CN116855496B - Application of expression plasmid containing interference sequence siRNA-HIF-1 alpha in preparation of anti-hepatocellular carcinoma drug - Google Patents

Application of expression plasmid containing interference sequence siRNA-HIF-1 alpha in preparation of anti-hepatocellular carcinoma drug Download PDF

Info

Publication number
CN116855496B
CN116855496B CN202310817378.XA CN202310817378A CN116855496B CN 116855496 B CN116855496 B CN 116855496B CN 202310817378 A CN202310817378 A CN 202310817378A CN 116855496 B CN116855496 B CN 116855496B
Authority
CN
China
Prior art keywords
hif
sirna
alpha
tumor
lenvatinib
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202310817378.XA
Other languages
Chinese (zh)
Other versions
CN116855496A (en
Inventor
陈鹏飞
贾慧婕
赵铁锁
任建庄
王艳玲
段旭华
朱兴书
陈金威
李昆
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhengzhou University
Xinxiang Medical University
Original Assignee
Zhengzhou University
Xinxiang Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhengzhou University, Xinxiang Medical University filed Critical Zhengzhou University
Priority to CN202310817378.XA priority Critical patent/CN116855496B/en
Publication of CN116855496A publication Critical patent/CN116855496A/en
Application granted granted Critical
Publication of CN116855496B publication Critical patent/CN116855496B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/42—Salmonella
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to the field of biotechnology. The invention provides an application of an expression plasmid containing an interference sequence siRNA-HIF-1 alpha in preparing an anti-hepatocellular carcinoma drug. The invention constructs the interference sequences siRNA-HIF-1 alpha-1, siRNA-HIF-1 alpha-2, siRNA-HIF-1 alpha-3, siRNA-HIF-1 alpha-4 and recombinant plasmid expressing the corresponding interference sequences, and uses attenuated salmonella to carry the recombinant plasmid, thereby effectively inhibiting the tumor growth of tumor-bearing mice, prolonging the survival time of the mice, promoting the apoptosis of tumor cells and improving the anti-tumor immune response of organisms; in addition, the attenuated salmonella carrying interference sequence siRNA-HIF-1 alpha can be used in combination with Lenvatinib, so that the anti-hepatocellular carcinoma effect of Lenvatinib can be effectively increased, and the anti-tumor immune response of tumor-bearing mice can be better enhanced.

