CN116855474A

CN116855474A - Phospholipase mutant and preparation and application thereof

Info

Publication number: CN116855474A
Application number: CN202310692706.8A
Authority: CN
Inventors: 刘逸寒; 孙慧; 黄芷琪; 路福平
Original assignee: Tianjin University of Science and Technology
Current assignee: Tianjin University of Science and Technology
Priority date: 2023-06-12
Filing date: 2023-06-12
Publication date: 2023-10-10

Abstract

The invention belongs to the technical field of enzyme genetic engineering, and particularly relates to a phospholipase D mutant and preparation and application thereof. The phospholipase D mutant is obtained by mutating 346 th amino acid of a wild phospholipase D amino acid sequence from leucine to methionine through a molecular biological technology means, and the amino acid sequence is shown as SEQ ID NO. 2. Compared with wild phospholipase D, the phospholipase D mutant has obviously improved catalytic activity. The phospholipase D mutant obtained by the invention provides a certain reference for reasonably designing the phospholipase D to improve the catalytic performance of the phospholipase D, can be applied to the production of various natural rare phospholipids and non-natural phospholipid compounds, and is applied to the fields of biology, food, medicine, daily chemicals and the like.

Description

Phospholipase mutant and preparation and application thereof

Technical field:

the invention belongs to the technical field of enzyme genetic engineering, and particularly relates to a phospholipase D mutant and preparation and application thereof.

The background technology is as follows:

phospholipids are the major components of biological membranes in all organisms and are involved in cell signaling, various enzymatic reactions and energy metabolism. Furthermore, phospholipids represent an evolutionary and non-negligible step in the appearance of life. Phospholipids are widely used in the food, pharmaceutical and cosmetic industries due to their numerous nutritional and bioactive functions. Currently, most phospholipids are natural products, and a few are obtained by artificial synthesis. Most of the natural phospholipids are mixtures, and it is difficult to obtain single-function phospholipids. Phospholipase is a generic term for a class of enzymes acting on phospholipids, and phospholipase is mainly classified into phospholipase A1, phospholipase A2, phospholipase B, phospholipase C and phospholipase D according to the hydrolysis site of phospholipase. The synthesis of rare phospholipids and unnatural phospholipid derivatives with specific structures from complex mixtures of phospholipids by using phospholipase has wide application prospects.

Phospholipase D (PLD, ec.3.1.4.4) is a common enzyme, and is present in large amounts in plants, animals and microorganisms. PLD in plant tissues is mostly extracellular enzyme, and the separation and extraction work is relatively simple; PLD in animal tissues is mostly intracellular enzyme, and separation and preparation are difficult. Compared with the prior art, the phospholipase D produced by the microorganism has the advantages of low production cost, short culture period, high phosphatidyl transfer reaction activity, good substrate specificity and the like. Among them, PLDs derived from Streptomyces, such as PLDs derived from Streptomyces PMF, S.chromafuscus and S.antieticus, etc., exhibit a strong transesterification ability and a broader substrate selection spectrum, and thus, have been studied most extensively. PLD can catalyze hydrolysis and phosphatidyl transfer reactions of substrate phospholipids. PLD can catalyze the hydrolysis of phospholipid substrates to generate Phosphatidic Acid (PA) under the action of water molecules; when a suitable second nucleophile substrate is included, PLD can catalyze the transesterification of the polar head of the substrate phospholipid, releasing the original polar head, producing a new phospholipid. Transesterification of PLD is particularly important for functional modification of phospholipids, and can catalyze and synthesize rich PC into other rare phospholipids, such as Phosphatidylserine (PS), phosphatidylglycerol (PG), phosphatidylinositol (PI), phosphatidylethanolamine (PE) and the like. The enzyme modified phospholipids have improved nutritive value and various properties, and are widely used in the fields of foods, health products, medicines, feeds, cosmetics, etc.

Site-directed saturation mutagenesis, i.e., rational design, replaces, deletes or inserts amino acids of proteins based on their spatial structure, active site, catalytic mechanism, etc. The overlap PCR technique is a technique in which primers having complementary ends are used to form overlapping strands in PCR products, and amplified fragments of different sources are spliced together in an overlapping manner by extension of the overlapping strands in a subsequent amplification reaction. The technology is used for carrying out site-directed mutagenesis on the gene sequence, thereby realizing the directional transformation of the protein, and being reasonable and practical.

As a genetic engineering expression system, the bacillus expression system is widely researched and applied because of the advantages of easy separation and purification of exogenous proteins, no inclusion body formed by the expressed exogenous proteins, no pathogenicity and the like, and a plurality of industrial enzymes are successfully expressed in the bacillus expression system. Therefore, in the invention, the phospholipase D gene from the streptomyces antibioticus is subjected to molecular modification by overlapping PCR, and the bacillus subtilis expression system is utilized for high-throughput screening, so that the phospholipase D mutant gene with improved enzyme activity is obtained.

