CN104293830A - Preparation method and use of recombinant plasmid containing amiRNA-HIF-1alpha sequence - Google Patents
Preparation method and use of recombinant plasmid containing amiRNA-HIF-1alpha sequence Download PDFInfo
- Publication number
- CN104293830A CN104293830A CN201410233294.2A CN201410233294A CN104293830A CN 104293830 A CN104293830 A CN 104293830A CN 201410233294 A CN201410233294 A CN 201410233294A CN 104293830 A CN104293830 A CN 104293830A
- Authority
- CN
- China
- Prior art keywords
- hif
- sequence
- amirna
- plasmid
- recombinant plasmid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a preparation method and a use of a recombinant plasmid containing amiRNA-HIF-1alpha sequence. The preparation method of the recombinant plasmid comprises the following steps: synthesizing the amiRNA-HIF-1alpha sequence, connecting a target fragment with a vector plasmid, converting the competent cells of Escherichia coli by the obtained connection product, and carrying out electrophoresis identification and sequencing on the obtained recombinant plasmid. The recombinant plasmid includes the amiRNA-HIF-1alpha encoding sequence and a vector plasmid DNA sequence, and the vector plasmid DNA sequence includes a regulatory sequence connected with the amiRNA-HIF-1alpha. The invention also discloses a use of the recombinant plasmid in the preparation of antitumor drugs. The recombinant plasmid can be used for the study on the action mechanism of the amiRNA-HIF-1alpha in tumor angiogenesis, proliferation, apoptosis, invasion and metastasis, the exploitation and production of the antitumor drugs in order to provide a new way for the prevention and treatment of malignant tumors.
Description
Technical field
The present invention relates to a kind of Preparation method and use of recombinant plasmid, particularly, relate to a kind of Preparation method and use of the recombinant plasmid containing amiRNA-HIF-1 α.
Background technology
Neonate tumour blood vessel (Tumor Angiogenesis) or vasculogenesis (Vasc μ larization) are the very crucial factors of implanted solid tumor growth, the growth of malignant tumour, invasion and m etastasis depend on tumor vascular generation, if do not have vasculogenesis, Primary tumor growth can not more than 1 ~ 2mm
3, its continued growth must rely on the formation of neovascularity, to provide enough nutrition and oxygen, takes away meta-bolites, and synkaingenesis vascular wall is imperfect, in high penetration state, is conducive to the transfer of tumour cell.Neonate tumour blood vessel is a very complicated process, comprise the interaction of tumour cell, endotheliocyte, phagocytic cell and their excreted factor, these excreted factor may be promotive factor (as VEGF, Ang-2, bFGF, IL-8 etc.) or the supressor (TSP-1 Angioststin etc.) of Tumor angiogenesis.Tumor-blood-vessel growth is by promotive factor and the organic regulation and control of supressor, if angiogenic factors raises or Angiogenesis dysfunction, the two balance is broken and makes vascular endothelial cell accelerate differentiation, producing capillary blood vessel holds around tumor tissues, promote neonate tumour blood vessel, accelerate invasion and metastasis of tumor.Therefore, the running balance of Effective Regulation vasculogenesis promotive factor and supressor is key and the action target spot of Antineoplastic angiogenesis treatment.Solid tumor by cellular defense mechanism at anoxia condition (Hypoxia Condition; also known as hypoxia condition; refer to that restrictive cell obtains the tumour high-cell density of oxygen) under existence, these protection mechanisms comprise the activation of the transcription factor HIF-1 α that VEGF, Bcl-2, MDR, MMPs etc. can be induced to express and are conducive to the glucose recompile mechanism of cell proliferation, angiogenesis and multidrug resistance.Wherein micro-environmental hypoxia activates tumour cell HIF-1 α, and the expression of the angiogenic factors such as induction VEGF, bFGF, Ang-2 is that it promotes the important step of implanted solid tumor growth and neonate tumour blood vessel.Pugh etc. study confirmation, and hypoxic tumor cell is the critical stimulus factor of angiogenesis factor release and angiogenic process.Oxygen deficient induction factor 1 (Hypoxia-inducible factor-1, HIF-1) is the basic regulatory factor of VEGF under anoxia condition, and HIF-1 is positioned 14q21-q24, is the heterodimer containing α and β subunit.Under normal oxygen concentratio condition, in cell, HIF-1 α is unstable, and the transformation period, the very fast ubiquitin-proteasome pathway mediated by ODD was degraded less than 5 min.And under hypoxemia or anaerobic conditions, HIF-1 α stability increases, transfer to nucleus, be combined into dimer HIF-1 with HIF-1 β subunit, HIF-1 is combined with goal gene HRG thus activates its transcription.In tumour cell, HIF-1 expresses with the intracellular signaling of oxygen dependence closely related, and the HIF-1 α that regulation mechanism comprises oxygen dependence degrades, the upper mediation of the phosphorylation of albumen, transcriptional level is protein stabilized and