Description

Application of expression plasmid containing interference sequence siRNA-HIF-1 alpha in preparation of anti-hepatocellular carcinoma drug
Technical Field
The invention relates to the field of biotechnology, in particular to application of an expression plasmid containing an interference sequence siRNA-HIF-1 alpha in preparation of anti-hepatocellular carcinoma drugs.
Background
HCC is one of the common digestive tract tumors in our country, and 2022 statistics show that: the mortality rate of men is 6%, the mortality rate of women is 4%, the relative survival rate of women is 20% in 5 years, and the male is one of the most fatal cancers, and seriously endangers national health. Currently, HCC treatment methods include surgical resection, liver transplantation, radio frequency ablation, radiation therapy, immunotherapy, and the like. However, since liver blood supply is abundant and the structure is complicated, and early symptoms of most HCC patients are atypical, it is not timely to find that middle, late and metastatic HCC patients mostly develop drug resistance after radiotherapy and chemotherapy, prognosis is poor, and HCC treatment is a great problem which afflicts the medical community, it is urgent to find an effective method for treating HCC.
HCC is a typical vascular-rich tumor, and HCC growth is closely related to tumor angiogenesis, a complex pathophysiological process. Normally, there is a balance between the expression of angiogenic factors and the release of anti-angiogenic factors, whereas in HCC tumor cells, vascular endothelial cells and immune cells highly express angiogenic factors, leading to the accelerated formation of abnormal blood vessels, the growth of which provides nutrients for the growth of the tumor. Vascular endothelial growth factor (vascular endothelialgrowthfactor, VEGF) plays an important role in tumor angiogenesis and tumor progression. VEGF continues to be expressed as the tumor progresses. High expression of VEGF in HCC patients is closely related to accelerated disease progression and low patient survival, and the potential effect of VEGF on the function of immune cells and other stromal cells (such as fibroblasts and endothelial cells), drugs against VEGF signaling have been used to recommend anti-angiogenic therapies.
HIF-1 is a heterodimer consisting essentially of a constitutively expressed HIF-1 beta subunit and a highly regulated HIF-1 alpha subunit, which is an oxygen homeostasis regulator expressed in almost all nucleated mammalian cells, and is one of the important targets for cancer therapy in recent years.
Lenvatinib is a tyrosine kinase receptor inhibitor, which can inhibit the kinase activity of vascular endothelial growth factor VEGFR1-3, inhibit other tumor pathological angiogenesis and regulate and control tumor microenvironment, thereby inhibiting tumor growth and disease progression. However, the therapeutic effect is still affected by various factors, such as the hypoxic environment of the tumor, so how to regulate the hypoxic environment of the tumor, and increase the therapeutic effect of Lenvatinib is attracting attention of students.
Disclosure of Invention
The invention aims to provide an application of an expression plasmid containing an interference sequence siRNA-HIF-1 alpha in preparing an anti-hepatocellular carcinoma drug, and constructs recombinant plasmids containing the interference sequences siRNA-HIF-1 alpha-1, siRNA-HIF-1 alpha-2, siRNA-HIF-1 alpha-3, siRNA-HIF-1 alpha-4 and the expression of corresponding interference sequences, and uses attenuated salmonella to carry the recombinant plasmids, so that the recombinant plasmids can be used in combination with Lenvatinib, the anti-hepatocellular carcinoma effect of Lenvatinib can be effectively increased, and the anti-tumor immune response of tumor-bearing mice can be better enhanced.
In order to achieve the above object, the present invention provides the following technical solutions:
The invention provides an interference sequence siRNA-HIF-1 alpha, which comprises an siRNA-HIF-1 alpha-1 sequence, an siRNA-HIF-1 alpha-2 sequence, an siRNA-HIF-1 alpha-3 sequence or an siRNA-HIF-1 alpha-4 sequence.
Preferably, the siRNA-HIF-1 alpha-1 sequence is shown as SEQ ID NO. 1; the siRNA-HIF-1 alpha-2 sequence is shown as SEQ ID NO. 2; the siRNA-HIF-1 alpha-3 sequence is shown as SEQ ID NO. 3; the siRNA-HIF-1 alpha-4 sequence is shown as SEQ ID NO. 4.
The invention also provides an expression plasmid containing the interference sequence siRNA-HIF-1 alpha.
Preferably, the original plasmid used is the pSilencer plasmid.
Preferably, the interfering sequence siRNA-HIF-1. Alpha. Is inserted between the BamHI and HindIII cleavage sites of the original plasmid.
The invention also provides a strain for expressing the interference sequence siRNA-HIF-1 alpha, which uses attenuated salmonella as host bacteria to transform the expression plasmid.
The invention also provides an expression plasmid containing the interference sequence siRNA-HIF-1 alpha and application of the strain in preparing anti-hepatocellular carcinoma medicaments.
Preferably, the expression plasmid may also be used in combination Lenvatinib.
By adopting the technical scheme, the invention has the following beneficial effects:
1. the invention screens out that the interference sequence siRNA-HIF-1 alpha-3 can inhibit the expression of HIF-1 alpha in cells most obviously and has the best repeatability (P < 0.0001).
2. The attenuated salmonella carrying siRNA-HIF-1 alpha can inhibit the tumor growth of tumor-bearing mice, prolong the survival time of the mice, reduce the cell proliferation and the blood vessel formation in tumor tissues and promote the apoptosis of tumor cells; can effectively improve the infiltration rate of T lymphocytes and M1 type macrophages in tumor tissues of tumor-bearing mice and the immune cell rate in spleen, and improve the anti-tumor immune response of organisms.
3. The attenuated salmonella carrying siRNA-HIF-1 alpha can be used in combination with Lenvatinib, so that the effect of resisting hepatocellular carcinoma can be effectively enhanced, the tumor growth of tumor-bearing mice can be better inhibited, the apoptosis of tumor cells can be promoted, and the anti-tumor immune response of organisms can be improved.
Drawings
FIG. 1 is a schematic diagram showing the local secondary structure of HIF-1α mRNA, a target region of HIF-1α, which is a target region of 4 interfering sequences;
FIG. 2 shows the interference of 4 interference sequences siRNA-HIF-1 alpha on HIF-1 alpha expression verified by the Westernblot method (A in FIG. 2 shows the expression of related molecules for Western blot detection, B in FIG. 2 shows the statistical analysis of Western blot; 3-1, 3-2, 3-3 are 3 repeated wells of plasmid 3, 4-1, 4-2 are 2 repeated wells of plasmid 4);
FIG. 3 shows the effect of different groups on the growth and survival of mouse tumors (A in FIG. 3 is a picture of mouse tumor tissue, B in FIG. 3 is a statistical analysis of tumor weight, C in FIG. 3 is a statistical analysis of changes in tumor volume in mice, D in FIG. 3 is a change in body weight in mice, E in FIG. 3 is survival of tumor bearing mice (n=10); P <0.05 compared to PBS group, # represents P <0.05 compared to Scramble group, $ represents P <0.05 compared to siRNA-HIF-1α group, & represents P <0.05 compared to Lenvatinib group);
FIG. 4 shows the detection of apoptosis in tumor cells by TUNEL method (A in FIG. 4 shows the result of FITC labeling, and B in FIG. 4 shows the apoptosis index);
FIG. 5 shows the expression of different groups of related molecules for Westernblot detection of apoptosis, proliferation and migration in tumor tissue (A in FIG. 5 shows the expression pattern of the related molecules for Western blot detection, B in FIG. 5 shows the Western blot statistical analysis of the related molecules for apoptosis in tumor tissue, and C in FIG. 5 shows the Western blot statistical analysis of the related molecules for proliferation and migration in tumor tissue);
FIG. 6 shows the immunohistochemical detection of Ki-67, PCNA expression in tumor tissue in different groups (A in FIG. 6 shows the staining of Ki-67 in tumor tissue, B in FIG. 6 shows the immunohistochemical statistical analysis of Ki-67 in tumor tissue, C in FIG. 6 shows the staining of PCNA in tumor tissue, D in FIG. 6 shows the immunohistochemical statistical analysis of PCNA in tumor tissue; P <0.05 compared to PBS group, # represents P <0.05 compared to Scramble group, $ represents P <0.05 compared to siRNA-HIF-1. Alpha.) & P <0.05 compared to Lenvatinib group, & gt;
FIG. 7 shows the immunohistochemical detection of CD31, CD34 and VEGF expression in different groups (A in FIG. 7 is the staining of CD31, CD34 and VEGF, B in FIG. 7 is the immunohistochemical statistical analysis of CD31, CD34 and VEGF);
FIG. 8 shows the expression of the angiogenesis-related molecules detected by Western blot in different groups (A in FIG. 8 shows the expression pattern of the angiogenesis-related molecules detected by Western blot, B in FIG. 8 shows the statistical analysis of Western blot; P <0.05 in comparison with PBS group, # represents P <0.05 in comparison with Scramble group, $ represents P <0.05 in comparison with siRNA-HIF-1. Alpha.) & represents P <0.05 in comparison with Lenvatinib group,;