The invention comprises the following steps:

the invention aims to solve the technical problems that the existing natural phospholipase D (PLD) is insufficient, mutants are obtained through directed evolution, and the mutants are expressed, so that the enzymatic synthesis of the natural phospholipids and derivatives thereof is realized. In order to achieve the above purpose, the technical scheme adopted by the invention is as follows: based on the wild-type phospholipase D from the antibiotic streptomycete TCC 21059, the PLD mutant is obtained by mutating the 346 th amino acid from leucine to methionine through molecular biological technology means. Recombinant vectors are constructed through enzyme digestion, connection and the like, the high-efficiency expression of the recombinant vectors in bacillus subtilis and bacillus amyloliquefaciens is realized, and PLD mutants with improved enzyme activity are obtained through fermentation, extraction and other technologies.

One of the technical schemes provided by the invention is a PLD mutant, the amino acid sequence of the mutant is shown as SEQ ID NO.2, and the mutant is obtained by L346M mutation on wild PLD shown as SEQ ID NO. 1;

furthermore, the invention also provides a coding gene of the PLD mutant, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 4.

The second technical scheme provided by the invention is a recombinant vector or recombinant strain containing the encoding gene of the PLD mutant;

further, the expression vector used by the recombinant vector is an escherichia coli-bacillus subtilis shuttle plasmid pBSA43;

further, the host used by the recombinant strain is bacillus subtilis WB600 and bacillus amyloliquefaciens CGMCC No.11218.

The third technical scheme provided by the invention is the application of the recombinant vector or recombinant strain, in particular to the application in producing PLD mutant shown in SEQ ID NO. 2.

The fourth technical scheme provided by the invention is the application of PLD mutant shown in SEQ ID NO.2, especially the application in preparing glycerophospholipids and derivatives thereof, more especially the application in preparing non-natural phospholipid derivatives;

further, the PLD mutant shown in SEQ ID NO.2 is applied to catalytic synthesis of Phosphatidylserine (PS), phosphatidylglycerol (PG), phosphatidylinositol (PI), phosphatidylethanolamine (PE), phosphatidylglucose, phosphatidylamino sugar or phosphatidylfructose and the like;

further, the PLD mutant can be used in forms including, but not limited to, enzyme solutions, enzyme powders, emulsions, gels, immobilized enzymes, and the like.

The beneficial effects are that:

1. the invention uses overlap PCR technology to make site-directed saturation mutation on wild PLD, the specific activity of mutant L346M is 10.3 times of that of WT, the reaction condition is mild (PLD mutant optimum temperature is 70 ℃, optimum pH is 7.0), and the yield of phosphatidyl choline and serine obtained by catalyzing phosphatidyl choline and serine is 6.04 times of that of wild PLD.

2. The invention respectively uses a bacillus subtilis expression system and a bacillus amyloliquefaciens expression system to realize the high-efficiency expression of PLD mutants in different modes.

3. The invention utilizes mutant to catalyze and synthesize PS, PG, PI, PE, phosphatidyl glucose, phosphatidyl amino sugar, phosphatidyl fructose and other phospholipid derivatives.

Description of the drawings:

FIG. 1 is a PCR amplification electrophoretogram of the wild-type PLD gene of the present invention;

FIG. 2 is a diagram showing the cleavage assay of the recombinant plasmid pBSA43-pldmL346M of the present invention;

wherein: 1 is bacillus subtilis and 2 is bacillus amyloliquefaciens.

FIG. 3 is a thin layer chromatography of the wild type and mutant catalyzed phosphoserine production of the present invention;

wherein: WT is wild-type PLD, L346M is mutant L346M.

FIG. 4 is a SDS-PAGE map of the mutant L346M of the present invention after purification;

FIG. 5PLD wild type and mutant optimal temperature curves;

wherein: WT is wild-type PLD, L346M is mutant L346M.

FIG. 6PLD optimal pH profile for wild type and mutant.

Wherein: WT is wild-type PLD, L346M is mutant L346M.

FIG. 7 temperature stability of PLD wild type and mutant L346M.

FIG. 8 pH stability of PLD wild type and mutant L346M.

The specific embodiment is as follows:

the technical contents of the present invention will be further described with reference to examples, but the present invention is not limited to these examples, and the scope of the present invention is not limited to the following examples.

The culture medium used in the embodiment of the invention is as follows:

LB medium: 5g/L of yeast extract, 10g/L of tryptone, 10g/L of NaCl and the balance of water.