ligand binding capacity and inner cellular localization.Under anoxia condition, permitted polygenic transcript and expression in tumour cell and changed, stress reaction is made to anoxic, is called as hypoxia response gene (HRG).The gene regulated and controled by HIF-1 α in HRG is called the target gene of HIF-1 α, one or more hypoxia response elements (HRE) is contained in the promotor of these target genes or enhanser, the HIF-1 of activation combines with it, form HIF-1, p300/CBP cyclic amp response element binding protein (CREB), and the initiation complex of other transcription factors, thus start transcribing of target gene.HIF-1 target gene number reaches more than 60 and plants, relate to tumor cell proliferation, energy transformation, vasculogenesis, Invasion and Metastasis etc., by many interactional h and E signal transduction pathways, coding comprises the angiogenic factors such as VEGF, bFGF, IGF-1, iNOS, IL-8, COX-2, MMPs.The angiogenesis factor that VEGF, bFGF, IGF-1 etc. of tumor cell secretion are important can stimulate tumor-microvessel to occur, increase vascular permeability, and the angiogenic inflammatory molecule such as IL-8, COX-2 and iNOS of secretion can affect the generation of tumor vascular system, development and transfer.HIF-1 can directly activate a series of angiogenic factors, comprises VEGF, vegf receptor FLT-1 and FLK-1, its Tyrosylprotein kinase TIE-2 acceptor, matrix metalloproteinase MMP-2 and MMP-9.Induce in angiogenic factors at HIF-1, VEGF due to its strong vasculogenesis characteristic and in human tumor great expression and particularly remarkable.HIF signalling system is responsible for regulating VEGF and tumor-blood-vessel growth, but HIF family member independent action in this process also deposits dispute.
More and more study proof in recent years, micro-environmental hypoxia is the common induction factor of neonate tumour blood vessel always, and anoxic, in digestive system carcinoma, particularly plays vital effect in colorectal cancer evolution.The target gene that the HIF-1 that stress produce under anoxia condition regulates and neonate tumour blood vessel closely related, HIF-1 process LAN promote colorectal cancer generation in play the part of important role.Therefore, the expression blocking HIF-1 significantly can reduce the generation of tumor-microvessel, and alleviate the promoter action of micro-environmental hypoxia to tumour, HIF-1 becomes antineoplastic vital role target spot.MicroRNA(miRNA) be the non-coding small molecules single stranded RNA of a kind of size about 22 nt, can by the shearing of target gene mRNA or the expression of translational control target gene suppressing target gene mRNA.The miRNA mode of action is overlapping with the RNAi approach of siRNA mediation to a great extent, but compared with siRNA, miRNA only needs namely can play a role with the combination of target gene part, thus can block the functionally active of target gene to the full extent.MicroRNA(artificial microRNA, the amiRNA of exogenous synthetic) technology refer to utilize endogenous miRNA precursor molecule to produce target gene that tiny RNA goes to mediate in animal or plant is reticent.Recently, several RNAi carrier expressing pol II promoters driven of framework based on miRNAs is fabricated, and this RNAi carrier can express removing or the Transcription inhibition that exogenous miRNA passes through RNA interference channel guide RNA.The experiment in vivo and vitro utilizing microRNA expression framework to produce exogenous miRNA selective degradation target gene has illustrated fabulous application prospect.
Summary of the invention
The object of this invention is to provide a kind of Preparation method and use of recombinant plasmid containing amiRNA-HIF-1 α sequence for studying amiRNA-HIF-1 α sequence mechanism of action in the biological behaviour of the malignant tumours such as neonate tumour blood vessel, Proliferation and apoptosis, Invasion and Metastasis, on its basis can development and production can the medicine of prevention and therapy malignant tumour further.
In order to achieve the above object, the invention provides a kind of preparation method of the recombinant plasmid containing amiRNA-HIF-1 α, wherein, described method comprises: step 1, synthesize siRNA sequence according to HIF-1 α CDS sequences Design, and carry out 5 ' end 2-methoxyl group modification, then verify its validity by cell transfection assays; Step 2, designs and synthesizes the DNA sequence dna amiRNA-HIF-1 α comprising HIF-1 α siRNA sequence; Step 3, is connected with vector plasmid ligase enzyme gained amiRNA-HIF-1 α sequence, and the connection product obtained is the described recombinant plasmid containing amiRNA-HIF-1 α sequence; Described ligase enzyme is T
4dNA ligase; Step 4, connects product conversion competent escherichia coli cell with step 3 gained and cultivates; Step 5, cultivates any picking one bacterium colony of gained from step 4 and carries out plasmid extraction, then pass through electroresis appraisal; Step 6, by the antitumor action of cell experiment checking gained recombinant plasmid.
