequence set forth in SEQ ID NO:3-4, mixing SgRNA shown in the specification and Cas9 to form a Cas9-SgRNA complex, and transferring the Cas9-SgRNA complex into the spider mites, and screening to obtain spider mite mutants with the growth and development blocked larvae.

The invention also provides an application of the SgRNA or the spider mite gene editing system in preparing spider mite control products.

The SgRNA of the invention or the application of the spider mite gene editing system in preparing products for regulating and controlling spider mite albino phenotype and/or larva growth and development.

The SgRNA of the invention or the application of the spider mite gene editing system in construction of spider mite mutants.

Preferably, the spider mite mutants include albino spider mite mutants and mutants with stunted larval growth.

The invention discloses the following technical effects:

the invention aims at the related genes of carotenoid synthesis and juvenile hormone, and proves that the related genes of carotenoid synthesis and juvenile hormone can be used as targets for preventing and controlling agricultural mites by using the CRISPR-Cas9 technology, and the CRISPR-Cas9 can also be applied to non-model insect spider mites. Specifically, by delivering Cas9-SgRNA complexes into females. Albino offspring were found in the offspring, mated with wild type and their characterization was studied further. After sequencing its complete target gene, mutations were found at positions near the PAM site in the target gene. The albino phenotype is shown to be the result of CRISPR-Cas9 induced carotenoid synthesis gene mutation, which causes mite growth to be affected. Thereby providing a theoretical basis for the feasibility of CRISPR-Cas9 mediated mite genetic modification. The invention provides a new potential target for agricultural pest mite control based on CRISPR-Cas9 technology, thus having good application prospect.

The invention has the following advantages: (1) The specific interference pest mite specific gene is safe to higher animals and human beings; (2) mite killing specificity and safety to non-target organisms; (3) is nontoxic and harmless to the environment. Therefore, the invention has obvious technical advantages compared with the traditional mite control method.

Detailed Description

Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples of the present invention are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.

Example 1

1. Experimental method

1. Test Tetranychus feeding

Turkistan spider mites: the breeding method comprises the steps of collecting a test field from a university of stone river agricultural college laboratory test station in 6 months of 2021, breeding cowpea in a physiological laboratory illumination incubator (the temperature is (28+/-1) DEG C and the relative humidity is (65+/-5)%) and the photoperiod L/D=16 h/8 h) of the insects at the university of stone river, and keeping the cowpea without any medicament in the breeding process.

2. Recombinant Cas9 ribonucleoprotein and SgRNA

A recombinant streptococcus pyogenes commercial Cas9 protein containing multiple Nuclear Localization Sequences (NLSs) was used. Primer sequences were designed using the CRISPO website (see Table 1).

TABLE 1 sequence of SgRNA

3. In vitro Cas9-SgRNA cleavage experiments

Primers were designed using Primer 5 to amplify the SgRNA of the region of the targeted carrot-like synthetic gene tetur01g11260, the juvenile hormone-related gene tetur13g 0350. DNA was extracted from wild-type mites using the Gentra Puregene tissue kit (QIAgen) according to the manufacturer's instructions, and adult female mites were used as materials. Using Expand ^TM Long Range dNTPack (Sigma-Aldrich) the tetur01g11260, tetur13g03250 fragments (amplified fragments 1 and 2) were PCR, pre-denatured at 92℃for 2min;92℃for 10s, 60℃for 15s,68℃for 1min,5 cycles; 92℃for 10s, 55℃for 15s,68℃for 1min,37 cycles; extension at 68℃for 5min, preservation at 4℃and detection of PCR products by agarose gel electrophoresis and useAnd (5) purifying by using a circulating purification kit.

The Cas9 RNP complex is composed of SgRNA, alt-R s.p. cas9V 3 enzyme and Cas9 dilution buffer. Negative control replaced SgRNA with TE. After incubation at room temperature, the in vitro cleavage reaction system at room temperature is as follows: 2 μl 10×cas9 nuclease reaction buffer, 4 μl Cas9 RNP,10 μl DNA substrate, and 4 μl water. The reaction mixture was allowed to stand at 37℃for 90min, then 2. Mu.L of proteinase K was added, and at 56℃for 10min. The results were then analyzed using gel electrophoresis, in which the reaction mixture was spotted onto a gel.