The solid medium of the above medium was supplemented with 2% agar.

The solutions used in the present invention and examples are as follows:

20mM phosphate buffer: 38mL of 0.2M NaH ₂ PO ₄ ，62mL 0.2M Na ₂ HPO ₄ ，pH 7.0。

SP salt solution (1L): k (K) ₂ HPO ₄ 18.34g，KH ₂ PO ₄ 6.0g，(NH ₄ ) ₂ SO ₄ 2.0g, sodium citrate 1.0g, mgSO ₄ ·7H ₂ O0.2 g, 800mL of water is added for dissolution, and after complete dissolution, water is added for volume fixing to 1L.

SP I medium (200 mL): 195.2mL of SP salt solution, 0.8mL of 5% casein hydrolysate, 2mL of 10% yeast juice and 2mL of 5% glucose solution, respectively taking 5mL of mixed solution, subpackaging into sterilized empty test tubes, and preserving at 4 ℃.

SP II medium: 292.8mL of SP salt solution, 1.2mL of 5% casein hydrolysate, 3mL of 10% yeast juice, 3mL of 5% glucose solution, 1.5mL of 100mM calcium chloride and 1.5mL of 50mM magnesium chloride, respectively taking 2mL of mixed solution, packaging into sterilized empty test tubes, and preserving at 4 ℃.

LBS medium: 91.1g of sorbitol, 10g of NaCl,5g of yeast extract, 10g of tryptone are dissolved in 1L of water.

Wash Buffer (mM): weighing NaCl 29.25g,Tris 2.42g, dissolving 3.5g of imidazole in ultrapure water to a volume of 1L, removing impurities by using a 0.22 mu m microporous membrane, and then placing in a refrigerator at the temperature of 4 ℃ for light-shielding storage.

ElutionBuffer (mM): weighing NaCl 29.25g,Tris 2.42g, dissolving 13.6g of imidazole in ultrapure water to a volume of 1L, removing impurities by using a 0.22 mu m microporous membrane, and then placing in a refrigerator at the temperature of 4 ℃ for light-shielding storage.

Lysis Buffer (mM): weighing NaCl 29.25g,Tris 2.42g, dissolving imidazole 1.4g in ultrapure water, fixing the volume to 1L, removing impurities by using a 0.22 mu m microporous membrane, and then placing in a refrigerator at 4 ℃ for light-shielding storage.

The following definitions are employed in the present invention:

1. nomenclature of amino acids and DNA nucleic acid sequences

Using the accepted IUPAC nomenclature for amino acid residues, three letter/single letter codes are used. The DNA nucleic acid sequence uses accepted IUPAC nomenclature.

2. Identification of phospholipase mutants

"amino acid substituted at the original amino acid position" is used to denote the mutated amino acid in the mutant. Like L346M, it is indicated that the amino acid at position 346 is replaced by Met from the wild-type Leu, the numbering of the position corresponding to the amino acid sequence numbering of the wild-type phospholipase in SEQ ID NO. 1.

In the present invention, lower case italics pld indicates a gene encoding a wild-type phospholipase, lower case italics pldmL346M indicates a gene encoding a mutant L346M, and information is as follows.

Phospholipase enzyme	Amino acid mutation site	Amino acid SEQ ID NO.	Nucleotide SEQ ID NO.
				Wild type	Leu346	1	3
L346M	Leu346Met	2	4

The partial sequence related to the invention is as follows:

the wild PLD is shown in SEQ ID NO. 1:

ADTPPTPHLDAIERSLRDTSPGLEGSVWQRTDGNRLDAPDGDPAGWLLQTPGCWGDAGCKDRAGTRRLLDKMTRNIADARHTVDISSLAPFPNGGFEDAVVDGLKASVAAGHSPRVRILVGAAPIYHLNVVPSRYRDELIGKLGAAAGKVTLNVASMTTSKTSLSWNHSKLLVVDGKTAITGGINGWKDDYLDTAHPVSDVDMALSGPAARSAGKYLDTLWDWTCRNASDPAKVWLATSNGASCMPSMEQDEAGSAPAEPTGDVPVIAVGGLGVGIKESDPSSGYHPDLPTAPDTKCTVGLHDNTNADRDYDTVNPEENALRSLIASARSHVEISQQDLNATCPPLPRYDIRTYDTLAGKLAAGVKVRIVVSDPANRGAVGSGGYSQIKSLDEISDTLRTRLVALTGDNEKASRALCGNLQLASFRSSDAAKWADGKPYALHHKLVSVDDSAFYIGSKNLYPAWLQDFGYIVESPAAAQQLKTELLDPEWKYSQQAAATPAGCPARQAG

the PLD mutant is shown in SEQ ID NO. 2:

ADTPPTPHLDAIERSLRDTSPGLEGSVWQRTDGNRLDAPDGDPAGWLLQTPGCWGDAGCKDRAGTRRLLDKMTRNIADARHTVDISSLAPFPNGGFEDAVVDGLKASVAAGHSPRVRILVGAAPIYHLNVVPSRYRDELIGKLGAAAGKVTLNVASMTTSKTSLSWNHSKLLVVDGKTAITGGINGWKDDYLDTAHPVSDVDMALSGPAARSAGKYLDTLWDWTCRNASDPAKVWLATSNGASCMPSMEQDEAGSAPAEPTGDVPVIAVGGLGVGIKESDPSSGYHPDLPTAPDTKCTVGLHDNTNADRDYDTVNPEENALRSLIASARSHVEISQQDLNATCPPMPRYDIRTYDTLAGKLAAGVKVRIVVSDPANRGAVGSGGYSQIKSLDEISDTLRTRLVALTGDNEKASRALCGNLQLASFRSSDAAKWADGKPYALHHKLVSVDDSAFYIGSKNLYPAWLQDFGYIVESPAAAQQLKTELLDPEWKYSQQAAATPAGCPARQAG

the invention will be further illustrated by the following examples.

Example 1: obtaining of wild-type PLD Gene

1. The wild-type PLD gene was derived from the laboratory-stored strain of Streptomyces antibioticus (Streptomyces antibioticus) TCC 21059, and the genome was extracted as described using Bacterial DNAKit D3350-02 from OMEGA, USA.

(1) Strain activation: dipping the streptomyces antibiotic spore liquid from a glycerol tube by using an inoculating loop, inoculating the streptomyces antibiotic spore liquid on a solid culture medium plate, and culturing for 5-6 days at the constant temperature of 28 ℃ by using three-area lines;

(2) And (3) switching: washing spores with sterile water, centrifuging at 12000r/min for 1min, repeatedly cleaning, transferring into 50mL liquid culture medium, placing into a shaking table at 28deg.C at 200r/min, and culturing for 24 hr;

(3) And (3) collecting thalli: taking a proper amount of culture bacterial liquid, subpackaging the culture bacterial liquid in a 1.5mL EP tube, centrifuging for 2min at 12000r/min, and discarding the supernatant;

(4) Add 250. Mu.L ddH ₂ O, re-suspending the thallus, adding 50 mu L of 50mg/mL lysozyme, and carrying out water bath at 37 ℃ for 10min;

(5) 100. Mu.L of BTL Buffer and 20. Mu.L of proteinase K were added and vortexed;

(6) Carrying out water bath at 55 ℃ for 40-50min, and oscillating and uniformly mixing every 20-30 min;

(7) Adding 5 mu L of RNase, reversing and mixing for several times, and standing at room temperature for 5min;

(8) Centrifuge at 12000rpm for 2min, remove undigested fraction, transfer supernatant fraction to a new 1.5mL EP tube;

(9) Adding 220 μl BDL Buffer, shaking, mixing, and water-bathing at 65deg.C for 10min;

(10) Adding 220 mu L absolute ethyl alcohol, blowing, sucking and mixing uniformly;

(11) Transferring to adsorption column, standing for 1min, centrifuging at 12000rpm for 1min, and discarding filtrate;

(12) Adding 500 μl HBC Buffer, centrifuging at 12000rpm for 1min, and discarding the filtrate;

(13) Adding 700 μl DNAWAsh Buffer, centrifuging at 12000rpm for 1min, and discarding the filtrate;

(14) Adding 500 μl DNAWAsh Buffer, centrifuging at 12000rpm for 1min, and discarding the filtrate;

(15) Centrifuging at 12000rpm for 2min, and air drying at 55deg.C for 10min;

(16) Add 40. Mu.L ddH ₂ O elutes and stores the gene at-20deg.CA group.

2. Amplification of the wild-type PLD-encoding Gene pldm

And (3) amplifying the genome obtained in the step (1) to obtain a wild PLD coding gene PLD.

The sequences of the primers (upstream primer F1 and downstream primer R1) of the wild-type PLD-encoding gene PLD are as follows:

F1:CGCGGATCCGCAGATACGCCGCCGA (BamHI cleavage site in the scribe line)

R1:AAGGAAAAAAGCGGCCGCTTAGTGGTGGTGGTGGTGGTGACCAGCTTGGCGAGCG (Not I cleavage site in the underlined part);

the reaction system for PCR amplification was 50. Mu.L, and the composition thereof was:

Prime STAR Max	25μL
		upstream primer F1 (20. Mu. Mol/L)	2μL
Downstream primer R1 (20. Mu. Mol/L)	2μL
		Genome (genome)	2μL
ddH ₂ O	19μL
		Total volume of	50μL

Note that: the above reagents were obtained from Takara, takara Bio Inc.