The preparation method of the above-mentioned recombinant plasmid containing amiRNA-HIF-1 α sequence, wherein, this recombinant plasmid comprises encoding sequence and the vector plasmid DNA sequence of amiRNA-HIF-1 α, comprises the adjustment sequence be connected with amiRNA-HIF-1 α in described vector plasmid DNA sequence; Described vector plasmid is the eukaryon expression plasmid that can copy in host and survive.
The preparation method of the above-mentioned recombinant plasmid containing amiRNA-HIF-1 α sequence, wherein, design and synthesize siRNA sequence described in step 1, object siRNA sequence of its design is: 5 '-UGUGAGUUCGCAUCUUGAU-3 '; Its contrast siRNA sequence is: 5 '-UACACCGUUAGCAGACACC-3 '.
The preparation method of the above-mentioned recombinant plasmid containing amiRNA-HIF-1 α sequence, wherein, cell transfection assays described in step 1 comprises: cultivator colorectal cancer HCT-116 cell, and be divided at random blank group, contrast siRNA sequence group, object siRNA sequence group, add empty plasmid respectively, comprise the plasmid of described contrast siRNA sequence and the plasmid that comprises described object siRNA sequence carries out transfection, at 37 DEG C of 5% CO
2observe respectively after cultivating 48h in incubator.
The preparation method of the above-mentioned recombinant plasmid containing amiRNA-HIF-1 α sequence, wherein, designing and synthesizing described in step 2 comprises the DNA sequence dna of HIF-1 α siRNA sequence, and its Sense sequences is: 5 '-TGCTGTGTGAGTTCGCATCTTGATGTTTTGGCCACTGACTGACATCAAGATGCGAA CTCACA-3 '; Its antisense sequences is: 5 '-CCTGTGTGAGTTCGCATCTTGATGTCAGTCAGTGGCCAAAACATCAAGATGCGAAC TCACAC-3 '.
The preparation method of the above-mentioned recombinant plasmid containing amiRNA-HIF-1 α sequence, wherein, described step 2 also comprises the DNA sequence dna making described Sense sequences and antisense sequences annealing form double-strand; Described annealing conditions is 95 DEG C, 30sec → 37 DEG C, 1min → 16 DEG C, 5min → 4 DEG C, 10min.
The preparation method of the above-mentioned recombinant plasmid containing amiRNA-HIF-1 α sequence, wherein, described step 3 also comprises: do from connecting contrast while being connected with ligase enzyme with vector plasmid gained amiRNA-HIF-1 α sequence, replaces amiRNA-HIF-1 α sequence to be connected with vector plasmid with water; The product of gained is as negative control group, and the product be connected with object fragment and carrier carries out the transformation of E. coli competent cell of step 4 simultaneously.
The preparation method of the above-mentioned recombinant plasmid containing amiRNA-HIF-1 α sequence, wherein, the plasmid extraction described in step 5, is undertaken by high pure plasmid Mini Kit; Described electroresis appraisal carries out electrophoretic separation with 1% sepharose containing ethidium bromide.
The preparation method of the above-mentioned recombinant plasmid containing amiRNA-HIF-1 α sequence, wherein, cell experiment described in step 6 comprises: cultivator colorectal cancer HCT-116 cell, and be divided at random blank group, vector plasmid group, recombinant plasmid group, add empty plasmid, vector plasmid and the described recombinant plasmid containing amiRNA-HIF-1 α respectively and carry out transfection, at 37 DEG C of 5% CO
2observe respectively after cultivating 48h in incubator.
Present invention also offers a kind of purposes of recombinant plasmid for the preparation of antitumor drug containing amiRNA-HIF-1 α sequence prepared by aforesaid method.
The above-mentioned recombinant plasmid containing amiRNA-HIF-1 α sequence is for the preparation of the purposes of antitumor drug, and wherein, described antitumor drug, its dosage form comprises injection liquid, freeze-dried etc.
The above-mentioned purposes of recombinant plasmid for the preparation of antitumor drug containing amiRNA-HIF-1 α sequence, wherein, the described antitumor drug based on HIPK2 gene, its route of administration comprises intravenous injection, intramuscular injection, subcutaneous injection, insertion administration and direct intratumor injection etc.
The Preparation method and use of the recombinant plasmid containing amiRNA-HIF-1 α provided by the invention has the following advantages:
Recombinant plasmid containing amiRNA-HIF-1 α sequence prepared by method provided by the invention, can be used for the research of other biologic activity of amiRNA-HIF-1 α sequence pair tumour impact, then in the manufacture of antitumor drug, on the basis of amiRNA-HIF-1 α gene mechanism of action in the biological behaviour of the malignant tumours such as neonate tumour blood vessel, Proliferation and apoptosis, Invasion and Metastasis, further development and production can the medicine of prevention and therapy malignant tumour.
Accompanying drawing explanation
Fig. 1 is the sequence chart of HIF-1 α siRNA.
Fig. 2 is HIF-1 α siRNA anti-tumor function proof diagram.
Fig. 3 is the result schematic diagram of HIF-1 α siRNA anti-tumor function checking.