4. In vivo Cas9-SgRNA cleavage experiments

4.1 Cas9-SgRNA injection

Stock solutions of each SgRNA were prepared by dissolving the SgRNA in RNase-free water. Cas9: sgRNA at 1:2 molar ratio was added to the injection mixture and chloroquine was also added to the mixed injection. Cas9-SgRNA injection mixture was centrifuged at 37 ℃ for 10min, and finally, injection mixture was centrifuged at 12000rpm for 10min at 4 ℃ and refrigerated to injection.

4.2 injection of female mites

Wild type female mites were placed in petri dishes and laid down on top of the leaves. Eight days later, female nymphs were transferred to another leaf disk. Over another one to four days, these unfertilized females were used for injection. Mites were injected under a microscope and mechanical micromanipulator, and about 3-5nL of Cas9-SgRNA injection mix was injected into the body. Each batch of injected mites was transferred to a separate leaf disk and allowed to spawn. After 24 hours, the injected females were transferred to new leaf discs and spawned again. From day 3 post-spawning, the phenotype screening of the albino phenotype was performed on injected female male haploid offspring (on four leaf discs in total (2 batches: A and B,2 time points: 0-24 hours and 24-48 hours)).

5. Genetic pattern of albino phenotype and production of homozygous albino products

Albino male offspring from Cas 9-sgrnas were isolated on leaf discs (one male per leaf disc) and allowed to mate with 3 to 5 unfertilized female mites of the parental population. The mating females were allowed to lay eggs on leaf disk (leaf disk 1) for 6 days before being discarded. Next, 3F 1 female nymphs developed from eggs on leaf disk 1 were transferred to another separate leaf disk, and allowed to grow and spawn for 4 days (leaf disk 2). These unfertilized F1 generations, the females (from leaf disc 2) were transferred to another leaf disc, kept at 10 ℃ to extend their life (leaf disc 3). Subsequently, the numbers of albino and wild type males were counted on leaf disk 2 and albino males from leaf disk 2 were paired with their unfertilized females (on leaf disk 3) to produce homozygous albino. . Briefly, 15 unfertilized females were crossed with 30 males from wild type. As a result, at least 100F 1 females were evaluated as albino.

6. PCR amplification for extracting DNA and RNA from spider mites and related genes

DNA was collected from female offspring. PCR was performed using in vitro Cas9-SgRNA cleavage experiment primers for tetur01g11260, tetur13g03250 fragments, and DNA extracted from Tetranychus urticae was used as template. PCR amplified products were verified on agarose gels and used according to manufacturer's instructionsgel and PCR kit purification.

The primers for the experimental synthesis of tetur01g11260 described above are shown in Table 2:

TABLE 2 Tetur01g11260 synthetic primer of spider mite gene

The Tetur13g03250 synthetic primers of the spider mite gene are shown in Table 3 below.

TABLE 3 Tetur13g03250 synthetic primer of spider mite gene

Amplification conditions: pre-denaturation at 95 ℃ for 5min;95℃30s,53℃40s,72℃1min,40 cycles, 72℃extension 2min. PCR amplification was performed using spider mite DNA as a template.

Finally, RNA is extracted from mites of the spider mites. 100 females were collected and RNA was extracted using Qiagen RNeasy Plus mini Kit. cDNA was synthesized using a Maxima First Strand cDNA synthesis kit of RT-qPCR using 1. Mu.g total RNA as template. PCR was performed using Primer 5 to design primers (tetur 01g11260, tetur13g03250 primers) to amplify the coding sequences of tetur01g11260, tetur13g 0350. The reaction mixture was prepared according to the manufacturer's instructions. The PCR product was purified using EZNA Cycle Pure kit and sequenced.

Spider mite cDNA amplification conditions: pre-denaturing at 92 ℃ for 2min;

92℃10s,57℃15s,68℃2.5min,4 cycles;

92℃10s,53℃15s,68℃2.5min,40 cycles;

extending at 68 ℃ for 7min; preserving at 4 ℃. Preserving at 4 ℃. Using cDNA as template and Expand ^TM Long Range dNTP Pack amplification.

cDNA gene fragment of tetur01g11260 (SEQ ID NO: 5) above:

ATGTGGACTTACCTCGATGTCCACCTTTACCTTACTTTACCCATTATAGCGTTGGAATACTCGCTTCTCCGACCCTTTCTCAATGTCCACGAATTCATCAAGATAGCCTTTATTTGTTCCAATGCCATGATTTACACAGTTCCTTGGGACAATTACATCGTTTACAATGAAGCCTGGTCTTATCCAATTGATCGGGTTCTCGGTGTAATTGGTTGGGTTCCATACGAAGAGTATGCCTTTTTCATTATACAAACAGTTTTAACGTCTTTCTGGACAATCCTATGGATGAGATGGTCAATCCCTTGTTTACATTTAAATTTCAATCGGTTTACATTTAATTGCGCTCGTTGGTTGCCCATGATTGCTTTAATAAGTCTAACTTATCTAGGCTTTAATCTTGGTACACCAGGAAGCAAAACATTTTACATGGGTGCTTTACTTTGGTGGATTTGTCCGGTAATTTGTTTCCTCTGGTTTGGTGCTGGCAATTATTTCCTGTCTCAATGGAAATTTTCTTTGACCAGTTTTATTGTCCCATCAATTTACCTCTGTTGGGTTGACACATTTTCACTGAGACAAGGTATATGGCATATCAATGAGGCAACAAGCCTGGAATGGTTTGTTGTTCCTGATTTACCCATTGAAGAGGCTACATTTTTCACTGTAGTCAATTTATTGATTGTCTTGGCCAATTGTGCCTTTGACAAGTCCAAGTGTCTTCTTGATTTGTATCCCGATCTGTTTCCAGTCAGTCCATCGTTAACAATCAATAGTTTACCCAATTATTTCAAGCAAACCTTCCTTGCCTTCATTGCCAGTGAACCAGATTTACCCAAGCAACGTTTAGATGACTTCAAAGTTTGCCTCAATGTTTTGTCTCGATCATCTAAATCGTTTACTGCAGCCGCTTCAACATTTCATTCAGGAATTAGGATCGACTTGAGCATTTTGTATGGATATGCTAGGGTAACAGATGACATGATTGACAACCAACAGGGAACTCAGGCTCGTCAGGAAAAGCTATCAATAATAAACAAATTTTTGGATCAATTATTTGCTTCAAGGCCAAAAAATAAATGGACTTACGATGTACCAACCAAAATGGATCCAACAGAAAAGGTTACCATAAATTGGAATGAATTTGAACATCTTTTATCGGATGAAGAATTGGCAGCATTCCGTTCACTGACGCATATCGTTTATTATCTTCCGTCTGAACCATTTTACGAGCTTTCCAGAGGCTATGCATGGGATATTGAGGGTAAAAAAGTCGAAACAGAAGCCGATTTACTAGAATACTCATCATATGTGGCTTCTTCCATTGGAATCCTATGTACCTTTGTAATGTGCTACAAAAGTGGCAAGTTTCCTAATGGAGTAACCAAAGAGCACATTTCAATGATTGAAAGGGCTAAAGAAATGGGCCAGGTATTACAGATTGTAAACATTGCCCGTGATATTGTTACTGATAGTCAAACACTGGGTCGTTGTTATGTTCCTTCTAATTACATGGATTCACCGGAAAAAGAACTGAAGTTACTTAAAGATGATAGGAATCCTTGGGCCTTAGGTGAGGATAAATTGAAAAGATATGCTCTTCAAATGCTCAATTTAGCTGACGATTATGCTCGAACTGCTTTAAATGGTATTGCTCTATTACCTAGTGAGGTTCAAGCTCCTGTTCTGGTGACAACAGAAATTTATCGAATGATTGGTGTTCAAATAGCATCTCAATCAGGTTATTTGGAGAGAGTTTATGTTTCCAAAGTGAAAAAGCTAATGATTGCCTTAACTTGTATGTATGCAAAATTTATTCGTATTCAAAAGAAATTTAGTTTCCATGAAAAATCAAATTGA。

cDNA Gene fragment of tetur13g03250 (SEQ ID NO: 6)