The amplification procedure was set up as follows: pre-denaturation at 97℃for 30s; denaturation: 97 ℃ for 10s; annealing: 45s at 56 ℃; extension: 72 ℃ for 10s; the reaction was carried out for 30 cycles; extension: and at 72℃for 10min.

The PCR product was subjected to agarose gel electrophoresis, the band of the wild-type PLD gene was about 1500bp (see FIG. 1), and the PCR product was recovered by a DNA gel cutting recovery kit and sent to a sequencing company for sequencing, thereby obtaining a wild-type PLD gene sequence (shown in SEQ ID NO. 3). The pBSA43 plasmid is extracted, the vector plasmid pBSA43 and the target gene pld are subjected to double enzyme digestion by restriction enzymes BamHI and NotI, pld recovered by gel cutting is connected with the vector pBSA43 to obtain recombinant plasmids pBSA43-pld, and the recombinant plasmids are transformed into bacillus subtilis WB600 to obtain recombinant strains WB600/pBSA43-pld.

Example 2: acquisition of PLD mutant L346M

1. Overlapping PCR: overlapping PCR was performed on the basis of the wild-type pld gene, and the mutant primers (upstream primer F2, downstream primer R2) and the reaction system were designed as follows:

F2：ATGTCCGCCGNNKCCGCGCTA

R2：TAGCGCGGMNNCGGCGGACAT

in the first step of overlapping PCR reaction system, F1 and R2 are used as upstream and downstream primers, and F2 and R1 are used as upstream and downstream primers. The plasmid pBSA43-pld is used as a template for PCR reaction to obtain an upstream fragment and a downstream fragment respectively.

The reaction system for amplifying the upstream fragment is as follows:

upstream primer F1 (20. Mu. Mol/L)	2μL
		Downstream primer R2 (20. Mu. Mol/L)	2μL
pBSA43-pld	2μL
		Primer Star Max	25μL
ddH ₂ O	19μL

The reaction system for amplifying the downstream fragment is as follows:

upstream primer F2 (20. Mu. Mol/L)	2μL
		Downstream primer R1 (20. Mu. Mol/L)	2μL
pBSA43-pld	2μL
		Primer Star Max	25μL
ddH ₂ O	19μL

The amplification procedure was: pre-denaturation at 98 ℃ for 30min; denaturation at 98℃for 10s, annealing at 54℃for 20s, extension at 72℃for 7s for 30 cycles; extending at 72℃for 10min.

And (3) cutting the gel, recovering the upstream and downstream fragments, and performing PCR reaction, wherein the reaction system is as follows:

upstream fragment	2.0μL
		Downstream fragment	2.0μL
Primer Star Max	25μL
		ddH ₂ O	21μL

The amplification procedure was: pre-denaturation at 98 ℃ for 30s; denaturation at 98℃for 10s, annealing at 54℃for 20s, extension at 72℃for 7s, 5 cycles; extending at 72℃for 10min.

After the PCR was completed, 2. Mu.L of each of the upstream primer F1 and the downstream primer R1 was added to the system, and PCR was performed by the following amplification procedure: pre-denaturation at 98 ℃ for 30s; denaturation at 98℃for 10s, annealing at 54℃for 20s, extension at 72℃for 10s, 30 cycles; extending at 72℃for 10min. The PCR amplified product was subjected to agarose gel electrophoresis, and the PCR product was recovered using a small amount of DNA recovery kit.

After the PCR reaction is finished, the PCR product and the carrier plasmid are subjected to BamHI and NotI double digestion, purified and recovered, the PCR product is connected with the carrier plasmid pBSA43 subjected to BamHI and NotI double digestion, bacillus subtilis WB600 is transformed, the mixture is coated on LB solid medium containing kanamycin resistance, and the mixture is subjected to static culture in a culture box at 37 ℃ for 12 hours, so that a transformant is obtained. A library of mutants mutated at position L346 was obtained.

2. Primary screening of high-activity mutants: adding 1mL of LB culture medium and corresponding resistance to calicheamicin into a sterilized 48-well plate, selecting single colony of recombinant bacillus subtilis WB600 obtained in the step 1, inoculating into a 48-deep-well plate, performing blank control, performing shake culture at 37 ℃ at 600r/min for 48h, and performing OD (optical density) culture on the obtained recombinant bacillus subtilis WB600 ₆₀₀ The concentration of the bacterial liquid was measured, and the supernatant obtained by a well plate centrifuge (5000 r/min,30 min) was used as an enzyme liquid to perform a catalytic reaction.