FIG. 9 shows the effect of siRNA-HIF-1α combination Lenvatinib treatment on immunocell infiltration in tumor tissue (A in FIG. 9 shows infiltration of CD4 + T cells in immunofluorescent-detected tumor tissue, B in FIG. 9 shows infiltration of CD4 + T cells in immunofluorescent-detected tumor tissue, C in FIG. 9 shows infiltration of CD8 + T cells in immunofluorescent-detected tumor tissue, D in FIG. 9 shows CD8 + T cells in immunofluorescent-detected tumor tissue, E in FIG. 9 shows infiltration of activated lymphocytes in immunofluorescent-detected tumor tissue, F in FIG. 9 shows activated lymphocyte immunofluorescent-detected tumor tissue, G in FIG. 9 shows infiltration of M1 macrophages in immunofluorescent-detected tumor tissue, H in FIG. 9 shows M1-type immunofluorescent-detected macrophages,; represents P <0.05 compared to PBS group, # represents P <0.05 compared to Scramble, and $ represents P <0.05 compared to siRNA-1α group, & P <0.05 compared to Lenvatinib group);
FIG. 10 shows the effect of siRNA-HIF-1α combination Lenvatinib treatment on spleen immune cells (FIG. 10A shows the detection of CD4 + T lymphocyte fraction, FIG. 10B shows the detection of CD8 + T lymphocyte fraction, FIG. 10C shows the detection of Treg cell fraction, FIG. 10D shows the detection of activated CD8 + T lymphocyte fraction, FIG. 10E shows the detection of NK1.1 cell fraction, FIG. 10F shows flow cytometry analysis; P <0.05, # shows P <0.05 compared to group Scramble, # shows P <0.05 compared to group siRNA-HIF-1α, & shows P <0.05 compared to group Lenvatinib);
FIG. 11 shows the effect of siRNA-HIF-1. Alpha. Combination Lenvatinib treatment on tumor-bearing mouse organs.
Detailed Description
The invention provides an interference sequence siRNA-HIF-1 alpha, which comprises an siRNA-HIF-1 alpha-1 sequence, an siRNA-HIF-1 alpha-2 sequence, an siRNA-HIF-1 alpha-3 sequence or an siRNA-HIF-1 alpha-4 sequence.
In the invention, the siRNA-HIF-1 alpha-1 sequence is shown as SEQ ID NO:1, and is specifically as follows: GATCCGTCTAGAGATGCAGCAAGATCTTCAAGAGAGATCTTGCTGCATCTCTAGACT TTTTTGGAAA;
the siRNA-HIF-1 alpha-2 sequence is shown as SEQ ID NO. 2, and is specifically as follows: GATCCTGTGAGCTCACATCTTGATAATTCAAGAGATTATCAAGATGTGAGCTCACATT TTTTGGAAA;
The siRNA-HIF-1 alpha-3 sequence is shown in SEQ ID NO:3, and is specifically as follows: GATCCCAGATGACGGCGACATGGTTTTTCAAGAGAAAACCATGTCGCCGTCATCTG TTTTTTGGAAA;
The siRNA-HIF-1 alpha-4 sequence is shown as SEQ ID NO. 4, and is specifically as follows: GATCCCTAGCTGGACACAGTGTGTTTTTCAAGAGAAAACACACTGTGTCCAGCTAG TTTTTTGGAAA.
The invention also provides an expression plasmid containing the interference sequence siRNA-HIF-1 alpha.
In the present invention, the expression plasmids are pSi-HIF-1α -1 containing siRNA-HIF-1α -1 sequence, pSi-HIF-1α -2 containing siRNA-HIF-1α -2 sequence, pSi-HIF-1α -3 containing siRNA-HIF-1α -3 sequence, and pSi-HIF-1α -4 containing siRNA-HIF-1α -4 sequence, respectively.
In the present invention, the original plasmid used for constructing the expression plasmid is preferably a pSilencer plasmid.
In the present invention, the interfering sequence siRNA-HIF-1α is preferably inserted between BamHI and HindIII cleavage sites of the original plasmid.
The invention also provides a strain for expressing the interference sequence siRNA-HIF-1 alpha.
In the present invention, it is preferable to transform the expression plasmid using attenuated salmonella as a host bacterium.
The invention also provides an expression plasmid containing the interference sequence siRNA-HIF-1 alpha and application of the strain in preparing anti-hepatocellular carcinoma medicaments.
In the present invention, the expression plasmid may also be used in combination Lenvatinib.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
EXAMPLE 1 construction and functional verification of attenuated Salmonella carrying siRNA-HIF-1. Alpha. Plasmid
(One) Synthesis of interfering sequence siRNA-HIF-1 alpha
Based on the gene sequence of HIF-1. Alpha. (NCBI, X95580.1), the interfering sequences siRNA-HIF-1. Alpha., specifically, the siRNA-HIF-1. Alpha. -1 sequence, the siRNA-HIF-1. Alpha. -2 sequence, the siRNA-HIF-1. Alpha. -3 sequence and the 4 interfering sequences of the siRNA-HIF-1. Alpha. -4 sequence were designed (see FIG. 1).
The siRNA-HIF-1 alpha-1 sequence is shown as SEQ ID NO.1 and is GATCCGTCTAGAGATGCAGCAAGATCTTCAAGAGAGATCTTGCTGCATCTCTAGACT TTTTTGGAAA;
The siRNA-HIF-1 alpha-2 sequence is shown as SEQ ID NO.2 and is GATCCTGTGAGCTCACATCTTGATAATTCAAGAGATTATCAAGATGTGAGCTCACATT TTTTGGAAA;
The siRNA-HIF-1 alpha-3 sequence is shown as SEQ ID NO. 3 and is GATCCCAGATGACGGCGACATGGTTTTTCAAGAGAAAACCATGTCGCCGTCATCTG TTTTTTGGAAA;
The siRNA-HIF-1 alpha-4 sequence is shown as SEQ ID NO. 4 and is GATCCCTAGCTGGACACAGTGTGTTTTTCAAGAGAAAACACACTGTGTCCAGCTAG TTTTTTGGAAA.
(II) preparation of siRNA-HIF-1. Alpha. Plasmid
SiRNA-HIF-1 alpha double stranded oligonucleotide annealing
And obtaining corresponding siRNA-HIF-1 alpha-anti sequences according to the designed 4 interference sequences siRNA-HIF-1 alpha.
According to the synthesis sequence instruction (WUHan Jin Kairui bioengineering Co., ltd.), substances on the tube wall were centrifuged by a centrifuge for 2 minutes, 13.5. Mu.L of ultrapure water was added to siRNA-HIF-1α -1, 13.6. Mu.L of ultrapure water was added to siRNA-HIF-1α -anti-1, 13.3. Mu.L of ultrapure water was added to siRNA-HIF-1α -2, 13.4. Mu.L of ultrapure water was added to siRNA-HIF-1α -3, 13.6. Mu.L of ultrapure water was added to siRNA-HIF-1α -anti-3, 13.7. Mu.L of ultrapure water was added to siRNA-HIF-1α -4, and 13.6. Mu.L of ultrapure water was added to siRNA-HIF-1α -anti-4, respectively, to prepare 100. Mu.M.
The primer concentration was then diluted from 100. Mu.M to 20. Mu.M with DEPC water and the reagents in Table 1 were added to a 1.5mL EP tube. The temperature of the metal bath is adjusted in advance, the EP tube added with the reagent is firstly put into a constant temperature of 90 ℃ for incubation for 3min, the constant temperature of 37 ℃ for incubation for 1h, and finally put into a refrigerator with the temperature of minus 20 ℃ for standby.
Table 1 related reagents and amounts thereof
SiRNA-HIF-1 alpha plasmid construction
(1) SiRNA-STAT3 JM109 strain (JM 109 strain is purchased from Tiangen Biochemical technology (Beijing) Co., ltd.) was obtained by synthesizing the strain based on JM109, the synthesis process was referred to "in vivo and vitro experimental study of attenuated Salmonella carrying coexpression siRNA-Stat3 and GRIM-19 plasmid against prostate cancer"), which was removed from a refrigerator at-80℃and thawed on ice, the bacterial stations were irradiated with ultraviolet rays in advance, the alcohol lamps were ignited, the inoculating loop was burned red with an external flame of the alcohol lamp, and after cooling, the strain was spread on an ampicillin-positive culture plate, and the culture plate was then cultured in a incubator at 37 ℃.
(2) After 12h of culture, the culture plate is observed, if a monoclonal colony grows out of the culture plate, the culture plate is sealed by a sealing film and placed in a refrigerator at 4 ℃ for standby.
(3) Selecting and shaking: placing 50mL centrifuge tubes, liquid culture medium and other articles into a bacteria ultra-clean workbench, irradiating with ultraviolet rays for 30min, igniting an alcohol lamp, adding 10mL LB liquid culture medium into the 50mL centrifuge tubes, and according to the liquid culture medium: ampicillin = 1000:1 ratio ampicillin was added, monoclonal colonies were picked up with a 100 μl gun head in a 50mL centrifuge tube, gently blown with a loading gun, the wall was marked, and then placed in a 37 ℃ thermostatted shaker at 180rpm overnight.
(4) The next morning the shaker was turned to 220rpm and rocked for 1 hour to extract the plasmids (the plasmid extraction kit according to the invention is a small and medium-sized endotoxin-free plasmid kit manufactured by TIANGEN company).
(5) The ultra-micro spectrophotometer was cleaned in advance with ultra-pure water to prevent errors in measurement, then 1 mu LPSILENCER of plasmid was sucked up by a sample gun and added to the machine well, and the plasmid concentration was measured and recorded.
(6) 4 New 1.5mLEP tubes were prepared and the reagents in Table 2 were added sequentially. Then the metal bath is opened in advance, the metal bath is incubated for 7min at 30 ℃, then the metal bath is incubated for 7min at 37 ℃, the metal bath is quickly inserted into ice after the incubation is finished, and 10 mu L of 6×loading Buffer is added to prepare an enzyme digestion solution.
TABLE 2 types and amounts of reagents
(7) 4 New 1.5mL EP tubes were also prepared and the corresponding reagents in Table 3 were added to make control solutions.
TABLE 3 types and amounts of reagents
(8) Weighing 0.7g agarose, putting into a clean small beaker, adding 35mL 1 xTAE, preparing 2% agarose gel, putting into an electrophoresis tank, putting the electrophoresis tank with good positive and negative poles, adding 1 xTAE into the electrophoresis tank until the agarose gel overflows a sample adding hole, sequentially adding samples according to D20007 mu L, plasmid control 6 mu L and enzyme cutting solution 20 mu L, adjusting the voltage to 140V, adjusting the time to 15min, and taking out the gel after electrophoresis is finished.
(9) The gel imaging system was turned on to see if the cleavage was successful.