Fig. 4 is p-amiRNA-HIF-1 α construction of recombinant plasmid synoptic diagram.
Fig. 5 is p-amiRNA-HIF-1 α recombinant plasmid electrophoresis result.
Fig. 6 is the impact of p-amiRNA-HIF-1 α Transfected Recombinant Plasmid Human colorectal cancer cells on cell proliferation.
Fig. 7 is the result schematic diagram of the impact of p-amiRNA-HIF-1 α Transfected Recombinant Plasmid Human colorectal cancer cells on cell proliferation.
embodiment
Below in conjunction with accompanying drawing, the specific embodiment of the present invention is further described.
The preparation method of the recombinant plasmid containing amiRNA-HIF-1 α sequence provided by the invention, the method comprises:
Step 1, synthesizes siRNA sequence according to HIF-1 α CDS sequences Design, and carries out 5 ' end 2-methoxyl group (2-MO) and modify, then verifies its validity by cell transfection assays; The object siRNA sequence of its design is: 5 '-UGUGAGUUCGCAUCUUGAU-3 '; Its contrast siRNA sequence is: 5 '-UACACCGUUAGCAGACACC-3 '.
This cell transfection assays comprises: cultivator colorectal cancer HCT-116 cell, and be divided at random blank group, contrast siRNA sequence group, object siRNA sequence group, the plasmid add empty plasmid respectively, comprising contrast siRNA sequence and the plasmid comprising object siRNA sequence carry out transfection, at 37 DEG C of 5% CO
2observe respectively after cultivating 48h in incubator.
Step 2, designs and synthesizes the DNA sequence dna amiRNA-HIF-1 α comprising HIF-1 α siRNA sequence; Its Sense sequences is: 5 '-TGCTGTGTGAGTTCGCATCTTGATGTTTTGGCCACTGACTGACATCAAGATGCGAA CTCACA-3 '; Its antisense sequences is: 5 '-CCTGTGTGAGTTCGCATCTTGATGTCAGTCAGTGGCCAAAACATCAAGATGCGAAC TCACAC-3 '.
Step 2 also comprises the DNA sequence dna making Sense sequences and antisense sequences annealing form double-strand; Annealing conditions is 95 DEG C, 30sec → 37 DEG C, 1min → 16 DEG C, 5min → 4 DEG C, 10min.
Step 3, to gained amiRNA-HIF-1 α sequence and vector plasmid T
4dNA ligase connects, and the connection product obtained is the recombinant plasmid containing amiRNA-HIF-1 α.Step 3 also comprises: do from connecting contrast while being connected with ligase enzyme with vector plasmid gained amiRNA-HIF-1 α sequence, replaces amiRNA-HIF-1 α sequence to be connected with vector plasmid with water.This ligase enzyme is T
4dNA ligase.
Step 4, with step 3 gained containing amiRNA-HIF-1 α recombinant plasmid transformed competent escherichia coli cell and cultivate; And certainly connecting the product of gained as negative control group, the product be connected with object fragment and carrier carries out the transformation of E. coli competent cell of step 4 simultaneously, and observes.
Step 5, cultivates any picking one bacterium colony of gained from step 4 and carries out plasmid extraction, then pass through electroresis appraisal; Plasmid extraction, is undertaken by high pure plasmid Mini Kit; Electroresis appraisal carries out electrophoretic separation with 1% sepharose containing ethidium bromide.
Step 6, by the antitumor action of cell experiment checking gained recombinant plasmid.
This cell experiment comprises: cultivator colorectal cancer HCT-116 cell, and be divided at random blank group, vector plasmid group, recombinant plasmid group, add empty plasmid, vector plasmid and the recombinant plasmid containing amiRNA-HIF-1 α respectively and carry out transfection, at 37 DEG C of 5% CO
2observe respectively after cultivating 48h in incubator.
This recombinant plasmid comprises encoding sequence and the vector plasmid DNA sequence of amiRNA-HIF-1 α, comprise the adjustment sequence be connected with amiRNA-HIF-1 α in vector plasmid DNA sequence, this vector plasmid is the eukaryon expression plasmid that can copy in host and survive.
Present invention also offers the purposes of recombinant plasmid for the preparation of antitumor drug containing amiRNA-HIF-1 α sequence prepared by aforesaid method.This antitumor drug, its dosage form comprises injection liquid, freeze-dried etc., and its route of administration comprises intravenous injection, intramuscular injection, subcutaneous injection, insertion administration and direct intratumor injection etc.
Embodiment 1:pcDNA
tMthe structure of 6.2-GW/EmGFP-amiRNA-HIF-1 α (being abbreviated as p-amiRNA-HIF-1 α) recombinant plasmid.
The design of 1.HIF-1 α siRNA, synthesis and functional verification process as shown in Figure 1, comprise the following steps.