The reaction system for catalyzing and synthesizing phosphatidylserine is as follows: 1.5mL of 4.4mM PC (diethyl ether-dissolved), 1mL of 52.8mM L-serine (0.2M acetic acid-sodium acetate buffer pH 5.5-dissolved), 500. Mu.L of enzyme solution, and the reaction was shaken in a water bath (40 ℃ C., 200rpm,20 min), extracted with chloroform: methanol (2:1, v/v), and then subjected to thin layer chromatography.

The transformant containing the mutant is subjected to primary screening by using a thin layer chromatography technology, and the specific steps are as follows:

(1) Preparing a developing agent: n-butanol/glacial acetic acid/95% ethanol/water/0.1% ninhydrin solution (4:1:1:2:2, v/v/v/v/v);

(2) Pouring the developing agent into a developing cylinder, standing for 10min, and scribing at a position 1.5cm away from the lower end of the silica gel plate;

(3) Sample application is carried out on the sample to be measured and the standard sample by using a capillary on a silica gel plate;

(4) Obliquely placing into a spreading jar, taking out when the distance from the top is about 1cm, drying at 105 ℃ for 10min, iodizing for 30s, developing serine into purple spots, developing PS into purple spots, and developing PC into yellow spots. Mutants with highest activity improvement (see FIG. 3) were obtained, and plasmids were extracted for sequencing. Enzyme digestion verification (shown as lane 1 in FIG. 2) shows that a high-activity mutant L346M is obtained, the corresponding coding gene is pldmL346M, the plasmid containing the gene is named pBSA43-pldmL346M, and the recombinant strain is named bacillus subtilis recombinant strain WB600/pBSA43-pldm L346M.

3. And (3) re-screening:

(1) The wild-type phospholipase-expressing Bacillus subtilis strain WB600/pBSA43-pld and the L346M-expressing Bacillus subtilis transformant WB600/pBSA43-pldm L346M described above were respectively activated in solid plate medium, single colonies were picked up and inoculated in 5mL of liquid LB medium (Kan-resistant), shake-cultured at 37℃at 220rpm for 8 hours, and transferred in 50mL of liquid LB medium (Kan-resistant) at 2% of the inoculum size, shake-cultured at 37℃at 220rpm for 48 hours, and the supernatants were centrifuged to obtain a crude enzyme solution.

(2) Preparing pure enzyme solution: with ddH ₂ O cleaning Ni in chromatographic column ²⁺ Resin, rinse off residual ethanol, then add two column volumes of Lysis Buffer to balance the pH of the resin;

respectively mixing the wild-type crude enzyme solution and the L346M crude enzyme solution prepared in the step (1) with pretreated Ni ²⁺ Mixing resin, combining (100 r/min) for 60min, and pouring into chromatographic column to obtain Ni ²⁺ Depositing resin in the column, completely draining filtrate, adding 10mL Wash Buffer to Wash out the impurity protein with weak binding force;

after Wash Buffer is drained, 10mL Elution Buffer is added to elute the target protein bound on the resin, and the filtrate containing the target protein flowing out at the moment is collected;

the collected filtrate contained imidazole at a higher concentration, which had an influence on the subsequent experiments, so that imidazole was replaced with Tris-HCl (pH 7.0, 50 mM), and the purified enzyme solution was collected and analyzed by SDS-PAGE, and as a result, a single band of 54kDa was obtained as shown in FIG. 4.

(3) The enzyme activity determination method comprises the following steps: the transesterification activity was determined by catalytic synthesis of PS using PC and L-serine as substrates. The reaction was carried out in a biphasic system, essentially comprising 3mL of 0.022M PC (dissolved in diethyl ether), 2mL of 0.264M L-serine (dissolved in 0.2mol/L acetic acid-sodium acetate buffer, pH 5.5) and 1mL of enzyme solution, and was reacted in a water bath at 40℃for 20min. After the completion of the reaction, a chloroform/methanol (2:1, v/v) solution was added to extract.

After the catalytic reaction, the phospholipids (PC and PS) in the reaction mixture were analyzed by hplc using an agilent 1260 hplc uv detector. The chromatographic column is Venusil XBP Silica (5 μm, 2.1X106 mm), the mobile phase is acetonitrile/methanol/85% phosphoric acid (95:5:0.8, v/v/v), the ultraviolet detection wavelength is 205nm, the flow rate is set to 0.3mL/min, the column temperature is maintained at 25 ℃, and the sample injection amount is 10 mu L. PS standard solutions with concentrations of 0.2mg/mL, 0.4mg/mL, 0.6mg/mL, 0.8mg/mL, 1.0mg/mL, 1.5mg/mL and 2.0mg/mL were respectively prepared for the above detection, and standard curves were drawn.