(10) Sterilizing the carving knife, roasting with an alcohol lamp, cooling, opening ultraviolet, cutting off empty plasmid ring on gel, placing on clean sealing film, wrapping, freezing at-20deg.C for 20min, squeezing, and sucking liquid into 1.5mL EP tube to obtain empty plasmid.
(11) 4 EP tubes (1.5 mL) were prepared, the reagents in Table 4 were added sequentially, the temperature of the water bath was adjusted to 25℃in advance, and then the water bath was performed for 10min to prepare ligation plasmids, pSi-HIF-1α -1, pSi-HIF-1α -2, pSi-HIF-1α -3 and pSi-HIF-1α -4, respectively.
TABLE 4 types and amounts of reagents
3. JM109 transformation of the siRNA-HIF-1. Alpha. Plasmid, strain retention and plasmid extraction
(1) Taking JM109 competent cells out of a refrigerator at-80 ℃, placing ice for melting, simultaneously irradiating a bacteria table with ultraviolet light, sucking the 4 plasmid connection systems with a sample gun, adding all the plasmid connection systems into the corresponding 4 JM109 competent cells (marked clearly on competent cell tubes), gently mixing, placing the mixture on ice for 20min, placing the mixture into a water bath of a water bath kettle at 42 ℃ for 45s, rapidly placing the mixture on ice for 2min (the water bath and the rest process are not required to be moved as much as possible), sucking 900 mu L of LB liquid culture medium into each tube with the sample gun, fastening an EP tube, inserting a sample into a buoy card, placing the mixture into a shaking table at 37 ℃, keeping constant temperature at 220rpm, and shaking for 1h. After shaking, the mixture was centrifuged at 4℃for 3min at 8000rpm, the supernatant was discarded, 100. Mu.L was left to be gently beaten and mixed to precipitate, and the precipitate was spread on 4 ampicillin positive plates with a tripod, respectively, and then placed in a 37℃incubator overnight.
(2) After culturing for 12-14h, observing whether a monoclonal colony grows out, and if so, storing in a refrigerator at 4 ℃ for standby. And (3) constructing the siRNA-HIF-1 alpha plasmid by the steps of selecting and shaking the bacteria in the afternoon.
(3) On the third day, 800. Mu.L of bacterial liquid and 200. Mu.L of 50% glycerol are sucked by a sample gun and blown and mixed uniformly in a 1.5mL EP tube, strains are reserved, the strains are placed in a refrigerator at the temperature of minus 80 ℃ for preservation, the rest bacterial liquid is subjected to double shaking for 1 hour at the speed of 220rpm at the temperature of 37 ℃ in a constant temperature shaking table, and then plasmids are extracted, and the steps are the same as those of the construction of siRNA-HIF-1 alpha plasmids (4) - (5).
(III) siRNA-HIF-1 alpha plasmid restriction enzyme digestion verification
(1) 4 New 1.5mL EP tubes were prepared, siRNA-HIF-1. Alpha. Plasmids were added, and the remaining steps were constructed as described above for siRNA-HIF-1. Alpha. Plasmids (6) - (8).
(2) Ligation was confirmed to be successful if the siRNA-HIF-1. Alpha. Plasmid was excised by observation under a gel imager.
(IV) verifying the interference effect of the 4 interference sequences siRNA-HIF-1α on HIF-1α expression
SiRNA-HIF-1 alpha plasmid transfection of tumor cells
(1) The well-grown tumor cells are taken and prepared according to 3.5X10 5 cells/hole, a six-hole plate is paved, the six-hole plate is put into a cell culture box with 5 percent CO 2 and the temperature of 37 ℃ for incubation, and when the density of the cells in the hole reaches 80-90 percent, transfection is carried out, and Lipofectamine 3000 transfection reagent is used.
(2) Two sets of 1.5mL EP tubes, 6 in each set, respectively marked as A1, A2, A3, A4, A5, A6 and B1, B2, B3, B4, B5 and B6, 125 mu L opti is added into the EP tube marked with A1-6, and 4 mu L lip3000 transfection reagent is required to be added into the EP tube marked with A2-6; similarly, each of B1-6 was added with 125. Mu.L opti, and the other of B2-6 was added with 5. Mu.L P3000, while the remaining 3-6 numbers were added with plasmids (the volume of added plasmids was calculated according to Lipofectamine 3000 transfection reagent Specification), and then A and B were gently mixed according to the corresponding serial numbers, and left to stand at room temperature for 15min.
(3) Discarding the culture medium in the six-hole plate, adding 1mLPBS to wash dead cells in each hole, discarding PBS, adding 1750 mu L of Opti-MEM culture medium in each hole, adding the corresponding 1-6 mixed solution, lightly beating the six-hole plate to ensure that the culture medium is uniformly distributed, and culturing in a cell culture box.
(4) After 24h incubation, cellular proteins were extracted.
SiRNA-HIF-1 alpha plasmid function verification (cell Westernblot experiment)
(1) Protein sample preparation: the same procedure as described above for extracting cellular proteins.
(2) Protein electrophoresis: a. preparing lower glue; b. preparing an upper layer of glue; c. preparing; d. sample adding; e. electrophoresis; f. carrying out electric rotation; g. closing; h. sealing the primary antibody; i. sealing the secondary antibody; j. exposure imaging, and specific operation process is carried out according to the specification.
(3) The sequence most obvious in HIF-1 alpha inhibition is selected from 4 sequences according to the exposure result.
As a result, as shown in FIG. 2, the interference sequence siRNA-HIF-1. Alpha. -3 was able to significantly inhibit expression of HIF-1. Alpha. In cells, and was most reproducible (P < 0.0001), compared to the control group, and therefore, the plasmid was selected for the next experiment and the sequence was protected.
Six siRNA-HIF-1 alpha plasmid electrotransfer into attenuated mouse salmonella competence
1. The attenuated salmonella (which is attenuated by a refrigerator at-80 ℃ C., reference "Intratumoral delivery and suppression of prostate tumor growth by attenuated Salmonella enterica serovar typhimurium carrying plasmid-based small interfering RNAs" and "in vivo and in vitro experimental study of the attenuated salmonella carrying the coexpression siRNA-Stat3 and GRIM-19 plasmids against prostate cancer") were taken out of the refrigerator at-80 ℃ C.) and placed on ice until they melted, then spread on an ampicillin-negative culture plate, and placed in a bacterial incubator at 37 ℃ C. Overnight.
2. After the monoclonal bacterial colony grows, the following bacteria are picked and shaken, and the steps are constructed with siRNA-HIF-1 alpha plasmid (3).
3. 10% Sterile glycerol was pre-chilled in a refrigerator at 4℃and inoculated in a 1:100 ratio to 30mL of ampicillin-negative LB broth, and then shaken at 220rpm for 2h. The OD value of the bacterial liquid is measured by adjusting the wavelength of a spectrophotometer to 600nm, shaking is stopped when the OD value reaches 0.5-0.6, the bacterial liquid is placed on ice for 1h, then the bacterial liquid is centrifuged by a centrifuge at 4 ℃ for 4000rpm,15min, the supernatant is discarded, 20mL of pre-cooled 10% sterile glycerol is added for lightly suspending precipitation, the supernatant is discarded before the centrifugation step, 10mL of pre-cooled 10% sterile glycerol is added for lightly suspending precipitation, the supernatant is discarded after the centrifugation step, 8mL of pre-cooled 10% sterile glycerol is lightly suspending precipitation, the supernatant is discarded before the centrifugation step, 2mL of pre-cooled 10% sterile glycerol is added for lightly suspending precipitation, the precipitate is split into 1.5mLEP tubes for 200 mu L, and then the bacterial liquid is immediately placed in a liquid nitrogen box for 1min, and then the bacterial liquid is stored in a refrigerator at-80 ℃.
4. 1. Mu.L of siRNA-HIF-1. Alpha. Plasmid with the best inhibition of HIF-1. Alpha. Expression screened in the earlier stage is sucked up to be added into the prepared attenuated salmonella competence, and the mixture is slowly mixed uniformly and then placed on ice for 10min (movement is avoided as much as possible). The mixture was sucked up by a sample gun and added to an electrode cup, then the electrode cup was placed in a discharge converter cell, the voltage of the electric converter was adjusted to 2500V, electric conversion was performed, when a buzzing sound was heard to indicate that the electric conversion was completed, then the mixture in the electrode cup was sucked out, and added to a 2mLEP tube containing 800. Mu.L of an ampicillin-negative LB liquid medium (note: this procedure was quick and gentle), then the EP tube was inserted on a buoy card, and placed on a constant temperature shaker at 37℃at 220rpm, shaking for 2 hours.
5. After shaking, the mixture was centrifuged at 4℃at 2500 rpm for 5min, the supernatant was discarded with a sample gun in a bacterial ultra-clean bench, 100. Mu.L remained, and the mixture was blown and mixed uniformly, and then spread on an ampicillin positive plate and placed in a 37℃incubator overnight.
6. The next day, the monoclonal colony was grown to indicate successful transformation, and the refrigerator was sealed with sealing film at 4 ℃. Selecting and shaking, constructing (3) the siRNA-HIF-1 alpha plasmid, then reserving strains, and placing in a refrigerator at the temperature of minus 80 ℃ for later use.
Example 2
25C 57BL/6 mice (female, 6-8 weeks, 20 g/mouse) were used as experimental mice (purchased from Hakka Bedskin Biotech Co., ltd., he) and 1X 10 6 HCC cells were subcutaneously injected into the right hind leg to establish a hepatocellular carcinoma mouse model. The local skin injection condition is observed 7-10 days after the molding is finished, if a skin mound with the diameter of 6-8mm is formed, the inoculation is successful, and if failure is not considered.