ATGGTTTTGGAAGCTTTGGTGAAATGGAAGGCTGAAGCAGCAAACAAGAATCTTGGGTCAGAGATGAATAACGATCCTCAGCTTTATGATAAATCCAATGGATTACAGAAGAAAGATTCTGAATATCTCTTGAAGAGACTGGAAAAAGATTTTCAAAATGTTTCTCCAAAGGTAATTGTGGACATTGGATGTGGAACTGGAAATATAACGAAAATGATTTACTCCAGTTTTCCCGATTCACGAATCATTGGTTTCGATTGCAGTGAAAAGATGATTGAATTTGCTCGGGAAAATTATTCAACCTCCAACCTCAACTTTCATTGTGGAAACATTTGTGCCGATTGGGAAGAACTGTCAGTTAACTTGGACATAGAAGCGGAATCGGTTGACGTAGTTACATCTACTTTTTGCCTTCATTGGGTTACGAATACTGCCAAAGCCATGGAAAACATCAATAAAATGCTGAAGCCAGGAGGAAAATGTTATTTATTGATGTTTTCTTGGAGCCCCATTTTTCCCCTTCAAGAACAGATAACATATCAAGAACCTTGGTATGAATTGTTTCAAAAGCTTGAGGTTCCTATGGATCATGAGAAACCCAAATATGCTACAAAACCTCAGTCAGATATAAAATCTGAGCTTGCTCGGCGAGCCTCAACCTCTCAATTAGCCGATTCCCAACATTTGCTTGATTTGGCTAAACCCAAGTCTAAATCTTCAACCATTCGTAGGAAATCATCGGCTCCGTTCCCTGTTTATGAGATTCCTCCTGAGAAAGAACGAATTGATCACTGGATGCAATTGTGTGAAACTGCTAATTTGAAGCCTATTGAAGTGGCAATACATGACTCGACTTTCACTTATGAAGATATTGAAGGATTCAAAGGTGAATTGGTATCTTTGTGTCACTTTCTGGCTCATGTTCCGAAAGATTTGCATCCTCAATTTCTGAACGACTATTATGAACACATGAGAAGGGTTTTCATTGCACATCAGAGTACTTTGCCAAAGATCAACGTAGATTACCAATTTTTAACCGCAATAGCCGAAAAACCTGCGACCAATGACACAAAGAATAAGATTAACAAAGACGAAAACCAAAATGAATATGAGACTGAAATCTAA。

2. Results and analysis

1. SgRNA guide sequence design and in vitro Cas9-SgRNA cleavage

The SgRNAs of tetur01g11260 and tetur13g03250 are selected, and the SgRNAs with higher scores are selected through website prediction. After the PCR amplified fragments of tetur01g11260 and tetur13g03250 are cut by the Cas9-SgRNA in vitro, the correct prediction cleavage mode is obtained.

2. In vivo Cas9-SgRNA experiments

2.1 screening of albino Male offspring

RNP mixtures of TETUR01g11260, TETUR13g 03210, cas9 and SgRNA (SgRNA 1 and SgRNA 2) were injected into unfertilized female ovaries, with a proportion of viable females of 78.5% 24 hours after injection, taking TETUR01g11260 as an example. Injected females lay eggs for 24 hours and are placed on new leaf discs, where they lay eggs again for 24 hours. After 24 hours and 24-48 hours, there were 550 and 320 eggs on the leaf disk, respectively. After hatching, male spider mites lacking pigments were screened. In leaf discs with eggs accumulated within 24 hours after injection, one live albino male was found, and 11 mites with albino phenotype were detected in larvae/nymphs produced by eggs deposited between 24 and 48 hours after injection. However, none of these nymphs developed into adults. Live albino males were isolated, allowed to develop to the adult stage and crossed to obtain homozygous stable lines, and further characterized as lacking red pigment at all life stages of the line.

Experiments with tetur13g03250 revealed that none of the nymphs developed to adults, since tetur13g03250 was associated with juvenile hormone. It is possible that mite growth was affected by knockout of the tetur13g 0350 gene.

2.2 genetic Pattern and complementation test of CRISPR line phenotypes

Male offspring of unfertilized females injected with Cas 9-sgrnas were crossed with the wild type population to determine the genetic basis of their albino phenotype. In all cases, the F1 females of the hybrid offspring had normal body and eye color. Additionally, in F2 haploid offspring produced from unfertilized F1 females, the ratio of albinism to wild type phenotype is about 1:1, strongly indicating albinism is inherited as a monogenic recessive trait. Females of the CRISPR line were crossed with males of wild type and all female F1 offspring were found to be albino. This complement deletion suggests that the CRISPR albino phenotype is caused by mutation or disruption of the gene tetur01g11260 targeted by Cas9-SgRNA experiments.

2.3 sequence analysis of related genes for carotenoid Synthesis and juvenile hormone in CRISPR lines

DNA was extracted from the CRISPR strain, and sequencing of PCR amplified fragments 1 and 2 revealed that interruption and deletion occurred.