Definition of enzyme activity: under the above-mentioned catalytic conditions (pH 5.5, temperature 40 ℃ C.) the amount of enzyme required to produce 1. Mu. Mol of PS per minute using PC and L-serine as substrates was defined as one enzyme activity unit, and was designated U/mL.

(4) Optimum temperature: by adopting the enzyme activity measuring method, the enzyme activities of the pure enzyme solutions of the wild PLD and the mutant L346M are respectively measured at 30 ℃,40 ℃,50 ℃,60 ℃, 70 ℃ and 80 ℃, the highest activity is taken as 100%, the relative activities of the enzyme solutions at all temperatures are calculated, the optimal temperature curve is shown in figure 5, the optimal temperature of the wild PLD and the mutant L346M is 60 ℃, and the optimal temperature of the mutant L346M is 70 ℃.

Optimum pH: by adopting the enzyme activity determination method, the pure enzyme solutions of the wild PLD and the mutant L346M are respectively determined in acetic acid-sodium acetate buffer solutions with pH of 4.0, pH of 5.0, pH of 6.0, pH of 7.0 and pH of 8.0 at 60 ℃ (wild type) and 70 ℃ (mutant), the relative activity of the wild PLD and the mutant L346M at each pH is calculated by taking the highest activity as 100%, the optimal pH curve is shown in figure 6, the optimal pH of the WT is 6.0, and the optimal pH of the mutant is 7.0.

Temperature stability: the pure enzyme solutions of WT and L346M were incubated at 40℃and 50℃and 60℃and 70℃for 2 hours, respectively, and residual enzyme activities were measured under the optimum conditions after the incubation was completed, and the results are shown in FIG. 7. After incubation for 2h at 40 ℃, the residual enzyme activity of L346M was almost unchanged from the initial enzyme activity, whereas the residual enzyme activity of WT was 74%. After incubation at 50 ℃ for 2h, the residual enzyme activity of L346M was 77% of the initial, and the residual enzyme activity of WT was only 31% of the initial enzyme activity. After incubation at 60℃for 2h, the residual enzyme activity of L346M was 61% and that of WT was only 9%. After incubation at 70℃for 2h, WT was inactivated and L346M had a residual enzyme activity of 42%.

pH stability: the purified enzyme solutions of WT and L346M were stored at a low temperature of 4℃for 5 days in buffers of pH (6.0, 7.0 and 8.0), respectively, and then the residual enzyme activities were measured under the respective optimum conditions, and the results are shown in FIG. 8. The residual enzyme activity of L346M stored at different pH values is still more than 90%, which shows that L346M can maintain good stability within the pH range of 6.0-8.0.

Specific enzyme activity determination: measuring the enzyme activity of a Wild Type (WT) pure enzyme solution under the optimal temperature of 60 ℃ and the optimal pH of 6.0 reaction conditions; the enzyme activity of the pure enzyme solution of mutant L346M was measured at an optimum temperature of 70℃and under optimum reaction conditions of pH 7.0. The specific enzyme activity was calculated, and the result showed that the specific enzyme activity of the wild type was 0.33U/mg, and the specific enzyme activity of L346M was 3.40U/mg, which was 10.3 times that of the wild type. The mutant L346M with obviously improved enzyme activity is obtained through screening.

Example 3: construction of recombinant strain expressing PLD mutant of Bacillus amyloliquefaciens

1. Construction of Bacillus amyloliquefaciens mutant PLD high expression recombinant Strain

Preparing bacillus amyloliquefaciens CGMCC No.11218 competent:

(1) Activating strains and culturing for 24 hours at 37 ℃;

(2) Single colony is selected and inoculated to LBS culture medium, and cultured for 12 hours at 220rpm in a 37 ℃ incubator;

(3) Inoculated to 100mL of LBS medium at an inoculum size of 2%, cultured at 220rpm in an incubator at 37℃for 2.5 hours to make OD ₆₀₀ Centrifuging to remove supernatant at 0.4-0.6;

(4) The cells were resuspended in 30mL of wash buffer (0.5M sorbitol, 0.5M mannitol, 10% glycerol), the supernatant was discarded by centrifugation and the wash repeated 3 times;

(5) The cells were resuspended in 10mL of buffer (0.5M sorbitol, 0.5M mannitol, 10% glycerol, 14% PEG 6000) and sub-packaged for storage at-80 ℃.