On day 7 after model establishment, mice were randomly divided into 5 groups of 5: PBS group, scramble group, siRNA-HIF-1α group, lenvatinib group, siRNA-HIF-1α+ Lenvatinib group.
The treatment was performed according to the following protocol: PBS groups were filled with 3mmol/L hydrochloric acid, 100. Mu.L each; group Scramble X10 6 CFU/mL Scramble (the sequence represented by Scramble is shown as SEQ ID NO:5, GCAAGATGATCGGCTGGTACT) of attenuated Salmonella solution was injected intratumorally, 100 μl each; 5X 10 6 CFU/mL siRNA-HIF-1 alpha-3 attenuated salmonella solution is injected into the siRNA-HIF-1 alpha group tumor, and each 100 mu L; group Lenvatinib mice were gavaged 200 μ gLenvatinib (purchased from sanitation (chinese) pharmaceutical company limited); 100 μL of 5× 6 CFU/mL siRNA-HIF-1α -3 attenuated Salmonella solution and lavage 200 μ g Lenvatinib were injected intratumorally into groups of siRNA-HIF-1α+ Lenvatinib mice. Lenvatinib is infused 1 time per day, and the treatment period is 1 week. The first treatment of siRNA-HIF-1 alpha bacterial liquid and Lenvatinib treatment are carried out on the same day, 7 days after the first treatment, the second attenuated salmonella treatment carrying siRNA-HIF-1 alpha is carried out, and the siRNA-HIF-1 alpha bacterial liquid is treated twice.
(One) Effect on tumor growth and survival
On the seventh day after the end of treatment, mice were sacrificed and intact mouse tumor tissues were obtained, weighed and compared in size. In addition, tumor volume, body weight and death of mice were monitored every two days during treatment, and survival was recorded by daily observation of mice.
The results are shown in FIG. 3, where siRNA-HIF-1. Alpha. And Lenvatinib alone inhibited tumor growth relative to the control, whereas the combined treatment showed the most pronounced inhibition (P < 0.05) as a result of the smaller tumor volume and lighter weight (A-C in FIG. 3). After inoculation of tumor cells, the change in body weight of mice was not significant with increasing tumor volume, and there was no significant difference in body weight among groups of mice (D in fig. 3), indicating less toxicity of the therapeutic drug. Furthermore, the siRNA-HIF-1α combination Lenvatinib showed longer survival in tumor-bearing mice compared to control and monotherapy groups, and mice in the combination therapy group survived after the end of life observation (E in FIG. 3), indicating that the combination therapy significantly inhibited tumor growth in mice than the monotherapy.
(II) Effect on apoptosis, proliferation and migration of tumor cells
On the seventh day after the end of treatment, mice were sacrificed and intact mouse tumor tissues were obtained.
1. One-step TUNEL apoptosis assay
(1) Paraffin sections were put into a 72 ℃ oven for baking for 25min, and then the sections were put into the solutions described in table 5 in order:
TABLE 5 types of reagents and time of action
(2) The liquid on the sections was removed by blotting with a blotting paper, 20. Mu.g/mL proteinase K (DNase free) was added dropwise with a sample gun, and the sections were placed in a wet box and incubated at 37℃for 20min.
(3) Then washed with 1 XPBS solution for 10min 3 times.
(4) TUNEL assay configuration (TdT enzyme: fluorescent labeling solution=1:9), blotted with water absorbing paper to remove the liquid on the sections, and the assay was added dropwise to the tissue of the sections and incubated at 37 ℃ for 60min. And then film-washing, wherein the film-washing steps are the same as the above.
(5) DAPI staining solution was added dropwise, stained at room temperature for 10min, and washed with PBS.
(6) Then sealing the film with an anti-fluorescence quenching agent, and taking pictures by a confocal microscope and storing the pictures.
TUNEL method detects apoptosis of cells in tumor tissue of each group (see fig. 4), and increases the green fluorescence of fluorescein FITC label, which indicates that apoptosis of cells in tumor tissue is increased, and the result shows that: almost no apoptotic tumor cells were seen in PBS, scramble, whereas the apoptosis index of tumor cells in tumor tissues of siRNA-HIF-1α, lenvatinib and siRNA-HIF-1α+ Lenvatinib groups was significantly increased (P < 0.05).
Then, a Westernblot method is adopted for detection: (1) Adding absolute ethyl alcohol into a mortar, igniting and sterilizing at high temperature, cooling to be not scalding hands, adding liquid nitrogen, taking 0.1g of tumor tissues of different treatment groups after the frosting, putting into the mortar, grinding into powder, then collecting into a 2mLEP tube, adding 600 mu L of protein lysate, putting onto a shaking table, vibrating and cracking for 30min, at 8000rpm,4 ℃ and centrifuging for 10min, and collecting supernatant into a 1.5mLEP centrifuge tube for later use; (2) the remaining steps are the same as Westernblot cell experiment.
Westernblot results show (FIG. 5), siRNA-HIF-1. Alpha. Group, lenvatinib group mice showed increased expression of apoptosis-related proteins CLEAVED CASPASE-3 and BAX after monotherapy, decreased expression of anti-apoptotic molecule Bcl-2, whereas the combination treatment group was most pronounced (P < 0.05).
2. Immunohistochemistry
(1) Slicing the prepared tissue wax block to obtain white slices.
(2) Dewaxing and rehydration: the slices are put into a 72 ℃ oven to be baked for 25min, after the wax is melted, the slices are put into dimethylbenzene and ethanol with different concentrations from high to low, and then washed with ultrapure water for 2 times and 3min each time.
(3) Thermal antigen repair: the sections were placed in 0.01mmol/L citrate buffer, heated in a water bath for 15min, cooled to room temperature, and the above-described operations were repeated again (2 times, 3 times with 1 XPBS and 8min each).
(4) Incubation with 3% hydrogen peroxide: the liquid on the sections was wiped dry with absorbent paper, taking care not to hit the tissue, 3% hydrogen peroxide was added dropwise to the sections, and incubated at room temperature for 10min.
(5) Washing: the 1 XPBS was washed 3 times, 8min each, and the rotational speed was noted to prevent tumor tissue from shedding.
(6) Closing: the pieces were wiped dry, goat serum blocking solution (5%) was added dropwise, and incubated at room temperature for 15min.
(7) Incubation resistance: the sections were tilted to drain the goat serum lock, primary antibody was added dropwise, and the tissue sections were placed in a black moisture box and incubated overnight at 4 ℃ in a refrigerator.
(8) PBS wash: the next day the slides were rewarmed at room temperature for 30min and the washing steps were the same as before.
(9) Secondary antibody incubation: the corresponding secondary antibody was added dropwise and incubated at room temperature for 30min.
(10) PBS wash: the steps are the same as before.
(11) Streptavidin blocking: dripping horseradish peroxidase-labeled streptavidin on each tumor tissue section, incubating for 10min at room temperature, and washing the same.
(12) DAB color development: the color development was stopped by dropping the color development liquid onto each tissue with a sample gun and putting it into tap water when yellow or brown particles appeared.
(13) Hematoxylin counterstaining was then performed.
(14) Dehydration and transparency are the same as before.
(15) A neutral resin is used for sealing.
Immunohistochemical determination criteria: (1) MVD, finding the dense and clear-dyed areas of the microvessels in each slice under the field of a low-power mirror, selecting the area with the most dense microvessels for observation under the field of a high-power mirror, counting the number of microvessels in the area, and calculating the MVD value to obtain the average value of microvessels in the area. Endothelial cells or clusters stained brown and clearly distinguished from the background of tissue are considered a vessel count. (2) Ki-67/PCNA/VEGF, the staining intensity of positive cells was scored from weak to strong, the number of nuclei without yellow pellet was 0 min, pale yellow was 1 min, brown was 2 min, dark brown was 3 min, and the total number of intact cells and the number of positive cells in the field of view were recorded under a microscope.
PCNA is an accessory protein of DNA polymerase delta, and is a good index for reflecting the proliferation state of cells. Ki-67 is a proliferation cell-associated antigen whose function is closely related to mitosis, and is mainly used to label cells in the proliferation cycle. The results of immunohistochemical detection of the expression of cell proliferation molecules Ki-67 and PCNA in tumor tissues show (as shown in FIG. 6), that the Ki-67 and PCNA positive staining is mainly in the nucleus and takes the shape of brown yellow or brown particles or is distributed in a dispersing way, compared with a control group, the siRNA-HIF-1α single treatment group and the Lenvatinib single treatment group reduce the expression of Ki-67 and PCNA in tumor tissues, and the combined treatment group has the most obvious effect (P < 0.05), so that the combined treatment can obviously inhibit the proliferation of cells in tumor tissues.