1.1 with HIF-1 α CDS for template, design its siRNA sequence, the principle of the expression matching and can not intervene other genes with template complete complementary need be followed, and design its control sequence, be synthesized by takala company.And carry out 5 ' end 2-MO modification.
Object siRNA sequence: 5 '-UGUGAGUUCGCAUCUUGAU-3 '
Contrast siRNA sequence: 5 '-UACACCGUUAGCAGACACC-3 '
1.2 will be incubated at containing 10% new-born calf serum, 100U/ml penicillin, 100 μ g/ml Streptomycin sulphate McCoy ' s 5A perfect medium (37 DEG C of 5% CO
2, saturated humidity) people tie straight cancer HTC-116 cell strain, by 1 × 10
6the amount of individual cells/well inoculates the cell of exponential phase of growth in 24 orifice plates, at 37 DEG C of 5% CO
2incubated overnight in incubator, until cell density reaches 60%-80%.
The Human colorectal carcinoma HCT-116 cell of above-mentioned cellar culture is divided at random blank group, contrasts siRNA sequence group, object siRNA sequence group, add different plasmids by following dosage respectively and carry out transient transfection.
(1) blank group: normal HCT-116 cell, n=3.
(2) siRNA sequence group is contrasted: control siRNA, n=3.
(3) object siRNA sequence group: HIF-1 α siRNA, n=3.
Plasmid to be transfected (1.0 μ g/ hole), transfection liposome Hily-Max(4.5 μ L/ hole is prepared in the centrifuge tube of 1.5ml, purchased from Japanese colleague's chemistry institute) mixture, plasmid to be transfected is diluted in McCoy ' the s 5A substratum not containing serum and antibiotic, mix, then by transfection Liposomal suspensions, incubation at room temperature 5 min.Finally both mixed, fully mixing leaves standstill 20min, and plasmid is fully combined with liposome.Then directly join in cell cultures, at 37 DEG C of 5% CO
248h is cultivated in incubator.
The results are shown in Figure 2 and Fig. 3, object siRNA sequence group cell quantity compares obvious minimizing with contrast siRNA sequence group with blank group, and illustration purpose siRNA sequence can suppress colon-cancer cell in propagation, is the siRNA sequence having anti-tumor function.
2. as shown in Figure 4, p-amiRNA-HIF-1 α construction of recombinant plasmid process, specifically comprises the following steps: according to gained HIF-1 α siRNA sequence, design and synthesize the DNA sequence dna comprising HIF-1 α siRNA sequence, be designated as amiRNA-HIF-1 α.
Sense sequences: 5 '-TGCTGTGTGAGTTCGCATCTTGATGTTTTGGCCACTGACTGACATCAAGATGCGAA CTCACA-3 '
Antisense sequences: 5 '-CCTGTGTGAGTTCGCATCTTGATGTCAGTCAGTGGCCAAAACATCAAGATGCGAAC TCACAC-3 '
The weight of synthesizing the synthetic DNA of 2OD(1 OD value by the raw work in Shanghai is respectively about 33 μ g), use ddH
2o(distilled water) be mixed with 100nM.
Then, by Sense sequences solution 5 μ l+antisense sequences solution 5 μ l+annealing liquid (10 ×) 2 μ l+8 μ l ddH2O (cumulative volume 20 μ l).
Annealing conditions: 95 DEG C, 30sec → 37 DEG C, 1min → 16 DEG C, 5min → 4 DEG C, 10min, obtains the DNA sequence dna (ds oligo) forming double-strand, for the ligation of follow-up T4 enzyme.
3. object fragment is connected with carrier.
5 × Ligase Buffer(damping fluid) 4 μ L
PcDNA
tM6.2-GW/EmGFP-miR vector plasmid 2 μ L
ds oligo（10nM） 4 μL
T
4dNA ligase 1 μ L
ddH
2O 9μL
Total amount 20 μ L
Note: T
4dNA Ligase(T
4dNA ligase) be purchased from TaKaRa company.
16 DEG C connect 2 h, doing from connecting contrast simultaneously, replacing amiRNA-HIF-1 α sequence and pcDNA with water
tM6.2-GW/EmGFP-amiR carrier connects.Products therefrom is as negative control group, and the product be connected with object fragment and carrier carries out competent escherichia coli cell conversion simultaneously.
4. connect the conversion of product.
(1) in ice bath, 6 μ L are connected product to be added to respectively in 30 μ L DH5 α competent cells, rotate mixing gently, ice bath 30 min;
(2) 42 DEG C of water-bath heat-shocked 90 s;
(3) fast pipe is transferred in ice bath, ice bath 2 min;
(4) 200 μ L LB substratum are added respectively, mixing, 37 DEG C, 200 rpm shaking culture 1 h;
(5) bacterium liquid is coated the LB planar surface containing 50 μ g/ml spectinomycins, ambient temperatare is put, to liquid-absorbent;
(6) be inverted flat board, be transferred to 37 DEG C of biochemical cultivation case incubated overnight.