Bacillus amyloliquefaciens: cleaning the electric rotating cup by 75% alcohol; 10ng of recombinant plasmid (pBSA 43-pldmL 346M) and 100 mu L of competent were mixed evenly and transferred to an electric rotating cup, and ice-bathed for 2min;2100-2500V, electric shock 4-6ms later, 1mL of resuscitation fluid (LB+0.5M sorbitol+0.38M mannitol) is immediately added, the mixture is resuscitated at 37 ℃ and 220rpm for 2-3h, the mixture is spread on a solid culture medium plate containing kanamycin resistance, transformants are picked up, plasmids are extracted, and enzyme digestion verification is carried out (as shown in lane 2 of FIG. 2), so that the bacillus amyloliquefaciens recombinant strain CGMCC No.11218/pBSA43-pldmL346M containing pBSA43-pldmL346M is obtained.

The wild PLD recombinant strain CGMCC No.11218/pBSA43-PLD is prepared by the same method.

Example 4: expression and preparation of PLD mutant L346M in bacillus amyloliquefaciens

1. Activating bacillus amyloliquefaciens recombinant strains CGMCC No.11218/pBSA43-pldmL346M and CGMCC No.11218/pBSA43-pld respectively;

2. transferring into 50mL of LB culture medium (containing kanamycin resistance) according to 2% inoculum size, culturing at 37deg.C and 220r/min for 48h, centrifuging at 12000rpm for 10min, and collecting fermentation supernatant to obtain L346M crude enzyme solution and wild PLD crude enzyme solution respectively;

3. enzyme activity determination:

the transesterification activity of PLD was determined by the amount of PS produced under the action of PLD using PC and L-serine as substrates. The reaction was carried out in a biphasic system, essentially comprising 3mL of 0.022M PC (dissolved in diethyl ether), 2mL of 0.264M L-serine (dissolved in 0.2mol/L acetic acid-sodium acetate buffer, pH 7.0) and 1mL of enzyme solution, and was reacted in a water bath at 70℃for 20 minutes. After the completion of the reaction, a chloroform/methanol (2:1, v/v) solution was added to conduct extraction (L346M at 70 ℃, pH 7.0; wild type at 60 ℃, pH 6.0).

Under the above-mentioned catalytic conditions, the amount of enzyme required to produce 1. Mu. Mol of PS per minute was defined as one enzyme activity unit, which was designated U/mL, using PC and L-serine as substrates. The results showed that in the bacillus amyloliquefaciens expression system, the wild type enzyme activities were: 3.53U/mL, the L346M enzyme activity was 37.74U/mL.

Example 5: preparation of phosphatidylserine

mu.L of the L346M crude enzyme solution prepared in example 4/wild-type PLD crude enzyme solution was added to 1.5mL of a 0.017g/mL PC-diethyl ether solution and 1mL of a 0.0625g/mL serine-sodium acetate solution (pH 5.5), catalyzed by a 40℃water bath shaker at 150rpm for 3 hours, extracted overnight in a chloroform/methanol (2:1, v/v) in the absence of light, and the PS yield was determined by high performance liquid chromatography, the yield of the wild-type PLD catalyzed PS was 11.26%, and the yield of the mutant L346M catalyzed PS was 68%, which was 6.04 times that of the wild-type PLD (PS yield (mol%) =PS yield/initial PC amount. Times.100%).

The above examples merely represent a few embodiments of the present invention, which are described in more detail and are not to be construed as limiting the scope of the patent. It should be noted that the above-described embodiments are susceptible to numerous variations, combinations and modifications without departing from the spirit of the present patent, all of which are intended to fall within the scope of the appended claims.

Claims

1. A phospholipase D mutant is characterized in that the phospholipase D mutant is obtained by mutating amino acid 346 of an amino acid sequence of wild type phospholipase D from leucine to methionine, and the amino acid sequence of the mutant is shown as SEQ ID No. 2.

2. The phospholipase D mutant of claim 1, wherein the amino acid sequence of the mutant has greater than 75% homology with the sequence of SEQ ID No.2 of claim 1.

3. A gene encoding the phospholipase D mutant of claim 1.

4. The coding gene of claim 3, wherein the nucleotide sequence is set forth in SEQ ID No. 4.

5. A recombinant vector or recombinant strain comprising the coding gene of claim 3.

6. The recombinant vector according to claim 5, wherein the expression vector used is a pBSA43 plasmid.

7. The recombinant strain of claim 5, wherein the host bacteria are bacillus subtilis WB600 and bacillus amyloliquefaciens CGMCC No.11218.

8. Use of the recombinant vector or recombinant strain of claim 5 for the production of the phospholipase D mutant of claim 1.

9. Use of a phospholipase D mutant according to claim 1.

10. The use according to claim 9, in the preparation of glycerophospholipids and derivatives thereof.