Then, the result of the detection by the Westernblot method is also adopted, and the result shows that (as shown in figure 5), the expression level of migration related molecules MMP2 and proliferation related molecules cyclnD 1 is reduced (P < 0.05).
The above results indicate that the effects of combination therapy may be related to the promotion of tumor cell apoptosis, inhibition of tumor cell proliferation and migration in vivo by siRNA-HIF-1. Alpha. Plasmid and Lenvatinib.
(III) Effect on angiogenesis in tumor tissues and expression of angiogenesis-related molecules
Hepatocellular carcinoma is a blood-rich tumor, the formation of blood vessels is closely related to the development of the tumor, the expression level of CD31 and CD34 molecules in tumor tissues can reflect the condition of tumor angiogenesis, and VEGF is a common target gene of Lenvatinib and HIF-1 alpha. Thus, to verify the anti-tumor mechanism of the combination Lenvatinib therapy of attenuated salmonella carrying siRNA-HIF-1α, we examined the expression of neovascular specific markers CD31 and CD34 and VEGF in tumor tissue.
Detection was also performed by western blot and immunohistochemical experiments.
The results show (as in fig. 7-8): both siRNA-HIF-1α, lenvatinib were able to inhibit VEGF expression after treatment alone compared to the control group, whereas inhibition was most pronounced in the combination treatment group (P < 0.05). Microvessel density MVD value is a quantitative measure of tumor angiogenesis capacity, which has been detected as a marker of tumor prognosis, and we therefore performed quantitative analysis of CD31 and CD34 immunohistochemistry using this method. The MVD values were decreased in the siRNA-HIF-1α, lenvatinib alone treatment group compared to the control group, while the MVD values were further decreased in the combination treatment group (P < 0.05). The Western blot experiment and the immunohistochemical experiment result are consistent, which shows that in the tumor-bearing mice, the angiogenesis of the attenuated salmonella carrying siRNA-HIF-1 alpha is obviously reduced after the treatment of the siRNA-HIF-1 alpha combination Lenvatinib.
(IV) Effect on immune cells in tumor tissue and spleen
The HIF-1 alpha/VEGF signal channel can promote the generation of tumor blood vessels and inhibit the functions of T lymphocytes, so that the infiltration of CD4 + T cells, CD8 + T cells and macrophages in mouse tumor tissues is detected by immunofluorescence technology. Spleen is the largest peripheral immune organ, and plays an anti-tumor role by regulating immune cells, so that the proportion of T lymphocytes and NK cells in the spleen of a mouse is detected by flow cytometry, and the anti-tumor activity of the combination Lenvatinib of attenuated salmonella carrying siRNA-HIF-1 alpha on the mouse is discussed.
1. Immunofluorescence
(1) Paraffin sections were prepared and the first day of procedure was immunohistochemical.
(2) The next day rewarming and washing steps are the same as before.
(3) Dripping fluorescent secondary antibody, incubating for 30min at room temperature in dark place, and washing the solution in the same way.
(4) DAPI staining solution is added dropwise, incubated for 10min at room temperature, and the washing steps are the same as before.
(5) The sheet is sealed by an anti-fluorescence quenching agent. To prevent the effect of fluorescence quenching, the results were photographed in a dark room with a fluorescence microscope as soon as possible.
The results show (as in fig. 9): compared with the control group, the infiltration of CD4+T lymphocytes and CD8+T lymphocytes in tumor tissues of Lenvatinib single treatment group and siRNA-HIF-1 alpha single treatment group is increased, the infiltration effect of the combined treatment group is more obvious, the proportion of infiltrated activated lymphocytes is also increased, and the proportion of M1 type macrophages with anti-tumor effect is obviously increased (P < 0.05).
2. Flow cytometry
(1) Preparation of a mouse spleen cell suspension. a. 3 mice were sacrificed randomly, spleens were removed, and spleen cell suspensions were prepared; b. grinding spleen with a ground glass plate, collecting cells in a dish with RPMI 1640 medium, filtering cell suspension into a 15mL centrifuge tube through a 70 μm filter screen, and centrifuging at 2000rpm for 5min; c. pouring out the supernatant, adding 2mL of erythrocyte lysate, fully suspending the cell pellet, lysing the erythrocyte on ice for 2min, adding RPMI 1640 culture medium for neutralization, and centrifuging at 2000rpm for 5min; d. discarding the supernatant, observing whether the erythrocyte is completely lysed, if so, carrying out the next step, and if not, repeating the previous step; e. cell pellet was suspended in 1mL of medium, counted, and split into 1.5mL EP tubes, 2X 10 6 cells/100. Mu.L/tube, one EP tube for each mouse, and control group was selected as negative tube and single standard tube.
(2) Flow cytometry detects the level of immune cells in the spleen. a. Adding corresponding antibodies (CD 3, CD4, CD8 and NK 1.1) into each EP tube, incubating at 4 ℃ for 30min in dark place, directly adding 500 mu LPBS after the time is up, and centrifuging at 2500rpm/min for 5min; b. removing supernatant, adding 1mLPBS to wash cells, centrifuging at 2500rpm/min for 5min; c. the supernatant was discarded, and the cells were resuspended with 300. Mu. LPBS and examined on a flow-through machine.
(3) Flow cytometry detects levels of Treg cells and GranzymeB in spleen. a. 100. Mu.L of spleen cell suspension was added to each EP tube, the number of cells was 3X 10 6, and the top-stained antibodies (CD 3, CD8, CD4, CD 25) were added according to the flow antibody instructions (from Biolegend), incubated at 4℃for 30min in the absence of light, and at the end of incubation 500. Mu. LPBS was added directly to each EP tube, centrifuged at 2500rpm/min for 5min; b. removing supernatant, adding 1mLPBS to wash cells, centrifuging at 2500rpm/min for 5min; c. preparing a fixing solution, adding 300 mu L of the fixing solution into each EP tube, gently mixing cells, and fixing the cells for 30min at 4 ℃ in a refrigerator; d. after the time is up, 1mL of membrane rupture liquid is directly added into each tube, and the membrane rupture liquid is centrifuged at 5000rpm/min for 6min; e. the supernatant was discarded, 100. Mu.L of antibody diluted with membrane rupture fluid (Foxp 3, granzymeB) was added to each tube and incubated at 4℃for 30min in the absence of light; f. after the time is up, 500 mu LPBS of the solution is directly added into each tube, and the solution is centrifuged at 5000rpm/min for 6min; g. the supernatant was discarded and the cells were resuspended with 300. Mu. LPBS and examined by flow cytometry.
The results show (as in fig. 10): compared with the control group, the infiltration of CD4+ T, CD8+T lymphocytes and NK cells in the spleens of mice in the Lenvatinib independent treatment group and the siRNA-HIF-1 alpha independent treatment group is increased, the proportion of immune suppression cell Tregs is reduced, the proportion of activated CD8+T lymphocytes is improved, and the effect of the combined treatment group is the most obvious (P < 0.05).
(V) attenuated salmonella carrying siRNA-HIF-1 alpha combined Lenvatinib has certain safety
And (3) detecting pathological changes of organs of the tumor-bearing mice by adopting an HE (high-speed) staining technology.
HE staining technique:
(1) Paraffin sections were baked in a 72 ℃ oven for 25min, and after paraffin was melted, the slides were placed in the solution of table 6 in sequence.
TABLE 6 types of reagents and time of action
(2) Hematoxylin is dyed for 4min (the dyeing time can be adjusted according to different conditions), flowing water returns to blue, and 1% hydrochloric acid alcohol differentiated solution is used for 1s, and tap water is used for developing.
(3) Eosin staining for 1min (staining time can be adjusted according to different conditions), running water film.
(4) The slides were then dehydrated and transparent in the order of Table 7.
TABLE 7 types of reagents and time of action
(5) And finally sealing the sheet with neutral resin, and cleaning the sheet after airing.
As can be seen from the HE staining results (as shown in FIG. 11), compared with the control group, the siRNA-HIF-1 alpha or Lenvatinib alone or in combination treatment of the two groups of mice did not cause obvious pathological changes of the viscera, and the damage of the viscera is not obvious, which indicates that the siRNA-HIF-1 alpha combined Lenvatinib treatment has certain safety.
From the above examples, the attenuated salmonella carrying siRNA-HIF-1 alpha of the present invention can be better used for resisting hepatocellular carcinoma, and the attenuated salmonella carrying sequence can effectively enhance Lenvatinib anti-hepatocellular carcinoma effect. The attenuated salmonella carrying siRNA-HIF-1 alpha combined Lenvatinib can effectively inhibit the tumor growth of tumor-bearing mice, prolong the survival time of the mice, reduce the cell proliferation and the blood vessel formation in tumor tissues and promote the apoptosis of tumor cells; can also improve the infiltration rate of T lymphocyte and M1 type macrophage in tumor tissue of tumor-bearing mice and the immune cell in spleen, and improve the anti-tumor immune response of organisms.
The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims (7)