5. plasmid electroresis appraisal and order-checking qualification.
5.1 plasmid electroresis appraisal.
Because the not long bacterium of negative control plates, and object fragment is connected product positive flat board length with carrier has a lot of bacterium, so think that the chief is all positive bacterium colony, chooses 1 and extracts plasmid, is named as amiRNA-HIF-1 α-1.Then operate as follows.
(1) respectively connect 1 bacterium colony incubator overnight in 3mlLB pipe from washer to cultivate.
(2) its plasmid is extracted.
High pure plasmid Mini Kit (purchased from G-SHUN), it is composed as follows:
Extraction plasmid procedure is as follows:
A) collect 3 μ L bacterium liquid with 1.5 mlEP pipes, centrifugal 1 min of 12000 rpm, removes supernatant;
B) 250 μ L solution I/RNase A mixed solutions are added, resuspended thalline;
C) add 250 μ L solution II, gentleness puts upside down mixing 6 times repeatedly, and room temperature places 2 min;
D) add 350 μ L solution III, gentleness puts upside down mixing 6 times repeatedly;
E) the centrifugal 10min of 12000 rpm, carefully sucks supernatant in DNA purification column, leaves standstill 2 min;
F) the centrifugal 1min of 12000 rpm, abandons filtrate;
G) add 500 μ L solution PB in post, the centrifugal 1min of 12000 rpm, abandons filtrate;
H) add 500 μ L solution W in post, the centrifugal 1min of 12000 rpm, abandons filtrate, repeats once;
I) the centrifugal 3min of void column 12000 rpm;
J) post taking-up is placed in new 1.5ml EP pipe, adds 50 μ L sterilized waters (60 DEG C of preheatings), leave standstill the centrifugal 1min of 2min, 13400 rpm, collection tube substrate grain;
Be separated with 1% agarose gel electrophoresis containing ethidium bromide (EB).Electrophoresis result is shown in Fig. 5.
Embodiment 2:amiRNA-HIF-1 α plasmid transfection Human colorectal cancer cells, observation of cell proliferative conditions.
To be incubated at containing 10% new-born calf serum, 100U/ml penicillin, 100 μ g/ml Streptomycin sulphate McCoy ' s 5A perfect medium (37 DEG C of 5% CO
2, saturated humidity) people tie straight cancer HTC-116 cell strain, by 1 × 10
6the amount of individual cells/well inoculates the cell of exponential phase of growth in 24 orifice plates, at 37 DEG C of 5% CO
2incubated overnight in incubator, until cell density reaches 60%-80%.
The Human colorectal carcinoma HCT-116 cell of above-mentioned cellar culture is divided at random blank group, vector plasmid group, recombinant plasmid group, add different plasmids by following dosage respectively and carry out transient transfection.
(1) blank group: normal HCT-116 cell, n=3.
(2) vector plasmid group: p-amiR, n=3.
(3) recombinant plasmid group: p-amiRNA-HIF-1 α, n=3.
Plasmid to be transfected (1.0 μ g/ hole), transfection liposome Hily-Max(4.5 μ L/ hole is prepared in the centrifuge tube of 1.5ml, purchased from Japanese colleague's chemistry institute) mixture, plasmid to be transfected is diluted in McCoy ' the s 5A substratum not containing serum and antibiotic, mix, then by transfection Liposomal suspensions, incubation at room temperature 5 min.Finally both mixed, fully mixing leaves standstill 20min, and plasmid is fully combined with liposome.Then directly join in cell cultures, at 37 DEG C of 5% CO
248h is cultivated in incubator.
The results are shown in Figure 6 and Fig. 7, recombinant plasmid group cell quantity compares obvious minimizing with vector plasmid group with blank group, illustrates that recombinant plasmid can suppress the propagation of colon-cancer cell.
Method provided by the invention prepare containing the recombinant plasmid of amiRNA-HIF-1 α, successfully can be built by biological means, and can effective transfected with human tumour cell; And can prove that this recombinant plasmid can obvious inhibition tumor cell propagation further, thus on this basis can development and production can the medicine of prevention and therapy malignant tumour, suppress the biological processes of malignant tumour, play the effect of prevention and therapy cancer.
Although content of the present invention has done detailed introduction by above preferred embodiment, will be appreciated that above-mentioned description should not be considered to limitation of the present invention.After those skilled in the art have read foregoing, for multiple amendment of the present invention and substitute will be all apparent.Therefore, protection scope of the present invention should be limited to the appended claims.
Claims (10)
1., containing a preparation method for the recombinant plasmid of amiRNA-HIF-1 α sequence, it is characterized in that, it is characterized in that, described method comprises:
Step 1, synthesizes siRNA sequence according to HIF-1 α CDS sequences Design, and carries out 5 ' end 2-methoxyl group and modify, then verifies its validity by cell transfection assays;
Step 2, designs and synthesizes the DNA sequence dna amiRNA-HIF-1 α comprising HIF-1 α siRNA sequence;
Step 3, is connected with vector plasmid ligase enzyme gained amiRNA-HIF-1 α sequence, and the connection product obtained is the described recombinant plasmid containing amiRNA-HIF-1 α;
Step 4, connects product conversion competent escherichia coli cell with step 3 gained and cultivates;
Step 5, cultivates any picking one bacterium colony of gained from step 4 and carries out plasmid extraction, then pass through electroresis appraisal;
Step 6, by the antitumor action of cell experiment checking gained recombinant plasmid.
2. the preparation method of the recombinant plasmid containing amiRNA-HIF-1 α sequence as claimed in claim 1, it is characterized in that, described recombinant plasmid comprises encoding sequence and the vector plasmid DNA sequence of amiRNA-HIF-1 α, comprise the adjustment sequence be connected with amiRNA-HIF-1 α in described vector plasmid DNA sequence, described vector plasmid is the eukaryon expression plasmid that can copy in host and survive.
3. if claim 1 is containing the preparation method of recombinant plasmid of amiRNA-HIF-1 α sequence, it is characterized in that, design and synthesize siRNA sequence described in step 1, object siRNA sequence of its design is: 5 '-UGUGAGUUCGCAUCUUGAU-3 '; Its contrast siRNA sequence is: 5 '-UACACCGUUAGCAGACACC-3 '.
4. if claim 3 is containing the preparation method of the recombinant plasmid of amiRNA-HIF-1 α sequence, it is characterized in that, cell transfection assays described in step 1 comprises: cultivator colorectal cancer HCT-116 cell, and be divided at random blank group, contrast siRNA sequence group, object siRNA sequence group, add empty plasmid respectively, comprise the plasmid of described contrast siRNA sequence and the plasmid that comprises described object siRNA sequence carries out transfection, observe respectively after cultivation.
5. the preparation method of the recombinant plasmid containing amiRNA-HIF-1 α sequence as claimed in claim 1, it is characterized in that, designing and synthesizing described in step 2 comprises the DNA sequence dna of HIF-1 α siRNA sequence, and its Sense sequences is: 5 '-TGCTGTGTGAGTTCGCATCTTGATGTTTTGGCCACTGACTGACATCAAGATGCGAA CTCACA-3 '; Its antisense sequences is: 5 '-CCTGTGTGAGTTCGCATCTTGATGTCAGTCAGTGGCCAAAACATCAAGATGCGAAC TCACAC-3 '.
6. the preparation method of the recombinant plasmid containing amiRNA-HIF-1 α sequence as claimed in claim 5, is characterized in that, described step 2 also comprises the DNA sequence dna making described Sense sequences and antisense sequences annealing form double-strand; Described annealing conditions is 95 DEG C, 30 seconds → 37 DEG C, 1 minute → 16 DEG C, 5 minutes → 4 DEG C, 10 minutes.
7. the preparation method of the recombinant plasmid containing amiRNA-HIF-1 α sequence as claimed in claim 1, it is characterized in that, described step 3 also comprises: do from connecting contrast while being connected with ligase enzyme with vector plasmid gained amiRNA-HIF-1 α sequence, replaces amiRNA-HIF-1 α sequence to be connected with vector plasmid with water; The product of gained is as negative control group, and the product be connected with object fragment and carrier carries out the transformation of E. coli competent cell of step 4 simultaneously.
8., if claim 1 is containing the preparation method of the recombinant plasmid of amiRNA-HIF-1 α sequence, it is characterized in that, the plasmid extraction described in step 5, undertaken by high pure plasmid Mini Kit; Described electroresis appraisal carries out electrophoretic separation with 1% sepharose containing ethidium bromide.
9. if claim 1 is containing the preparation method of the recombinant plasmid of amiRNA-HIF-1 α sequence, it is characterized in that, cell experiment described in step 6 comprises: cultivator colorectal cancer HCT-116 cell, and be divided at random blank group, vector plasmid group, recombinant plasmid group, add empty plasmid, vector plasmid and the described recombinant plasmid containing amiRNA-HIF-1 α respectively and carry out transfection, observe respectively after cultivation.
10. the purposes of recombinant plasmid for the preparation of antitumor drug containing amiRNA-HIF-1 α sequence by preparing as the method in claim 1 ~ 9 as described in any one.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410233294.2A CN104293830A (en) | 2014-05-29 | 2014-05-29 | Preparation method and use of recombinant plasmid containing amiRNA-HIF-1alpha sequence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410233294.2A CN104293830A (en) | 2014-05-29 | 2014-05-29 | Preparation method and use of recombinant plasmid containing amiRNA-HIF-1alpha sequence |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104293830A true CN104293830A (en) | 2015-01-21 |
Family
ID=52313780
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410233294.2A Pending CN104293830A (en) | 2014-05-29 | 2014-05-29 | Preparation method and use of recombinant plasmid containing amiRNA-HIF-1alpha sequence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104293830A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116855496A (en) * | 2023-07-05 | 2023-10-10 | 郑州大学 | Application of expression plasmid containing interference sequence siRNA-HIF-1 alpha in preparation of anti-hepatocellular carcinoma drug |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1831133A (en) * | 2005-03-08 | 2006-09-13 | 上海第二医科大学附属仁济医院 | Interference RNA miniplasmid of hypoxia induction factor |
| CN101326287A (en) * | 2005-12-29 | 2008-12-17 | 爱尔康研究有限公司 | RNAi-mediated inhibition of HIF1A for treatment of ocular angiogenesis |
| CN103314109A (en) * | 2010-12-30 | 2013-09-18 | 株式会社三养生物制药 | SiRNA for inhibition of Hif1a expression and anticancer composition containing same |
-
2014
- 2014-05-29 CN CN201410233294.2A patent/CN104293830A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1831133A (en) * | 2005-03-08 | 2006-09-13 | 上海第二医科大学附属仁济医院 | Interference RNA miniplasmid of hypoxia induction factor |
| CN101326287A (en) * | 2005-12-29 | 2008-12-17 | 爱尔康研究有限公司 | RNAi-mediated inhibition of HIF1A for treatment of ocular angiogenesis |
| CN103314109A (en) * | 2010-12-30 | 2013-09-18 | 株式会社三养生物制药 | SiRNA for inhibition of Hif1a expression and anticancer composition containing same |
Non-Patent Citations (1)
| Title |
|---|
| 丁震宇等: "人HIF-1αRNΑ干扰质粒的构建及其在Lovo细胞中有效性的检测", 《现代生物医学进展》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116855496A (en) * | 2023-07-05 | 2023-10-10 | 郑州大学 | Application of expression plasmid containing interference sequence siRNA-HIF-1 alpha in preparation of anti-hepatocellular carcinoma drug |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6391582B2 (en) | Methods for delivering therapeutic agents | |
| US8361983B2 (en) | Therapeutic RNA interference technology targeted to the PDX-1 oncogene in PDX-1 expressing neuroendocrine tumors | |
| CN108165549B (en) | Universal expression framework of artificial circular RNA and application thereof | |
| CN111617249B (en) | Application of hsa _ circ _0007444 in preparation of medicine for treating ovarian cancer | |
| CN104131033A (en) | AmiRNA-HIF-1alpha sequence containing recombinant plasmid | |
| CN102115762A (en) | Method for establishment of recombinant human colon cancer cell line for high-level expression of human cyclooxygenase-2, and application thereof | |
| CN104293830A (en) | Preparation method and use of recombinant plasmid containing amiRNA-HIF-1alpha sequence | |
| CN105861551A (en) | Vector for jointly expressing MicroRNAs to inhibit breast cancer cell proliferation and construction method and application thereof | |
| CN102140468A (en) | Human miR-185* antisense nucleic acid and application thereof | |
| CN101353656A (en) | siRNA inhibiting expression of epidermal growth factor receptor genes and use thereof | |
| CN110075122A (en) | A kind of liver cancer treatment excretion body drug | |
| CN103834035B (en) | A kind of cationization laminarin and its preparation method and application | |
| Huang et al. | Effects of hTERT antisense oligodeoxynucleotide on cell apoptosis and expression of hTERT and bcl-2 mRNA in keloid fibroblasts. | |
| CN104630221B (en) | Suppress shRNA and its recombinant vector and the application of growth of tumour cell | |
| CN107828787B (en) | Antisense oligonucleotide sequence for inhibiting human SRSF3 gene expression and its application | |
| CN101353655B (en) | siRNA inhibiting expression of vascular endothelial growth factor receptor genes and use thereof | |
| CN107217054B (en) | Application of G6PD gene and expression product thereof in treating colorectal cancer | |
| CN105802899B (en) | Genetically engineered bacterium for inhibiting tumor growth and construction method and application thereof | |
| CN101096670A (en) | siRNA interfering human a-fetoprotein gene and recombinant adenovirus | |
| CN105288660B (en) | Applications of the MiRNA-22 in preparing MMP14 and Snail expression inhibiting agent | |
| CN114164210B (en) | Long-chain non-coding RNA for regulating and controlling protooncogene MYB and application thereof | |
| CN102041270B (en) | Construction and screening of siRNAs (small interfering RANs) expression vectors of gastric cancer targeted DEC1 (differentiated embryo-chondrocyte expressed gene 1) and application thereof | |
| CN103045634A (en) | Cationic liposome compound of cancer suppressor gene LKB1 eukaryotic expression plasmid as well as preparation method and anti-tumor effect thereof | |
| CN110747197B (en) | Application of human endogenous 27nt-miRNA molecule in preparation of antitumor drugs | |
| CN102140467B (en) | Human miR-365 antisense nucleic acid and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150121 |