Taking tetur01g11260 as an example, the CRISPR line has a 5bp deletion, located 3bp upstream of the SgRNA2 PAM site, resulting in a deletion of two amino acids, altering translation of the carotenoid binding domain region, and to ensure that the detected deletion is the only interruption in the tetur01g11260 coding sequence, the complete cDNA sequences of the CRISPR line and the wild-type tetur01g11260 were sequenced. The results show that the cDNA sequence of the CRISPR line is 100% identical to the wild type cDNA sequence, except for a 5bp deletion.

In summary, carotenoid synthesis and juvenile hormone-related gene mutation lead to albino and ecdysis death phenotypes. The present invention exploits this finding to design a CRISPR-Cas9 strategy that uses sgrnas to target spider mite carotenoid synthesis and juvenile hormone related genes.

In this study, unfertilized spider mite females were injected with Cas9-SgRNA and white males were identified in offspring of female oviposition development within 24 hours after injection. Subsequently, homozygous albino versions were generated in these males, and both genetic patterns and complementation experiments showed that disruption of tetur01g11260 resulted in a albino phenotype. Furthermore, no sequence of the sgrnas predicted off-target effects. Further, to assess whether the tetur01g11260 disruption was caused by a typical CRISPR-Cas9 event, we sequenced tetur01g11260 at the DNA and cDNA level, with varying degrees of deletion. Undoubtedly, cas9 induced deletions are the underlying genetic basis for the albino phenotype. The test is carried out on tetter 01g11260 and tetter 13g03250 together in the study, and the fact that the mutation of tetter 01g11260 causes the tetranychus to have a albino phenotype, and the tetter 13g03250 causes the mites to be unable to molt and have a stagnant development and cause the mites to die is found, so that the tetter 13g03250 affects the growth and development of the mites.

The percentage of CRISPR-Cas9 transformed mite embryos was lower based on the total number of injected female eggs. However, this frequency is similar to the frequency originally reported for genetic transformation of non-model insects. Second, in contrast to the leaf discs of 24-hour eggs, no viable albino males could be obtained from the leaf discs of 24-48 hour eggs, as none of the albino larvae detected developed into adults. To enhance the likelihood that albino males with the same phenotype observed within 24-48 hours are caused by CRISPR-Cas9 events, the genes of these dead young males should be sequenced. However, the larvae/nymphs stage dead males are very small and difficult to manipulate. In conclusion, the CRISPR-Cas9 technology is used for inducing mutation events in the spider mites, so that theoretical basis is provided for the application of CRISPR-Cas9 in the spider mites, and a foundation is laid for the functional research in the spider mites in the future.

The above-described embodiments are merely illustrative of the preferred modes of the present invention, and do not limit the scope of the present invention

Various modifications and improvements of the technical scheme of the invention, which are carried out by those skilled in the art, are considered to fall within the protection scope of the invention as defined in the claims.

Claims

1. An sgRNA comprising any one of the following (1) - (2):

2. A CRISPR-Cas 9-based spider mite gene editing system, comprising the SgRNA of claim 1.

3. A method for constructing a spider mite mutant based on a CRISPR-Cas9 spider mite gene editing system, which is characterized by comprising the following steps: cas9 and the SgRNA of claim 1 are mixed in a molar ratio of 1:2 to obtain a Cas9-SgRNA complex, the Cas9-SgRNA complex is transferred into spider mites, and spider mite mutants are obtained through screening.

4. A method according to claim 3, wherein when the sequence set forth in SEQ ID NO:1-2, mixing SgRNA shown in the formula 1-2 with Cas9 to form a Cas9-SgRNA compound, transferring the Cas9-SgRNA compound into the spider mites, and screening to obtain albino spider mite mutants;

5. Use of a SgRNA according to claim 1 or a spider mite gene editing system according to claim 2 for the preparation of a product for controlling spider mites.

6. Use of a SgRNA according to claim 1 or a spider mite gene editing system according to claim 2 for the preparation of a product for regulating the albino phenotype and/or the growth and development of spider mites.

7. Use of the SgRNA of claim 1, or the spider mite gene editing system of claim 2, in the construction of spider mite mutants.

8. The use according to claim 7, wherein the spider mite mutants include albino spider mite male mutants and mutants with stunted larval growth.