1. The siRNA-HIF-1 alpha is characterized in that the sequence of the siRNA-HIF-1 alpha-3 is shown as SEQ ID NO. 3.
2. An expression plasmid comprising the siRNA-HIF-1 alpha of claim 1.
3. An expression plasmid according to claim 2, characterized in that the original plasmid used is the pSilencer plasmid.
4. The expression plasmid of claim 3, wherein the siRNA-HIF-1. Alpha. Is inserted between BamHI and HindIII cleavage sites in the original plasmid.
5. A strain expressing the siRNA-HIF-1 a of claim 1, wherein the expression plasmid of any one of claims 2 to 4 is transformed with attenuated salmonella as a host.
6. Use of the expression plasmid of claim 2, the strain of claim 5 for preparing anti-hepatocellular carcinoma drugs.
7. The use according to claim 6, wherein the expression plasmid is used in combination Lenvatinib.
CN202310817378.XA 2023-07-05 2023-07-05 Application of expression plasmid containing interference sequence siRNA-HIF-1 alpha in preparation of anti-hepatocellular carcinoma drug Active CN116855496B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310817378.XA CN116855496B (en) 2023-07-05 2023-07-05 Application of expression plasmid containing interference sequence siRNA-HIF-1 alpha in preparation of anti-hepatocellular carcinoma drug

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310817378.XA CN116855496B (en) 2023-07-05 2023-07-05 Application of expression plasmid containing interference sequence siRNA-HIF-1 alpha in preparation of anti-hepatocellular carcinoma drug

Publications (2)

Publication Number Publication Date
CN116855496A CN116855496A (en) 2023-10-10
CN116855496B true CN116855496B (en) 2024-08-16

Family

ID=88224588

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310817378.XA Active CN116855496B (en) 2023-07-05 2023-07-05 Application of expression plasmid containing interference sequence siRNA-HIF-1 alpha in preparation of anti-hepatocellular carcinoma drug

Country Status (1)

Country Link
CN (1) CN116855496B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110081715A (en) * 2010-01-08 2011-07-14 (주)바이오프리 Small interfering rna for inhibiting specific expression of hypoxia-inducible factor-1 alpha in osteoclast
CN104560996A (en) * 2014-12-25 2015-04-29 扬州大学 Vector of shRNA for restraining mouse GH gene expression and application of vector

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN100366747C (en) * 2005-03-08 2008-02-06 上海第二医科大学附属仁济医院 Interference RNA miniplasmid of hypoxia induction factor
CN1974759B (en) * 2006-07-26 2010-06-09 吉林大学 Attenuated salmonella transporting recombinant plasmid and its application in treating tumor
CN101011582B (en) * 2006-11-22 2010-05-12 中国人民解放军军事医学科学院军事兽医研究所 Medicament for emergency treatment after hydrophobia exposition and emergency therapy at early stage of pathogenesis, and its preparing process
CA2664271A1 (en) * 2006-11-27 2008-06-12 Enzon Pharmaceuticals, Inc. Polymeric short interfering rna conjugates
CN101575602B (en) * 2008-05-06 2011-06-22 天津市第一中心医院 siRNA sequence for inhibiting human BFGF gene expression amplification and expression carrier and application thereof
CN104293830A (en) * 2014-05-29 2015-01-21 上海市普陀区中心医院 Preparation method and use of recombinant plasmid containing amiRNA-HIF-1alpha sequence
CN106474489B (en) * 2015-08-31 2019-08-16 广州华津医药科技有限公司 Application of the attenuated salmonella typhimurium genetic engineering bacterium on preparation treatment liver-cancer medicine
IL259052B2 (en) * 2015-11-19 2024-03-01 Univ Basel Virulence attenuated bacteria for treatment of malignant solid tumors
CN116042622A (en) * 2022-01-13 2023-05-02 上海节惠生物科技有限公司 Interference sequence for preventing or treating tumor and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110081715A (en) * 2010-01-08 2011-07-14 (주)바이오프리 Small interfering rna for inhibiting specific expression of hypoxia-inducible factor-1 alpha in osteoclast
CN104560996A (en) * 2014-12-25 2015-04-29 扬州大学 Vector of shRNA for restraining mouse GH gene expression and application of vector

Also Published As

Publication number Publication date
CN116855496A (en) 2023-10-10

Similar Documents

Publication Publication Date Title
Dorfman et al. Intrathyroidal epithelial thymoma (ITET)/carcinoma showing thymus‐like differentiation (CASTLE) exhibits CD5 immunoreactivity: new evidence for thymic differentiation
He et al. T‐cell activation and immune memory enhancement induced by irreversible electroporation in pancreatic cancer
Lin et al. Translocation of Helicobacter pylori CagA into Human B lymphocytes, the origin of mucosa-associated lymphoid tissue lymphoma
Strunnikova et al. Regulated heat shock protein 27 expression in human retinal pigment epithelium
Eastham et al. Suppression of primary tumor growth and the progression to metastasis with p53 adenovirus in human prostate cancer
Shibata et al. Suppression of mammary carcinoma growth in vitro and in vivo by inducible expression of the Cdk inhibitor p21
Liu et al. Association of tumour-associated macrophages with cancer cell EMT, invasion, and metastasis of Kazakh oesophageal squamous cell cancer
CN113908283A (en) PRMT5 inhibitor and application thereof in combination with PD-L1 antibody blocking agent in treatment of lung cancer
CN111718995B (en) Biomarker for nasopharyngeal carcinoma metastasis diagnosis and/or prognosis evaluation
Shi et al. TRAF6 regulates proliferation of stromal cells in the transition and peripheral zones of benign prostatic hyperplasia via Akt/mTOR signaling
Aonuma et al. Vascular endothelial growth factor overproduced by tumour cells acts predominantly as a potent angiogenic factor contributing to malignant progression
CN103396992A (en) Culture and application of oligoclonal tumor-infiltrating lymphocytes for liver cancer
Sun et al. Targeting TGF-β1 suppresses survival of and invasion by anaplastic thyroid carcinoma cells
Bellan et al. Missing expression of pRb2/p130 in human retinoblastomas is associated with reduced apoptosis and lesser differentiation
CN116855496B (en) Application of expression plasmid containing interference sequence siRNA-HIF-1 alpha in preparation of anti-hepatocellular carcinoma drug
CN117305162A (en) CMU-Pb-L5 and application thereof in preparation of colorectal cancer treatment drugs
CN114225036B (en) Application of ATXN1 protein as target in preparation of medicine or kit for treating, preventing or diagnosing medulloblastoma
CN114814231B (en) Application of retinoic acid-induced gene I in cancer treatment
CN109364249A (en) Application using MANF as the substance of target spot in preparation treatment intrahepatic cholangiocarcinoma product
CN112980948B (en) Application of NFAT3 as therapeutic target in screening or preparing head and neck squamous cell carcinoma drugs
CN108203734A (en) Application of the RHCG genes in treating cancer drug and diagnostic kit is prepared
CN108490180B (en) Application of EphA8 gene in preparation of gastric cancer drugs and diagnostic kit thereof
CN115094134B (en) Application of PCSK9 in macrophage M2 type polarization and related diseases thereof
CN115721645B (en) Application of dehydrogenized hirsutine in preparation of anticancer drugs
CN114276994B (en) Human ovarian squamous carcinoma cell line and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant